Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabit subtidal reef flats and protected lagoons, Ref. 48637. Found mainly in rubble-algal habitat and usually in loose aggregations. Shy species, usually swimming away or when small, diving into holes (Ref. 48637). Oviparous (Ref. 205). Also taken by drive-in nets (Ref. 9770).
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: Gulf of Aden, East Africa, Seychelles, Mauritius (Mascarenes) and Chagos Archipelago east to Philippines and Vanuatu, north to southern Japan, south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: in tropical waters, from Chagos Archipelago through Indonesia to the Solomon Islands, north to southern Japan, south to Vanuatu.
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 23 - 26; Analspines: 0; Analsoft rays: 21 - 23
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 230 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

23.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 20m.
Recorded at 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.6 - 6
  Temperature range (°C): 26.573 - 28.764
  Nitrate (umol/L): 0.084 - 0.622
  Salinity (PPS): 33.950 - 35.063
  Oxygen (ml/l): 4.522 - 4.744
  Phosphate (umol/l): 0.055 - 0.186
  Silicate (umol/l): 1.149 - 3.666

Graphical representation

Depth range (m): 0.6 - 6

Temperature range (°C): 26.573 - 28.764

Nitrate (umol/L): 0.084 - 0.622

Salinity (PPS): 33.950 - 35.063

Oxygen (ml/l): 4.522 - 4.744

Phosphate (umol/l): 0.055 - 0.186

Silicate (umol/l): 1.149 - 3.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits subtidal reef flats and protected lagoon and coastal reefs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct pairing (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Rhinecanthus verrucosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Rhinecanthus verrucosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGTGCTTGAGCTGGAATAGTAGGCACAGCCCTAAGCTTGCTAATCCGGGCAGAACTGAGCCAACCCGGCGCTCTCTTAGGCGATGACCAAATCTACAATGTTATCGTCACAGCACATGCTTTCGTTATAATTTTCTTTATAGTAATACCAATCATAATTGGTGGTTTCGGAAACTGATTAATCCCATTAATGATCGGGGCTCCCGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGACTCCTACCACCTTCACTCTTACTACTTCTTGCCTCCTCAAGCGTAGAAGCCGGTGCTGGAACCGGATGAACGGTATATCCCCCTCTCGCAGGAAACCTAGCCCACGCGGGAGCCTCTGTTGACCTTACTATCTTCTCACTACACTTGGCAGGAATCTCATCAATTCTAGGAGCTATTAATTTCATTACAACAATTATTAATATGAAACCCCCCGCCATTTCCCAATATCAAACACCGCTATTTGTTTGAGCAGTCCTAATTACGGCAGTCCTTCTCCTTCTATCCCTCCCAGTCCTAGCTGCCGGGATTACAATACTACTCACTGATCGAAATTTAAACACCACATTCTTCGATCCTGCTGGAGGTGGAGATCCAATCCTTTATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rhinecanthus verrucosus

The blackbelly triggerfish, Rhinecanthus verrucosus, is a ray-finned fish in the family Balistidae found in the west Indo-Pacific. It occasionally makes its way into the aquarium trade. It is sometimes known as the blackpatch triggerfish.

Description[edit]

The blackbelly triggerfish has a laterally compressed, deep body and a long snout. In shape it is rhomboidal and it grows to a maximum length of 23 cm (9.1 in). The mouth is at the tip of the snout and the eye is set high on a long, straight forehead. The upper half of the body is pale brown and the underparts are white. There is a dark brown streak below the eye and a very large black spot on the underside just anterior to the anal fin. There are three short rows of forward pointing spines on the caudal peduncle. The anterior part of the dorsal fin consists of three spines which can be retracted into a groove and the separate posterior part has 23–26 soft rays. The anal fin is very much the same shape as the posterior dorsal fin and has 21–23 soft rays. The pectoral fin has 13–14 rays. The pelvic fin is covered by a flap of skin except for its extreme tip.[2][3]

Distribution[edit]

The blackbelly triggerfish is found in shallow areas of the west Indo-Pacific. The range includes the Seychelles, the Chagos Islands, Japan, Vanuatu, and western Australia. In 1995, this species was sighted near Boca Raton, Florida.[2]

Habitat[edit]

The blackbelly triggerfish is a territorial species and defends its territory against other triggerfish including the lagoon triggerfish (Rhinecanthus aculeatus). Its habitat is lagoons and reef flats where it favours areas with seaweed, corals, seagrasses, sandy flats, and stony places. It may move from place to place according to the status of the tide.[2]

References[edit]

  1. ^ Bailly, Nicolas (2010). "Rhinecanthus verrucosus (Linnaeus, 1758)". World Register of Marine Species. Retrieved 2012-02-27. 
  2. ^ a b c Rhinecanthus verrucosus (Linnaeus, 1758): Blackbelly Triggerfish USGS. Retrieved 2012-02-27.
  3. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Rhinecanthus verrucosus" in FishBase. December 2008 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!