Overview

Comprehensive Description

Biology

Occurs in coral-rich areas of deep lagoon and seaward reefs from the lower surge zone to at least 50 meters, Ref. 48637. Feeds on a variety of benthic organisms such as algae, echinoderms, fishes, mollusks, tunicates, sponges, and hydrozoans. Has a territorial nature. Eggs laid as one cluster in a shallow excavation on sand or rubble along channels. (Ref. 1602). Marketed fresh and dried-salted (Ref. 9770).
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Chagos, Djibouti, Kenya, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea south to Natal, South Africa (Ref. 4420) and east to the Line, Marquesan and Tuamoto islands, north to southern Japan, south to the southern Great Barrier Reef and New Caledonia.
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 24 - 27; Analspines: 0; Analsoft rays: 20 - 24
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

30.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs in coral-rich areas of deep lagoon and seaward reefs from the lower surge zone to at least 50 m. Feeds on a variety of benthic organisms: algae, echinoderms, fishes, molluscs, tunicates, sponges, and hydrozoans. Has a territorial nature. Eggs laid as one cluster in a shallow excavation on sand or rubble along channels. (Ref. 1602). Marketed fresh and dried-salted (Ref. 9770).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Scales enlarged above the pectoral-fin base and just behind the gill opening to form a flexible tympanum; scales of caudal peduncle with 2 longitudinal rows of large anterior-projecting spines. No groove in front of eye. Caudal peduncle compressed. Color: dark green to dark brown with oblique curved orange lines on posterior head and body; an oblique band of narrow blue and orange stripes from around the mouth to below the pectoral fin; a large round black blotch around peduncular spines; rays of soft dorsal, anal and pectoral fins orange; caudal fin orange (Ref. 9770).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 237 specimens in 1 taxon.
Water temperature and chemistry ranges based on 205 samples.

Environmental ranges
  Depth range (m): 0.15 - 99
  Temperature range (°C): 24.353 - 29.336
  Nitrate (umol/L): 0.019 - 5.255
  Salinity (PPS): 32.279 - 35.924
  Oxygen (ml/l): 3.591 - 4.814
  Phosphate (umol/l): 0.055 - 0.567
  Silicate (umol/l): 0.567 - 10.063

Graphical representation

Depth range (m): 0.15 - 99

Temperature range (°C): 24.353 - 29.336

Nitrate (umol/L): 0.019 - 5.255

Salinity (PPS): 32.279 - 35.924

Oxygen (ml/l): 3.591 - 4.814

Phosphate (umol/l): 0.055 - 0.567

Silicate (umol/l): 0.567 - 10.063
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 50 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in coral-rich (Ref. 58534) areas of deep lagoon and seaward reefs from the lower surge zone to at least 50 meters (Ref. 48637). Feeds on a variety of benthic organisms such as algae, coral, molluscs, worms, echinoderms, fishes, mollusks, tunicates, sponges, and hydrozoans (Ref. 54301). Has a territorial nature. They seek shelter in coral crevices when threatened or when retiring for the night.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawning behaviour may involve loose aggregations and nesting occurs in channels. The eggs are laid in a single spongy cluster in a shallow excavation in rubble or sand. Hatching occurs at night (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 7 specimens with morphological vouchers housed at Queensland Museum
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Balistapus undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6404-09|AP009203|Balistapus undulatus| ACACGTTGACTCTTCTCAACTAATCATAAAGATATCGGCACCCTCTATTTGATTTTTGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTA---AGCTTGCTAATCCGAGCAGAACTAAGCCAACCCGGCGCTCTTTTGGGTGAT---GACCAGATTTATAATGTGATCGTCACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTTGTCCCCCTAATG---ATTGGGGCCCCTGATATAGCATTCCCTCGAATGAATAACATGAGCTTTTGACTTCTACCTCCCTCACTTCTCCTACTCCTAGCCTCCTCAAGCGTAGAAGCAGGGGCCGGTACCGGATGAACCGTCTACCCACCCCTTGCAGGAAACCTGGCCCACGCAGGAGCCTCTGTAGACCTT---ACTATTTTCTCACTACACTTAGCGGGTATTTCATCCATCCTTGGCGCAATCAATTTTATCACCACTATTATTAACATGAAACCTCCCGCCATTTCACAGTACCAAACACCCCTATTTGTATGAGCCGTTCTAATTACAGCAGTACTTCTTCTCCTCTCTCTCCCCGTACTAGCTGCC---GGAATTACAATACTACTAACCGATCGAAATTTAAACACCACATTCTTTGACCCTGCCGGAGGGGGAGATCCAATCCTTTATCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTCTACATTCTTATTCTCCCTGGCTTTGGTATAATTTCTCATATCGTTGCTTATTATTCAGGTAAAAAA---GAACCTTTCGGTTACATGGGTATAGTCTGAGCTATAATGGCCATTGGACTCCTAGGGTTCATCGTCTGAGCCCACCACATGTTTACAGTTGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balistapus undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 16
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Orange-lined triggerfish

The Orange-lined Triggerfish, Orange-striped Triggerfish or Undulated Triggerfish (Balistapus undulatus) is a triggerfish of the tropical Indo-Pacific area. It is the only member of the genus Balistapus. They reach a maximum size of about 30 cm. They feed on coral, crabs and invertebrates. They are found up to around 50 m deep in tropical waters.

In the Aquarium

Balistapus undulatus is a hardy member of a saltwater aquarium. It however has a reputation as one of the meanest fish in the aquarium trade. Sometimes young individuals will accept tank-mates but an owner should expect this fish to kill most fish and invertebrates that share its aquarium. Serious consideration should therefore be made for keeping this fish alone. The minimum tank size to keep a small fish alone is 190 L. It is a slow growing fish, but as it gets older it will likely need a larger aquarium.

References

Gallery

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!