Overview

Brief Summary

The alewife, Alosa pseudoharengus, known as gaspereau in Atlantic Canada, is a small (about 30 cm long, 400 g) fish in of the shad/river herring genus Alosa that occurs in two forms: anadromous alewife spend most of their life in the western Altantic ocean but migrate into freshwater rivers in order to spawn, and the somewhat smaller landlocked form lives its full life in freshwater lakes. They are opportunistic feeders that eat zooplankton, insect larvae and adults, small fish, fish eggs, and can filter-feed through their gillrakers. The native range of alewife extends along the Atlantic seaboard from Labrador, Canada to North Carolina, USA. In its native range it is a valued food fish, and in some places anadromous populations are in danger of decline from overfishing, dams which block alewife access to spawning zones, and pollution. The US National Marine Fisheries Service classifies alewife as a “species of concern.” However, alewife can also invade land-locked lakes and waterways, and in this form can overpopulate, affecting populations of native fish and causing sanitary problems with large scale die-offs. A well-known example is the invasion of alewifes into the great lakes (especially Huron and Michigan) between 1930-1950, after the completion of the Welland canal.

(CABI 2011; Faria, Weiss and Alexandrino, 2006; Fisheries and Oceans Canada, 2011; NOAA 2009; WIkipedia 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Movement of schooling adults apparently restricted to coastal areas proximal to natal estuaries (Ref. 4639). They migrate up rivers and even small streams to spawn in lakes and quiet stretches of rivers, then return to sea shortly after spawning (Ref. 4639); landlocked populations also ascend affluent rivers and streams. Larvae remain in vicinity of spawning grounds, forming schools at sizes less than 10 mm TL, within one to two weeks after hatching (Ref. 4639), then descend in summer and autumn or even as late as November or December. Feed on shrimps and small fishes; the young on diatoms, copepods and ostracods while in rivers. Utilized fresh, dried or salted, smoked and frozen; eaten fried (Ref. 9988). Also used for crab and lobster bait and sometimes for pet food (Ref. 9988). Parasites found are Acanthocephala, cestodes, trematodes and copepods. Overfishing, pollution and impassable dams cause the decline of stocks (Ref. 37032).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gazi Bay, Gulf of Maine, Gulf of St. Lawrence, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Alewives are native to the Atlantic Ocean and the lakes and streams that drain to it from Newfoundland to North Carolina. They are "anadromous", which means that they live most of their lives in the sea but migrate into freshwater rivers and streams to breed. They are present, but non-native, in all of the Great Lakes and many lakes in northern New York. In the Great Lakes they are now abundant in Lake Huron and Lake Michigan. Alewives don't do well in Lake Superior because the water is too cold and Salvelinus namaycush prey heavily on them there. They don't do well in Lake Erie because the lake is too shallow to provide suitable overwintering grounds for large numbers of fish.

Several theories exist on how alewives could have become established in the Great Lakes. Scott and Crossman suggest that alewives may have been accidentally included in a batch of Alosa sapidissima that were used to stock Lake Ontario. The alewives also could have migrated from Lakes Seneca and Cayuga in New York to the Great Lakes through the St. Lawrence River. A third argument for the current distribution is that alewives were native to Lake Ontario in small numbers but went unnoticed until a population explosion in 1873.

Biogeographic Regions: nearctic (Introduced , Native )

  • Scott, W., E. Crossman. 1998. The Freshwater Fishes of Canada. Oakville, Ontario, Canada: Galt House Publications Ldt..
  • Scott, W., M. Scott. 1988. Atlantic Fishes of Canada. Toronto, Canada: Canadian Bulletin of Fisheries and Aquatic Science (University of Toronto Press).
  • Daniels, R. 2001. Untested assumptions: the role of canals in the dispersal of sea lamprey, alewife, and other fishes in the eastern United States. Environmental Biology of Fishes, 60: 309-329.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: Atlantic coast from the Gulf of St. Lawrence and Nova Scotia to North Carolina and in streams and rivers; also occurs in Lake Seneca and Cayuga; introduced into Lake Ontario, now landlocked there and in Lakes Erie, Huron, Michigan and Superior.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Alosa pseudoharengus (Wilson, 1811) is an anadromous species, native to the Atlantic Ocean and the lakes and streams that drain to it from Newfoundland to North Carolina (Scott and Crossman, 1998). This includes the Gulf of St. Lawrence, the outer coast of Nova Scotia, the Bay of Fundy, and the Gulf of Maine (Scott and Scott, 1988). It is also present, although non-native, in all of the Great Lakes (USA), and many lakes in northern New York. In the Great Lakes, A. pseudoharengus was first caught in Lake Erie in 1931 off the coast of Nanticoke, Ontario, Canada. Populations then moved slowly upstream to the upper great lakes (Scott and Crossman, 1998). It was discovered in Lake Huron in 1933, Lake Erie in 1940, Lake Michigan in 1949, and Lake Superior in 1954 (Scott and Crossman, 1998). It is now abundant in Lake Huron and dominant in Lake Michigan. Alewives cannot dominate Lake Superior due to cold water and predation by lake trout (Salvelinus namaycush), nor can they dominate Lake Erie because the lake is too shallow to provide suitable overwintering grounds for large numbers of fish (Scott and Crossman, 1998). Several theories exist on how alewives could have become established in the Great Lakes. Scott and Crossman suggest that alewives may have been accidentally included in a batch of American shad (Alosa sapidissima) that were used to stock Lake Ontario. The alewives also could have migrated from Lakes Seneca and Cayuga in New York to the Great Lakes through the St. Lawrence River. A third argument for the current distribution is that alewives were native to Lake Ontario in small numbers but went unnoticed until the population explosion in 1873 (Daniels, 2001). Daniels (2001) argues against both the theory of introduction with stocked American shad and dispersal through canals. He argues against the canal introduction because the alewife floater, Anodonta implicata, is not found in the upper portions of canals or in Lake Ontario. Anodonta implicata is a mussel and a parasite of alewives (Daniels, 2001).

Biogeographic Regions: nearctic (Introduced , Native )

  • Scott, W., E. Crossman. 1998. The Freshwater Fishes of Canada. Oakville, Ontario, Canada: Galt House Publications Ldt..
  • Scott, W., M. Scott. 1988. Atlantic Fishes of Canada. Toronto, Canada: Canadian Bulletin of Fisheries and Aquatic Science (University of Toronto Press).
  • Daniels, R. 2001. Untested assumptions: the role of canals in the dispersal of sea lamprey, alewife, and other fishes in the eastern United States. Environmental Biology of Fishes, 60: 309-329.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence and Nova Scotia to North Carolina
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Atlantic coast from Labrador to South Carolina; also in Great Lakes (possibly native to Lake Ontario, colonized other lakes via the Welland Canal). Introduced in inland reservoirs in some areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence and northern Nova Scotia south to North Carolina; landlocked races also exist in Lake Ontario, the Finger Lakes of New York, and in certain other fresh-water lakes.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Whitehead, P. J. P., 1985; Jones, P. W., F. D. Martin and J. D. Hardy, Jr., 1978; Edsall, T. A., 1970; Edsall, T. A., 1964.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Alewives have an overall silvery color with a grayish green back. A black spot at the eye level is directly behind the head. Adults have longitudinal lines that run along the midline of the body. Small alewives have a violet sheen on the sides while adults have a golden cast on their heads and upper parts. They are colored very much like Alosa chrysochloris. Scales along the middle of the belly form a raised edge. Females are bigger than males and generally live longer. The body is very rounded and flattened. The head is broadly triangular. The eyes are large and have structures that look like eyelids. The single dorsal fin usually has 13-14 rays but may have 12-16. The tail fin is forked. The anal fin is short and wide with 15-19 rays.  Alewives that live at sea tend to be longer, ranging from 255 to 355 mm. Alewives that live in freshwater are about 150 mm in length and mature faster than alewives that live at sea.

Range length: 100 to 355 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Average mass: 110 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Analspines: 0
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Alosa pseudoharengus has an overall silvery color with a grayish green back. A black spot at the eye level is directly behind the head. Adults have longitudinal lines that run along the scale lines above the midline of the body. Small specimens have a violet sheen on the sides while anadromous adults have a golden cast on their heads and upper parts. The scales are deciduous and the lateral line is not well-developed (Scott and Crossman, 1998). Coloration is generally similar to that of the skipjack herring, Alosa chrysochloris. Scales on the midline of the belly form scutes, creating a serrated surface (Trautman, 1957). Females are bigger than males and generally live longer. The body is strongly laterally compressed and relatively deep. The head is broadly triangular. Eyes are large and have well-developed adipose eyelids. The front of the jaw is thick and extends past the lower jaw when the mouth is closed. The maxillary extends to below the middle of the eye. A few small teeth are present on the premaxillary and mandible (Scott and Crossman, 1998). There are more than 30 gill rakers on the lower angle of the first gill arch (Trautman, 1957). The singular dorsal fin usually has 13-14 rays but may have 12-16. The caudal fin is forked. The anal fin is short and wide with 15-19 rays (usually 17-18). The pelvic fins are rather small and contain 10 rays. The pectoral fins are low on the sides and usually have 16 rays but may have as few as 14 (Scott and Crossman, 1998). There are a few physiological differences between anadromous and land-locked individuals. Anadromous specimens tend to be longer, ranging from 255 to 355 mm while land-locked species average 150 mm in length. Land-locked fish mature faster than anadromous ones (Daniels, 2001).

Range length: 100 to 355 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Average mass: 110 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 380 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

40.0 cm SL (male/unsexed; (Ref. 7251)); max. published weight: 200 g (Ref. 7251); max. reported age: 9 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 35 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 40 cm SL; max. weight: 200 g .
  • Bigelow, H. B. and Schroeder, W. C.,1953; Whitehead, P. J. P., 1985; Jones, P. W., F. D. Martin and J. D. Hardy, Jr., 1978; Edsall, T. A., 1970; Edsall, T. A., 1964.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Moderately compressed, belly with a distinct keel of scutes. Lower jaw rising steeply within mouth; minute teeth present at front of jaws (disappearing with age). Lower gill rakers increasing with age. A dark spot on shoulder. Distinguished from A. aestivalis by its silvery peritoneum; eye larger than snout length; back greyish green on capture.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Often confused with A. AESTIVALIS.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Alewives spend most of their time in coastal waters and most are caught in water 56 to 100 m deep at about 4°C. They are sensitive to light and tend to be in deeper waters during daylight hours. They follow the daily movements of zooplankton in the water column. Adults can withstand temperatures up to 25°C and young of the year can live in waters up to 30°C.

Range depth: 56 to 100 m.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Other Habitat Features: estuarine ; intertidal or littoral

  • Trautman, M. 1957. The Fishes of Ohio. Baltimore, Md.: Ohio State University Press (Waverly Press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 5 - 145 m (Ref. 4639), usually 56 - 110 m (Ref. 5951)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

For anadromous populations, much is known about their freshwater spawning habits, but little is known about movements within the ocean. Alewives spend most of their time in coastal waters and most are caught in water 56-100 m deep at about 4°C (Scott and Scott, 1988). Light sensitive, they tend to be in deeper waters during daylight hours. They also follow diel movements of zooplankton in the water column (Scott and Scott, 1988). Adults can withstand temperatures up to 25°C and young of the year can live in waters up to 30°C (Scott and Scott, 1988).

Freshwater populations spend most of their time in the deep waters of the lakes but come to the shallows and tributary streams in the spring to spawn (Trautman, 1957). The fish go to the deepest parts of the lakes to overwinter.

Range depth: 56 to 100 m.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Other Habitat Features: estuarine ; intertidal or littoral

  • Trautman, M. 1957. The Fishes of Ohio. Baltimore, Md.: Ohio State University Press (Waverly Press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

anadromous species, spawn in freshwater, landlock populations also exist; found at sea at depths of 5- 145 m
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 12475 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6796 samples.

Environmental ranges
  Depth range (m): 0.3 - 516
  Temperature range (°C): -0.070 - 22.025
  Nitrate (umol/L): 0.663 - 22.184
  Salinity (PPS): 30.218 - 36.012
  Oxygen (ml/l): 3.424 - 7.862
  Phosphate (umol/l): 0.221 - 1.640
  Silicate (umol/l): 1.848 - 17.288

Graphical representation

Depth range (m): 0.3 - 516

Temperature range (°C): -0.070 - 22.025

Nitrate (umol/L): 0.663 - 22.184

Salinity (PPS): 30.218 - 36.012

Oxygen (ml/l): 3.424 - 7.862

Phosphate (umol/l): 0.221 - 1.640

Silicate (umol/l): 1.848 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Marine waters or open lake waters except during breeding season. Lake populations overwinter in deep water. See Fay et al. (1983) for details on various specific environmental requirements. Marine populations spawn in quiet portions of rivers (fresh or brackish water) or in small streams, in lagoons behind barrier beaches, or in lakes above influence of tide. Lake populations move into shallow inshore waters or ponds to spawn at night. Larvae occur in or slightly downstream from spawning areas; juveniules may exhibit net upstream movement until leaving freshwater/estuarine nursery areas in summer or fall (or, in some areas, in spring of the next year).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; freshwater; brackish; marine; depth range 5 - 145 m. Adults school with like sizes, apparently remaining near natal estuaries. Larvae remain in vicinity of spawning grounds for up to two weeks before descending streams to estuaries and sea.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Whitehead, P. J. P., 1985; Jones, P. W., F. D. Martin and J. D. Hardy, Jr., 1978; Edsall, T. A., 1970; Edsall, T. A., 1964.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates between freshwater spawning habitat and nonspawning marine habitat. Some populations are landlocked, entirely freshwater, make local migrations. Some populations may not migrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Little is known about the feeding habits of alewives that live at sea. Alewives in freshwater populations eat mostly zooplankton, especially small crustaceans such as Copepoda, Cladocera, Mysidae, and Ostracoda. When they grow larger than 11.9 cm, they feed mostly on larger, bottom dwelling crustaceans. Some spawning adults eat small fish or fish eggs when in shallow waters.

Animal Foods: fish; eggs; aquatic crustaceans; zooplankton

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryhaline, entering brackish- and freshwaters, anadromous (Ref. 10294). Movement of schooling adults apparently restricted to coastal areas proximal to natal estuaries (Ref. 4639). They migrate up rivers and even small streams to spawn in lakes and quiet stretches of rivers, then return to sea shortly after spawning (Ref. 4639); landlocked populations also ascend affluent rivers and streams. Larvae remain in vicinity of spawning grounds, forming schools at sizes less than 10 mm TL, within one to two weeks after hatching (Ref. 4639), then descend in summer and autumn or even as late as November or December. Feed on shrimps and small fishes; the young on diatoms, copepods and ostracods while in rivers. Feed on planktonic and benthic invertebrates (Ref. 13515). Fish measuring 5.0-7.0 cm TL feed by gulping, filtering and particulate feeding, whereas smaller fish are exclusive particulate feeders (Ref. 46977). Preyed upon by walleye, smallmouth bass, crappie, rainbow trout and ohrid trout (Ref. 10294).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Little is known about the feeding habits of anadromous alewives (Scott and Scott, 1988). Adult land-locked fish eat mostly zooplankton, especially larger varieties such as copepods, cladocerans, mysids, and ostracods (Scott and Crossman, 1998). When they grow larger than 11.9 cm, they feed mostly on the benthic amphipod Pontoporeia (Scott and Scott, 1988). Some spawning adults eat small fish or fish eggs when in shallow waters (Scott and Crossman, 1998). Larval alewives eat mainly cladocerans and copepods.

Animal Foods: fish; eggs; aquatic crustaceans; zooplankton

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly zooplankton, especially crustaceans; fish eggs, crustacean eggs, insects and insect eggs, and small fishes may be important foods in some areas or for larger individuals (see Fay et al. 1983 for further details).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Shrimps and small fishes; Young feed on diatoms, copepods and ostracods.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Whitehead, P. J. P., 1985; Jones, P. W., F. D. Martin and J. D. Hardy, Jr., 1978; Edsall, T. A., 1970; Edsall, T. A., 1964.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Alewives are now the most abundant planktivores in Lake Ontario and are the main prey of Salmonidae in the Great Lakes. Their presence in the Great Lakes has caused the decline of many native fish species because of competition.

There isn't much known about the parasites of alewives, but Acanthocephala, Cestoda, Trematoda, Copepoda, and Nematoda have all been found in populations that live in the sea. Alewives that live in freshwater lakes don't have as many parasites.

Commensal/Parasitic Species:

  • Acanthocephala
  • Cestoda
  • Trematoda
  • Copepoda
  • Nematoda

  • Klumb, R., L. Rudstam, E. Mills. 2003. Comparison of Alewife Young-of-the-Year and Adult Respiration and Swimming Speed Bioenergetics Model Parameters: Implications of Extrapolation. Transactions of the American Fisheries Society, 132: 1089-1103.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Alewives have many predators. In freshwater, their main predators are Lota lota, Salvelinus namaycush, Anguillidae, Micropterus, Sander vitreus, and Coregonus. Introduced predators include Oncorhynchus tshawytscha and Oncorhynchus kisutch salmon. Little is known about the predators of alewives that live at sea but their hatchlings have a high mortality rate. As few as one out of 80,000 will reach the sea.

Known Predators:

  • burbot (Lota_lota)
  • lake trou (Salvelinus_namaycush)
  • eels (Anguillidae)
  • bigmouth bass (Micropterus_salmoides)
  • walleye (Sander_vitreus)
  • whitefish species (Coregonus)
  • chinook salmon (Oncorhynchus_tshawytscha)
  • coho salmon (Oncorhynchus_kisutch)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Alosa pseudoharengus is now the most abundant planktivore in Lake Ontario and it is the main prey of salmonoids stocked into the great lakes (Klumb, Rudstam, and Mills, 2003). Its presence in the Great Lakes has caused the decline of many fish species due to competition.

There have been few studies published on alewife parasites (Scott and Scott, 1988). Anadromous populations host more species of parasites than land-locked populations. Alewives caught off the Atlantic coast were found to host the following parasites: acanthocephalans, cestodes, trematodes, copepods, and nematodes (Scott and Crossman, 1998). Parasites are rare in land-locked populations (Scott and Scott, 1988), but one important freshwater alewife parasite, the alewife floater, Anodona implicata, has been used to research the historical range of the alewife. Anodonta implicata is a mussel which is native to the tidal Hudson river and Delaware Rivers in New York (Daniels, 2001).

Commensal/Parasitic Species:

  • acanthocephalans
  • cestodes
  • trematodes
  • copepods
  • nematodes

  • Klumb, R., L. Rudstam, E. Mills. 2003. Comparison of Alewife Young-of-the-Year and Adult Respiration and Swimming Speed Bioenergetics Model Parameters: Implications of Extrapolation. Transactions of the American Fisheries Society, 132: 1089-1103.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Alewives are considered a forage fish and have many predators. In freshwater, their main predators are burbot (Lota lota), lake trout (Salvelinus namaycush), eels (Anguillidae), bass (Micropterus), walleye (Sander vitreus), and whitefish (Scott and Crossman, 1998). Introduced predators include chinook and coho salmon. Little is known about the predators of anadromous alewives but their hatchlings have a high mortality rate. As few as one out of 80,000 will reach the sea (Scott and Scott, 1988).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Alosa pseudoharengus (Alewife and blue herring) preys on:
phytoplankton
Calanus
Pteropods
Copepoda
Ctenophora
other worms
Chaetognatha
Anthozoa
Crangon
Mysidae
Pandalidae
Decapoda
Gammaridae
Hyperiidae
Caprellidae
Isopoda
Cumacea
Polychaeta
Ammodytes marinus
microzooplankton
zooplankton
Chrysaora quinquecirrha
Other suspension feeders
Mya arenaria
Crassostrea virginica
Nereis
Macoma

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Important link in estuarine and marine food webs, between zooplankton and top piscivores; also may be highly utilized by gulls and terns (Fay et al. 1983). Lake populations often experience massive summer die-offs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

We don't know much about how alewives might communicate. Their large eyes probably help them find other alewives, their prey, and stay alert for predators.

Communication Channels: tactile ; chemical

Perception Channels: visual ; acoustic ; vibrations ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

We don't know much about how alewives might communicate. Their large eyes probably help them find other alewives, their prey, and stay alert for predators.

Communication Channels: tactile ; chemical

Perception Channels: visual ; acoustic ; vibrations ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Feeds most extensively during daylight.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are about 0.9 mm in diameter. Three to five days after hatching, the larvae begin to feed. They slowly transform into juvenile fish and remain in fresh water until the fall, growing to 3.8 to 12.5 cm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults migrate up rivers and even small streams, spawn in lakes and quiet stretches of rivers; landlocked populations also ascend affluent rivers and streams; the fry descend in summer and autumn or even as late as November or December. Spawning activity has been observed both diurnally and nocturnally, but with greatest activity at night (Ref. 38797). Spawning activity stops above 27.8°C (Ref. 38881).Freshwater populations mature earlier and at a smaller average size than saltwater populations (Ref. 4639).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Fertilized eggs are about 0.9 mm in diameter. Three to five days after hatching, the larvae begin to feed. They slowly transform into juvenile fish and remain in fresh water until the fall. While in freshwater, young-of-the-year grow 1.5 to 5 inches (3.8 to 12.5 cm). Little is known about sub-adult life-history traits.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Young alewives have a very high mortality rate. Less than 1% survive to migrate into the sea or large lake. About 70% of adult alewives die each year also. Most die during or shortly after the spawning season. Few alewives in freshwater populations live longer than 5 years.

Range lifespan

Status: wild:
10 (high) years.

Typical lifespan

Status: wild:
5 (high) hours.

  • Smith, S. 1970. Species Interactions of the Alewife in the Great Lakes. Transactions of the American Fisheries Society, 4: 754-764.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Young alewives have a very high mortality rate. Less than 1% survive to migrate into the sea (U.S. Department of Agriculture, 2004). Annual mortality for adult alewives is on the order of 70% per year. Most die during or shortly after the spawning season (U.S. Department of Agriculture, 2004). Few land-locked alewives live longer than 5 years (Smith, 1970).

Range lifespan

Status: wild:
10 (high) years.

Typical lifespan

Status: wild:
5 (high) hours.

  • Smith, S. 1970. Species Interactions of the Alewife in the Great Lakes. Transactions of the American Fisheries Society, 4: 754-764.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Alewives spawn in the spring. The young swim to sea or to deeper parts of large lakes (including the Great Lakes). Migration to spawning grounds happens earlier in warmer areas. Spawning generally starts in April in the south and lasts until the end of May farther north. In all populations, females reach the spawning grounds first and older fish are the first to spawn. The oldest fish recorded at spawning sites were to 10 years old. Spawning occurs in groups of 3 or in pairs.

Mating System: polygynandrous (promiscuous)

Females lay their eggs and males fertilize them at the same time. The eggs are sticky at first and may stick to plants or rocks. Within a few hours they settle to the bottom of the lake or river. Alewives lay their eggs over any type of substrate. The number of eggs per female may be 10,000 to 360,000.

In populations that migrate to the sea, adult alewives spend most of their lives at sea but spawn in inland streams. Although they cannot jump obstacles such as dams, they can swim over rapids. Fish in these populations mature at 3 years for males and 4 years for females.

In freshwater populations, fish mature at 2 years for males and 3 years for females. These fish move close to shallow beaches or into streams to spawn. Eggs hatch in 3 to 6 days, depending on how warm the water is.

Breeding interval: Alewives breed yearly.

Breeding season: Spawning occurs during the spring.

Range number of offspring: 10,000 to 360,000.

Range time to hatching: 3 to 6 days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Alewives do not have any parental investment in their young beyond spawning. The adults leave immediately after spawning in the spring and the young move to the open water in the fall.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Grosvenor, M. 1965. Wondrous World of Fishes. Washington, DC: National Geographic Society.
  • Scott, W., E. Crossman. 1998. The Freshwater Fishes of Canada. Oakville, Ontario, Canada: Galt House Publications Ldt..
  • Scott, W., M. Scott. 1988. Atlantic Fishes of Canada. Toronto, Canada: Canadian Bulletin of Fisheries and Aquatic Science (University of Toronto Press).
  • U.S. Department of Agriculture, N. 2004. "Invasivespecies.gov A gateway to Federal and State invasive species activities and programs" (On-line). Accessed October 27, 2004 at http://www.invasivespecies.gov/profiles/alewife.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

All alewives spawn in the spring. The young swim to sea in anadromous populations or to deeper water in lake populations in the fall (Grosvenor, 1965). For anadromous populations, the temperature of the river water determines the timing of spawning migrations upstream, so spawning happens first in lower latitudes. Spawning generally starts in April in the south and lasts until the end of May in upper latitudes (Scott and Crossman, 1998).

In all populations, females reach the spawning grounds first (Scott and Crossman, 1998) and older fish are the first to spawn (Grosvenor, 1965). The oldest fish recorded at spawning sites were 9-10 years old (Grosvenor, 1965). Spawning occurs in groups of 3 or in pairs (Scott and Crossman, 1998).

Mating System: polygynandrous (promiscuous)

Females broadcast their eggs simultaneously with males broadcasting sperm (U.S. Department of Agriculture, 2004). Although the eggs are adhesive at first and may stick to plants or rocks, they loose their adhesive qualities after a few hours and settle to the substrate (Scott and Scott, 1988). Alewives deposit their eggs over any type of substrate (U.S. Department of Agriculture, 2004). The number of eggs per female may be 10,000 to 12,000 (Scott and Crossman, 1998) or 48,000-360,000 (Scott and Scott, 1988).

In anadromous populations, adult alewives spend most of their lives at sea but spawn in streams above the influence of the tide. Although they cannot jump obstacles such as dams, they surmount rapids and fish runs migrating farther upstream than the closely related American shad (Scott and Crossman, 1998). Anadromous fish reach maturity at 3 years for males and 4 years for females (Scott and Crossman, 1998).

Land-locked populations mature at 2 years for males and 3 years for females. These fish move close to shallow beaches or up streams to spawn. They move on-shore at night and off-shore during the day. Adults leave the shallows immediately after spawning and have moved to deep water by late August (Scott and Crossman, 1998). Eggs hatch in 6 days at a mean water temperature of 60°F (15.6°C) and in 3 days at 72°F (22.2°C) (Scott and Crossman, 1998). Their maximum hatching success occurs at 20.8°C (Grosvenor, 1965).

Breeding interval: Alewives breed yearly.

Breeding season: Spawning occurs during the spring.

Range number of offspring: 10,000 to 360,000.

Range time to hatching: 3 to 6 days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: seasonal breeding ; sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Alewives do not have any parental investment in their young beyond spawning. The adults leave immediately after spawning in the spring and the young move to the open water in the fall.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Grosvenor, M. 1965. Wondrous World of Fishes. Washington, DC: National Geographic Society.
  • Scott, W., E. Crossman. 1998. The Freshwater Fishes of Canada. Oakville, Ontario, Canada: Galt House Publications Ldt..
  • Scott, W., M. Scott. 1988. Atlantic Fishes of Canada. Toronto, Canada: Canadian Bulletin of Fisheries and Aquatic Science (University of Toronto Press).
  • U.S. Department of Agriculture, N. 2004. "Invasivespecies.gov A gateway to Federal and State invasive species activities and programs" (On-line). Accessed October 27, 2004 at http://www.invasivespecies.gov/profiles/alewife.shtml.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns in spring or summer, depending on the locality (later in north than in south). Eggs hatch in a week or less. Males sexually mature in about 2-3 years, females in 3-4 years; all have spawned at least once by age 5 years; age of first spawning, % of repeat spawners, and longevity seem to decrease from north to south. May breed only once in some areas. Spawners move rapidly downstream after spawning. See Fay et al. 1983 for many additional details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous; spawn in lakes and quiet stretches of rivers; landlocked populations also ascend affluent rivers and streams; the fry descend in summer and autumn or even in November and December. Diurnal and (mostly) nocturnal spawning.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Whitehead, P. J. P., 1985; Jones, P. W., F. D. Martin and J. D. Hardy, Jr., 1978; Edsall, T. A., 1970; Edsall, T. A., 1964.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alosa pseudoharengus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCAACTAATCATAAAGATATTGGTACCCTTTACCTAGTATTTGGTGCCTGAGCAGGGATAGTAGGCACTGCCTTAAGTCTCTTAATCCGAGCAGAACTGAGCCAACCCGGGGCACTTCTCGGAGAC---GATCAGATCTATAACGTCATCGTTACGGCGCACGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATTCTAATTGGTGGCTTTGGGAACTGACTAGTCCCCCTTATGATCGGGGCACCAGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTACTTCCGCCCTCATTCCTCCTCCTTCTTGCCTCATCCGGGGTTGAGGCCGGGGCAGGAACCGGATGAACAGTCTACCCACCCTTGGCAGGTAATCTTGCCCACGCCGGAGCGTCCGTCGATCTAACTATCTTCTCTCTTCATCTAGCAGGTATCTCATCAATTCTTGGGGCCATTAATTTTATTACCACAATTATTAATATGAAACCCCCTGCAATCTCACAATATCAAACACCCCTATTTGTGTGATCCGTGCTTGTAACGGCCGTTCTCCTTCTTCTCTCACTCCCTGTGTTAGCTGCTGGGATTACAATGCTCCTAACAGACCGAAATCTAAATACGACCTTCTTTGACCCGGCAGGGGGAGGGGACCCAATTCTATATCAACACCTATTCTGATTCTTTGGCCACCCGGAAGTTTACATTTTAATCCTACCAGGATTTGGAATGATCTCCCACATTGTAGCCTATTATTCCGGCAAAAAAGAACCTTTCGGATACATGGGAATGGTATGAGCCATGATGGCCATCGGACTTCTAGGGTTTATCGTATGAGCCCACCACATGTTCACCGTAGGAATGGATGTAGACACACGAGCCTACTTTACATCAGCAACAATGATTATTGCTATCCCCACCGGAGTAAAAGTCTTTAGCTGACTTGCGACACTGCACGGGGGC---TCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alosa pseudoharengus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Alewives not listed as an endangered species, but in many places in their natural range, their habitat is threatened by dams along spawning rivers. On the other hand, their introduction into the Great Lakes and other areas resulted in declines in native fish in those areas.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alewives not listed as an endangered species, but in many places in their natural range, their habitat is threatened by dams along spawning rivers. On the other hand, their introduction into the Great Lakes and other areas resulted in declines in native fish in those areas.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Global rank is out of date and in need of review.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Dams impede upstream migrations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Alewives have been considered a nuisance in the Great Lakes since their population explosion in 1873. Live fish can clog industrial intake pipelines and sometimes die in large numbers, resulting in lots of dead fish on beaches in the spring. Oncorhynchus kisutch were introduced in the Great Lakes to control alewives and are now important sport fish in the region.

Since alewives feed mainly on plankton and bottom-dwelling crustaceans, alewives are particularly good at accumulating DDT and other toxins in their fatty tissues. For this reason it is best not to eat too many of the fish predators of alewives, such as salmon from the Great Lakes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Alewives support an important commercial fishery in the Atlantic Ocean. They are packaged fresh, smoked, salted, or pickled for human food and are often sold as “river herring.” Fishermen use weirs, traps, gill nets, and dip nets for alewives, which they consider one of the easiest fish to catch. Alewives have other uses, including pet food, lobster and snow crab bait, and processing into fishmeal and fish oil. Alewives are not usually fished in the Great Lakes since these are small and too bony to eat. However, recently there has been a trend to use them for pet food and fish meal.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Alewives have been considered a nuisance in the Great Lakes since their population explosion in 1873. Live fish tend to clog industrial intake pipelines and are “particularly obnoxious during periods of mass die-offs” because they can cause health hazards from the large numbers of dead fish in the spring (Scott and Crossman, 1998). Control measures, such as the introduction of coho salmon, Oncorhynchus kisutch, however, provide important sport fisheries for Lake Michigan (Scott and Crossman, 1998).

Since they feed mainly on planktonic and benthic organisms, alewives are particularly good at accumulating DDT (dichloro-diphenyl-trichloroethane) in their fatty tissues (Scott and Crossman, 1998). This bioaccumulation can make it dangerous for humans and other high-level predators to eat piscivorous fish, such as salmon, that feed primarily on alewives.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Alewives represent an important commercial fishery in the Atlantic Ocean. They are packaged fresh, smoked, salted, or pickled for human consumption and are often sold as “river herring.” Fishermen use weirs, traps, gill nets, and dip nets for alewives, which they consider one of the easiest fish to catch (Scott and Scott, 1988). Alewives have other uses, including pet food, lobster and snow crab bait, and processing into fishmeal and fish oil (Scott and Scott, 1988). The North American Fisheries Organization statistical bulletin includes alewives in the "other fish" category so no catch data are available (Scott and Scott, 1988). Alewives have not seriously been exploited as a fishery in the Great Lakes since these are small and too bony to eat. However, recently there has been a trend to use them for pet food and fish meal (Scott and Crossman, 1998).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: In last 2 decades has gained in recognition and interest as source of fish meal, fish oil, and fish protein, especially for the animal food industries (Fay et al. 1983). However, has declined in commercial importance in South Atlantic region in recent decades (Bozeman and Van Den Avyle 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Alewife

The alewife (Alosa pseudoharengus) is a species of fish. There are anadromous and landlocked forms. The landlocked form is also called a sawbelly or mooneye (although this latter name is more commonly applied to Hiodon spp.). The front of the body is deep and larger than other fish found in the same waters, and its common name is said to come from comparison with a corpulent female tavernkeeper ("ale-wife").[1] In Atlantic Canada it is known as the gaspereau. More locally, in southwestern Nova Scotia, it is called a kiack (or kyack).[2] In the Southeast US, when sold and used as bait, the fish is often referred to as "LY".

Adult alewives are preferred bait for the spring lobster fishery in Maine.[3] It is also used for human consumption, usually smoked. It is caught (during its spawning migration upstream) using large dip nets to scoop the fish out of shallow, constricted areas on its migratory streams and rivers. It is one of the "typical" North American shads of the subgenus Pomolobus. [4]

Contents

In the North American Great Lakes [edit]

Alewives are perhaps best known for their invasion of the Great Lakes by using the Welland Canal to bypass Niagara Falls. Alewives colonized the Great Lakes and became abundant mostly in Lake Huron and Lake Michigan. They reached their peak abundance by the 1950s and 1980s. Alewives grew in number unchecked because of the lack of a top predator in the lakes (lake trout were essentially wiped out around the same time by overfishing and the invasion of the sea lamprey). For a time, alewives, which often exhibit seasonal die-offs, washed up in windrows on the shorelines of the Great Lakes. Their control was the impetus for the introduction of various Pacific salmon species (first coho, and later the Chinook salmon) to act as predators on them. This caused the development of a salmon/alewife fish community, popular with many sport anglers. Alewives, however, have been implicated in the decline of many native Great Lakes species through competition and predation.

Conservation [edit]

Alewife populations have exhibited drastic declines throughout much of their range. Several threats have most likely contributed to their decline, including loss of habitat due to decreased access to spawning areas from the construction of dams and other impediments to migration, habitat degradation, fishing, and increased predation due to recovering striped bass populations.

In response to the declining trend for alewife, the states of Massachusetts, Rhode Island, Connecticut, and North Carolina have instituted moratoriums on taking and possession.

The alewife is a US National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the US Endangered Species Act.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly placed in genus Pomolobus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!