Overview

Comprehensive Description

Biology

Epipelagic to mesopelagic (Ref. 31442). Adults move upward in large numbers at night (Ref. 28499). Feed on fishes, copepods and euphausiids (Ref. 11712). Oviparous, with planktonic eggs and larvae (Ref. 31442). Lipid content is 15.6 % in fresh body weight and wax ester is 90.9 % in total lipids (Ref. 9197).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Japan to Bering Sea and to northern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 15; Analspines: 0; Analsoft rays: 14 - 16; Vertebrae: 35 - 38
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 130 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

13.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 8 years (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adipose fin small and slender; pectorals slender and short (Ref. 6885). Gray to dark greenish blue on dorsally, lighter ventrally; black on operculum and fins; golden or claret on photophores (Ref. 6885). Branchiostegal rays: 9-10 (Ref. 31442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 0 - 3400 m (Ref. 50550), usually 31 - 1189 m (Ref. 4925)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 141 specimens in 1 taxon.
Water temperature and chemistry ranges based on 87 samples.

Environmental ranges
  Depth range (m): 0 - 50000
  Temperature range (°C): -0.059 - 14.707
  Nitrate (umol/L): 0.430 - 45.757
  Salinity (PPS): 31.271 - 34.629
  Oxygen (ml/l): 0.348 - 6.571
  Phosphate (umol/l): 0.449 - 3.350
  Silicate (umol/l): 3.526 - 179.332

Graphical representation

Depth range (m): 0 - 50000

Temperature range (°C): -0.059 - 14.707

Nitrate (umol/L): 0.430 - 45.757

Salinity (PPS): 31.271 - 34.629

Oxygen (ml/l): 0.348 - 6.571

Phosphate (umol/l): 0.449 - 3.350

Silicate (umol/l): 3.526 - 179.332
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 30 - 2906m.
From 30 to 2906 meters.

Habitat: bathypelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Epipelagic to mesopelagic (Ref. 31442). Adults move upward in large numbers at night (Ref. 28499). Feed on fishes, copepods and euphausiids (Ref. 11712); other benthic and planktonic organisms (Ref. 28107).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 31442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Stenobrachius leucopsarus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GATATTGGCACCCTTTACCTGGTATTCGGTGCCTGGGCAGGCATAGTAGGAACTGCTCTTAGCCTCCTTATTCGAGCTGAACTCAGCCAACCTGGAGCCCTCCTGGGCGACGACCAGATTTATAACGTAATCGTAACAGCTCACGCTTTTGTAATAATTTTCTTTATAGTAATGCCTATCATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATTGGGGCCCCTGACATGGCATTCCCTCGTATGAACAATATGAGCTTCTGACTTCTCCCGCCATCTTTCCTTCTTCTCCTAGCCTCCTCCGGCGTAGAAGCCGGGGCCGGTACTGGCTGAACGGTTTATCCTCCACTTGCAGGCAATCTTGCTCATGCCGGAGCCTCTGTAGACCTAACAATTTTCTCGCTCCACCTAGCAGGTGTTTCATCAATTCTTGGGGCCATCAACTTTATTACAACTATTATTAACATGAAACCCCCAGCAATTACTCAGTACCAGACCCCCTTATTCATTTGAGCAGTATTAATTACAGCCGTACTCCTCCTTCTTTCCCTCCCAGTCCTGGCCGCTGGAATTACAATGCTTCTAACAGATCGAAACCTGAATACTACCTTCTTCGACCCAGCTGGCGGAGGAGACCCCATCCTTTACCAACACTTATTCTGATTCTTCGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Stenobrachius leucopsarus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!