Overview

Comprehensive Description

Biology

Occur in lagoon, seaward reefs (Ref. 1602) and sheltered inner reef slopes (Ref. 48637). Juveniles often associated with isolated patches of branching coral or rubble of shallow sandy protected areas. Adults occur singly or in pairs on the slopes of deep lagoon or seaward reefs (Ref. 37816, 48637). Often hostile towards divers and may attack unprovoked when caring for eggs (Ref. 48637). Feed on sea urchins, coral, crabs and other crustaceans, mollusks and tube worms. Oviparous (Ref. 205). Largest triggerfish; females are reported to have attacked divers when guarding their nest (Ref. 2334). Also caught with drive-in nets. Marketed fresh and dried-salted (Ref. 9770).
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to New South Wales (Australia) and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea south to Delagoa Bay, Mozambique (Ref. 4420) and east to the Line and Tuamoto islands, north to southern Japan, south to New Caledonia.
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Mauritius, Mozambique, Red Sea, Seychelles, Somalia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 24 - 26; Analspines: 0; Analsoft rays: 22 - 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 750 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

75.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Fish has a deep grove before eye; scaleless area around lips, continuing and narrowing posterior to corner of mouth; small forward-curving spines in about five rows on side of and a short distance anterior to caudal peduncle. Caudal peduncle compressed (Ref. 9770).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in lagoon and seaward reefs (Ref. 1602). Feeds on sea urchins, coral, crabs and other crustaceans, mollusks and tube worms. The largest triggerfish; females when guarding their nest have been reported to attack divers (Ref. 2334). In Japan, eggs were noted on rock surfaces during the summer months (Ref. 637). Also caught with drive-in nets. Marketed fresh and dried-salted (Ref. 9770).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 50m.
From 1 to 50 meters.

Habitat: reef-associated. Titan triggerfish  (Bloch & Schneider, 1801)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 50 m (Ref. 9770)
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 74 specimens in 1 taxon.
Water temperature and chemistry ranges based on 70 samples.

Environmental ranges
  Depth range (m): 1.525 - 212
  Temperature range (°C): 26.206 - 28.988
  Nitrate (umol/L): 0.068 - 3.148
  Salinity (PPS): 34.099 - 35.095
  Oxygen (ml/l): 4.005 - 4.582
  Phosphate (umol/l): 0.086 - 0.412
  Silicate (umol/l): 0.869 - 7.439

Graphical representation

Depth range (m): 1.525 - 212

Temperature range (°C): 26.206 - 28.988

Nitrate (umol/L): 0.068 - 3.148

Salinity (PPS): 34.099 - 35.095

Oxygen (ml/l): 4.005 - 4.582

Phosphate (umol/l): 0.086 - 0.412

Silicate (umol/l): 0.869 - 7.439
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Balistoides viridescens preys on:
Acanthaster planci

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Distinct paring (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balistoides viridescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATACCTGATTTTCGGTGCTTGAGCCGGAATGGTAGGAACCGCTTTAAGCCTACTAATCCGAGCAGAATTAAGCCAACCCGGCGCTCTTTTAGGAGACGATCAAATTTATAACGTTATCGTCACAGCACATGCTTTCGTGATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTCGGGAACTGACTCGTTCCTCTAATAATTGGAGCCCCCGACATAGCATTCCCTCGCATGAACAATATGAGCTTCTGACTCCTACCTCCATCGCTTCTTCTCTTACTTGCCTCATCAAGCGTAGAAGCAGGGGCCGGTACCGGATGAACGGTCTACCCTCCACTAGCAGGAAACCTAGCCCACGCAGGTGCTTCTGTAGACCTTACCATTTTCTCACTACACTTAGCAGGAATCTCCTCTATTCTTGGAGCAATCAATTTTATTACAACCATTATTAACATGAAACCCCCTGCCATTTCTCAATACCAGACGCCACTGTTCGTCTGAGCTGTCCTTATCACCGCAGTCCTACTGCTCTTGTCCCTCCCTGTTTTAGCTGCCGGAATTACCATACTACTTACCGACCGAAATCTAAACACCACCTTCTTTGACCCTGCTGGAGGAGGAGACCCAATTCTTTACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balistoides viridescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Titan triggerfish

The titan triggerfish, giant triggerfish or moustache triggerfish (Balistoides viridescens) is a large species of triggerfish found in lagoons and at reefs in most of the Indo-Pacific, though it is absent from Hawaii. With a length of up to 75 centimetres (30 in),[1] it is the largest species of triggerfish in its range (the stone triggerfish, Pseudobalistes naufragium, from the east Pacific is larger).[2]

Characteristics

Titan triggerfish are the workers of the reef and often surrounded by other fish feeding from the leftovers.

Titan triggerfish feed on shellfish, urchins, crustaceans and coral. They are the workers of the reef, often being busy turning over rocks, stirring up the sand and biting off pieces of branching coral. This is why one often sees other smaller fish species around it who feed from the left overs. They have also been observed being aggressive to other fish who enter their territory.

Titan triggerfish with orange-lined triggerfish and moorish idols at the reef of Fihalhohi, Maldives.

Interaction with humans

The titan triggerfish is usually wary of divers and snorkelers, but during the reproduction season the female guards its nest, which is placed in a flat sandy area, vigorously against any intruders.[3][4] Although bites are not venomous, the strong teeth can inflict serious injury that may require medical attention.[3][4][5][6]

The threat posture includes the triggerfish facing the intruder while holding its first dorsal spine erect.[3] It may also roll onto its side, allowing it a better look at the intruder it perceives as threatening its nest. The titan triggerfish will not always bite, but can swim at snorkellers and divers escorting them out of their territory.

The flesh of the titan triggerfish is sometimes ciguatoxic.[3][5]

References

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2010). "Balistoides viridescens" in FishBase. 1 2010 version.
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2010). "Pseudobalistes naufragium" in FishBase. 1 2010 version.
  3. ^ a b c d Randall, J. E. (2005). Reef and Shore Fishes of the South Pacific. University of Hawi'i Press. ISBN 0-8248-2698-1
  4. ^ a b Millington, J. T., & J. E. Randall (1990). Triggerfish bite – a little-known marine hazard. J. Wilderness Medicine 1: 79-85
  5. ^ a b Lieske, E., & R. Myers (1999). Coral Reef Fishes. 2nd edition. Princeton University Press. ISBN 0-691-00481-1
  6. ^ Debelius, H. (1993). Indian Ocean Tropical Fish Guide. Aquaprint Verlags GmbH. ISBN 3-927991-01-5
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!