Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Found in shallow and deep waters of northern lakes and streams and is restricted to relatively deep lakes in the southern part of its range (Ref. 5723). Rarely in brackish water (Ref. 11980). A solitary wanderer, the extent of their movements apparently limited by the size of the lake and individual (Ref. 27547). Although lake trout generally feed on a variety of organisms such as freshwater sponges, crustaceans, insects, fishes (with a preference for ciscoes), and small mammals, some populations feed on plankton throughout their lives (Ref. 27547). Such plankton-feeding lake trout grow more slowly, mature earlier and at smaller size, die sooner and attain smaller maximum size than do their fish-eating counterparts (Ref. 30351). Lake trout are highly susceptible to pollution, especially from insecticides (Ref. 14019, 27547). Utilized as a food fish, its flesh is usually of a yellow or creamy color but may be anything from white to orange (Ref. 27547). Often caught by fishers (Ref. 30578).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The native range of the lake trout (also known as lakers, tongue trout, mackinaw trout and mountain trout) includes the cold water regions of northern Canada, Alaska, the Great Lakes and parts of New England. The species has been widely introduced outside its native range in many parts of the western United States and in other areas, including New Zealand, South America and Sweden (Page, 1991).

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native throughout most of Canada and much of Alaska, south to Great Lakes region, northern New England, northern border of western U.S. Introduced in many areas of northern and western U.S. and elsewhere in the world. Common in north, uncommon in Great Lakes except where maintained by artificial propagation (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The native range of the lake trout (also known as lakers, tongue trout, mackinaw trout and mountain trout) includes the cold water regions of northern Canada, Alaska, the Great Lakes and parts of New England. The species has been widely introduced outside its native range in many parts of the western United States and in other areas, including New Zealand, South America and Sweden (Page, 1991).

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: Widely distributed from northern Canada and Alaska south to New England in USA and Great Lakes basin in Canada-USA. Introduced widely to many areas outside its native range. Splakes (hybrid between Salvelinus namaycush and Salvelinus fontinalis) have also been successfully introduced to many areas of North America. The three observed phenotypes existing in Lake Superior (lean, siscowet and humper or paperbelly) are under some genetic control and not merely expressions of environmental adaptation (Ref. 40529).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America, introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Lake trout possess a deeply forked caudal fin and a slate grey to greenish body with lighter undersides. Cream to yellow spots are generally present on the head, body and dorsal and caudal fins. The lower fins tend to be orange-red with a narrow white edge. Younger fish will have seven to twelve interrupted parr marks along their sides (Page, 1991). The species supports nine to twelve gill rakers and unlike their cousin the brook trout, -Salvelinus fontinalis-, lake trout do not have a black stripe on the anterior edge of their anal and pelvic fins (Wisconsin Sea Grant, 1999). Breeding males develop a dark, lateral stripe on their sides (Page, 1991).

Although an average weight of around 3kg is reported for this species, much larger fish are encountered, some weighing in excess of 27kg. These larger trout are thought to have lived for twenty years or more (Trout Angler's Society, 1999). Lake trout average 45 to 68cm in length, with unusual specimens reaching 126cm (Page, 1991).

Lake trout are known to hybridize with brook trout where the range of the two species overlap. The resulting hybrid, known as a splake, supports intermediate features.

Range mass: 0 to 0 kg.

Average mass: 3 kg.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Lake trout possess a deeply forked caudal fin and a slate grey to greenish body with lighter undersides. Cream to yellow spots are generally present on the head, body and dorsal and caudal fins. The lower fins tend to be orange-red with a narrow white edge. Younger fish will have seven to twelve interrupted parr marks along their sides (Page, 1991). The species supports nine to twelve gill rakers and unlike their cousin the brook trout, -Salvelinus fontinalis-, lake trout do not have a black stripe on the anterior edge of their anal and pelvic fins (Wisconsin Sea Grant, 1999). Breeding males develop a dark, lateral stripe on their sides (Page, 1991).

Although an average weight of around 3kg is reported for this species, much larger fish are encountered, some weighing in excess of 27kg. These larger trout are thought to have lived for twenty years or more (Trout Angler's Society, 1999). Lake trout average 45 to 68cm in length, with unusual specimens reaching 126cm (Page, 1991).

Lake trout are known to hybridize with brook trout where the range of the two species overlap. The resulting hybrid, known as a splake, supports intermediate features.

Range mass: 0 to 0 kg.

Average mass: 3 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 4 - 5; Dorsal soft rays (total): 8 - 10; Anal spines: 4 - 5; Analsoft rays: 8 - 10; Vertebrae: 61 - 69
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 51 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 32.7 kg (Ref. 40637); max. reported age: 50 years (Ref. 3494)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Power, G. 1978 Fish population structure in Arctic lakes. J. Fish. Res. Board Can. 35:53-59. (Ref. 3494)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by its color, white or yellowish spots on a dark green to grayish background, its deeply forked tail and its numerous pyloric caeca. Lateral line slightly curved anteriorly; pelvic fins with small axillary process (Ref. 27547). Body typically trout-like, elongate, somewhat rounded. Head stout, broad dorsally; mouth large, terminal, snout usually protruding slightly beyond lower jaw when mouth is closed. Back and sides usually dark green liberally sprinkled with whitish to yellowish (never pink or red) spots; overall color varies from light green to gray, brown, dark green or nearly black; belly white; pale spots present on dorsal, adipose and caudal fins and usually on base of anal; sometimes orange-red on paired fins, especially in northern populations; anterior edge of paired and anal fins sometimes with a white border. At spawning time, males develop a dark lateral stripe and become paler on the back (Ref. 27547). Caudal fin with 19 rays (Ref. 2196). Distinguished from congeners in Europe by the unique dark brown head, body, dorsal and caudal fins, covered by small pale spots; differs also by its deeply forked caudal fin (Ref. 59043).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Lake trout are a cold-water species requiring relatively high concentrations of dissolved oxygen for survival (Ryan, 1994).

Lake trout are the only major native sport fish adapted to the deep, cold water of oligotrophic (low-nutrient) lakes, such as those often found in northern Canada and the northern Great Lakes region (Shuter, 1998)

At the southern range of the species, lake trout require deep water refugia, where preferred temperature ranges and oxygen levels exist. Although most often found in lakes, lake trout may inhabit large river systems that have the neccessary habitat characteristics.

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Deep lakes in south, shallow and deep lakes and rivers in north. Usually in deep water, especially in summer when surface waters warm. Prefers temperatures below 13 C. Rarely in lakes with pH less than 5.2.

Spawns over boulder or rubble bottom in shallower part of lake (less than 12 m in inland lakes, less than 37 m in Great Lakes). Eggs fall into crevices between rocks. Sometimes spawns in rivers.

In Lake Superior, lean lake trout inhabit areas from shore to approximately the 80-m bathymetric contour; Siscowet lake trout generally are in water more than 80 m deep; humpers live primarily on offshore shoals (Harvey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lake trout are a cold-water species requiring relatively high concentrations of dissolved oxygen for survival (Ryan, 1994).

Lake trout are the only major native sport fish adapted to the deep, cold water of oligotrophic (low-nutrient) lakes, such as those often found in northern Canada and the northern Great Lakes region (Shuter, 1998)

At the southern range of the species, lake trout require deep water refugia, where preferred temperature ranges and oxygen levels exist. Although most often found in lakes, lake trout may inhabit large river systems that have the neccessary habitat characteristics.

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; depth range 18 - 53 m (Ref. 1998), usually 18 - 53 m (Ref. 1998)
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 18 - 53m.
From 18 to 53 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

May move hundreds of miles betwen spawning and nonspawning habitats. In northwestern Lake Michigan, recaptures of tagged lake trout indicate that they occupied an area with a radius of approximately 68 km; there was relatively little movement across the lake (moved mostly along the shoreline) (Schmalz et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

As juveniles, lake trout feed on zooplankton and small invertebrates. As they mature, their foraging patterns shift and the fish become opportunistic piscivores.

As adults, lake trout are generally pisciverous, feeding on a wide variety of pelagic prey species. In the Great Lakes region, alewives, smelt, sculpin and chubs make up a large portion of the lake trout diet (Wisconsin Sea Grant, 1999).

Due to the cold water and dissolved oxygen content requirements of the species, lake trout which persist in the southern edge of their range must move to deeper water areas in the warmer summer months. If preffered prey species are not present at these depths, lake trout may then resort to feeding on zooplankton and invertebrates. In habitats that support no pelagic prey species, lake trout must subsist entirely on these secondary food sources. These dietary conditions often produce a leaner trout which grows more slowly and reaches sexual maturity earlier (Vander Zanden, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in shallow and deep waters of northern lakes and streams and is restricted to relatively deep lakes in the southern part of its range (Ref. 5723). Rarely in brackish water (Ref. 11980). A solitary wanderer, the extent of their movements apparently limited by the size of the lake and individual (Ref. 27547). Although lake trout generally feed on a variety of organisms such as freshwater sponges, crustaceans, insects, fishes (with a preference for ciscoes), and small mammals, some populations feed on plankton throughout their lives (Ref. 27547). Such plankton-feeding lake trout grow more slowly, mature earlier and at smaller size, die sooner and attain smaller maximum size than do their fish-eating counterparts (Ref. 30351). Juveniles feed on invertebrates (Ref. 1998).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds opportunistically on various invertebrate and vertebrate animals. Zooplankton (Mysis and Pontoporeia crustaceans) important in diet of young; later, small benthic invertebrates are added to diet. Fishes, when available, are important in diet of adults (Scott and Crossman 1973), which may subsist on zooplankton when surface waters are too warm and fishes are absent in the deeper colder waters.

In Lake Superior, lean lake trout feed primarily on lake herring, rainbow smelt, and slimy sculpin; siscowet lake trout feed mostly on deepwater coregonines and deepwater sculpin (Harvey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

As juveniles, lake trout feed on zooplankton and small invertebrates. As they mature, their foraging patterns shift and the fish become opportunistic piscivores.

As adults, lake trout are generally pisciverous, feeding on a wide variety of pelagic prey species. In the Great Lakes region, alewives, smelt, sculpin and chubs make up a large portion of the lake trout diet (Wisconsin Sea Grant, 1999).

Due to the cold water and dissolved oxygen content requirements of the species, lake trout which persist in the southern edge of their range must move to deeper water areas in the warmer summer months. If preffered prey species are not present at these depths, lake trout may then resort to feeding on zooplankton and invertebrates. In habitats that support no pelagic prey species, lake trout must subsist entirely on these secondary food sources. These dietary conditions often produce a leaner trout which grows more slowly and reaches sexual maturity earlier (Vander Zanden, 1999)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Salvelinus namaycush preys on:
Osmerus eperlanus mordax
Salvelinus confluentus
Myoxocephalus thompsonii

Based on studies in:
Quebec (Lake or pond, Pelagic)

This list may not be complete but is based on published studies.
  • A. Baril, Effect of the water mite Piona constricta on planktonic community structure, M.Sc. Thesis, University of Ottawa, Canada (1983).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Epitheliocystis. Bacterial diseases
  • Lannan, C.N., J.L. Batholomew and J.L. Fryer 1999 Chlamydial infections of fish: Epitheliocystis. p.255-267. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders Vol. 3: Viral, bacterial and fungal infections. CABI Int'l. (Ref. 48851)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large.

Siscowet lake trout are highly abundant in Lake Superior (Harvey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Slow growing, long lived. Especially vulnerable to sea lamprey parasitism.

Lake trout can displace bull trout and may prevent bull trout from becoming established in certain low elevation lakes (Donald and Alger 1993).

Evidence from central U.S. waters of Lake Superior implies that siscowet predation on nearshore prey has not had a direct negative effect on lean lake trout stocks (Harvey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The spawning act occurs mostly at night, with peak activity between dusk and 9 or 10 pm (Ref. 28805, 28815). During the day the fish are more or less dispersed away from the spawning beds but return in considerable numbers in the late afternoon (Ref. 27547). Males reach spawning beds first and spend some time cleaning the rocks. Females arrive a few days later and are courted by the males. During and following courtship, the males attempt to spawn with the females. One or two males approach a female, press against her sides and quiver. The eggs fall into the crevices and the spawners disperse. The act is repeated until the female releases all her eggs (Ref. 1998, 27547). On occasion, as many as seven males and three females may engage in a mass spawning act (Ref. 28815). Spawning occurs annually in southern areas, every other year in Great Slave Lake, Northwest Terrritories, and only every other year in Great Bear and some other lakes of the arctic (Ref. 1153, 28802, 28860).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: wild:
41.0 years.

Average lifespan

Status: captivity:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
41.0 years.

Average lifespan

Status: captivity:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Lake trout are a slow-growing, late-maturing species with generally low reproductive potential (Shuter, 1998). Though long-lived, both males and females, on average, do not reach sexual maturity until six to eight years of age (Wisconsin Sea Grant, 1999). Research has indicated that environmental factors, such as lake size and dissolved solid concentrations, may play a role in the age of first maturity and overall repoductive success of the lake trout (Shuter, 1998).

Lake trout seek substrates of cobble, rubble or gravel in which to spawn. Males will fan the bottom clean of finer silt so that the fertilized eggs of the female can be deposited in the substrate. As a female enters a spawning area, several males engage in amplexus (clasping) with the female; in this way eggs and sperm are broadcast over the substrate. Spawning generally takes place in fall or early winter and most often at night (Moyle, 1976).

Because of the colder water habitats preferred by -S. namaycush-, fertilized eggs require a long time to hatch. Eggs overwinter for four to six months before hatching. The developing trout remain in the crevices of the spawing substrate until their yolk-sac is completely absorbed. These "fingerlings" then move into deeper waters in search of food, usually in the form of zooplankton.

Average age at sexual or reproductive maturity (male)

Sex: male:
4745 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
4927 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns generally in fall, earlier in the north than in the south. In Lake Superior, siscowet form has been found in spawning condition in spring and summer as well as in fall; humper form spawns in late summer and early fall (Burnham-Curtis and Smith 1994). Eggs hatch in winter or spring, usually after 4-5 months. Sexually mature sometimes as early as age IV, sometimes as late as age XVII. Post-spawning mortality generally is low (Stearley 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lake trout are a slow-growing, late-maturing species with generally low reproductive potential (Shuter, 1998). Though long-lived, both males and females, on average, do not reach sexual maturity until six to eight years of age (Wisconsin Sea Grant, 1999). Research has indicated that environmental factors, such as lake size and dissolved solid concentrations, may play a role in the age of first maturity and overall repoductive success of the lake trout (Shuter, 1998).

Lake trout seek substrates of cobble, rubble or gravel in which to spawn. Males will fan the bottom clean of finer silt so that the fertilized eggs of the female can be deposited in the substrate. As a female enters a spawning area, several males engage in amplexus (clasping) with the female; in this way eggs and sperm are broadcast over the substrate. Spawning generally takes place in fall or early winter and most often at night (Moyle, 1976).

Because of the colder water habitats preferred by -Salvelinus namaycush-, fertilized eggs require a long time to hatch. Eggs overwinter for four to six months before hatching. The developing trout remain in the crevices of the spawing substrate until their yolk-sac is completely absorbed. These "fingerlings" then move into deeper waters in search of food, usually in the form of zooplankton.

Average age at sexual or reproductive maturity (male)

Sex: male:
4745 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
4927 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salvelinus namaycush

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCCCTTAGCCTCTTGATTCGGGCAGAGTTAAGCCAACCCGGAGCTCTTCTAGGGGATGACCAAATCTATAACGTAATCGTAACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATACCAATTATGATTGGAGGCTTTGGAAACTGATTAATTCCTCTAATAATCGGGGCCCCAGACATAGCGTTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCACCGTCCTTTCTCCTTCTCCTGGCTTCGTCCGGGGTTGAAGCCGGCGCCGGTACGGGATGAACAGTCTACCCCCCTCTAGCCGGGAACCTCGCCCACGCAGGGGCCTCCGTTGATTTAACTATCTTCTCTCTTCATTTAGCTGGCATTTCCTCAATTTTAGGGGCCATTAACTTTATCACAACCATTATTAACATGAAGCCCCCAGCTATTTCTCAATATCAAACCCCGCTTTTTGTTTGAGCTGTGTTAGTTACTGCTGTCCTTTTATTACTTTCCCTCCCCGTATTAGCAGCAGGCATTACTATATTACTCACGGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGGGACCCAATTTTATACCAGCACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Salvelinus namaycush

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 111
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The commercial lake trout fishery in Lake Superior alone supported an annual commercial harvest of 2 million kg from 1920 to 1950. Overfishing and predation by the non-native sea lamprey, -Petromyzon marinus-, led to a sharp decline in the commercial take in the 1950's. Continued stocking since 1952, chemical control of the sea lamprey and the closing of the commercial fishery in the early 1960's has stabilized the population, but has not acheived the goal of restoring self-sustaining stocks that can support an annual harvest comparable to that of the 1930's and early 1940's. (Great Lakes Fishery Commission, 1996).

Success of the stocked fish has varied depending on the area. Due to this and other factors, the restoration plan for Lake Superior has changed from a program that concentrated heavily on stocking to a program that emphasized management of wild lake trout populations.

Continued mangement of the sea lamprey, stringent fishing controls and better survival of stocked fish will be key components of future restoration plans. (Great Lakes Fishery Commission, 1996).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The commercial lake trout fishery in Lake Superior alone supported an annual commercial harvest of 2 million kg from 1920 to 1950. Overfishing and predation by the non-native sea lamprey, -Petromyzon marinus-, led to a sharp decline in the commercial take in the 1950's. Continued stocking since 1952, chemical control of the sea lamprey and the closing of the commercial fishery in the early 1960's has stabilized the population, but has not acheived the goal of restoring self-sustaining stocks that can support an annual harvest comparable to that of the 1930's and early 1940's. (Great Lakes Fishery Commission, 1996).

Success of the stocked fish has varied depending on the area. Due to this and other factors, the restoration plan for Lake Superior has changed from a program that concentrated heavily on stocking to a program that emphasized management of wild lake trout populations.

Continued mangement of the sea lamprey, stringent fishing controls and better survival of stocked fish will be key components of future restoration plans. (Great Lakes Fishery Commission, 1996).

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Extirpated or greatly reduced in abundance in the Great Lakes due to the combined effects of overfishing and parasitism by sea lampreys. Populations of exotic Pacific salmon in Lake Superior do not appear to be having a substantial negative impact of lake trout populations or forage species for lake trout (see Harvey et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Lake trout restoration is possible if sea lampreys are controlled, the appropriate strain is stocked, and exploitation is limited, although additional limiting factors could hinder success in some locations of the Great Lakes (Reid et al. 2001).

See Eshenroder (1987) for information on the role of contaminant burdens and socioeconomic factors in the reestablishment of populations in the Great Lakes.

Management Requirements: See Kaeding et al. (1996) for information on proposed control methods (gillnetting, trapping) for introduced lake trout in Yellowstone Lake.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Although once an important commercial fish stock, lake trout levels in the Great Lakes dropped sharply during the 1950's. Lake trout are still highly valued as a sport fish and anglers who seek this species contribute to the regional economy of areas with fishable populations through the purchase of fishing licenses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Although once an important commercial fish stock, lake trout levels in the Great Lakes dropped sharply during the 1950's. Lake trout are still highly valued as a sport fish and anglers who seek this species contribute to the regional economy of areas with fishable populations through the purchase of fishing licenses.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Introduced lake trout can cause large declines in cutthroat trout populations (Kaeding et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lake trout

For the band, see Lake Trout (band). For the Baltimore food item, see Culture of Baltimore#Lake Trout.

Lake trout (Salvelinus namaycush) is a freshwater char living mainly in lakes in northern North America. Other names for it include mackinaw, lake char (or charr), touladi, togue, and grey trout. In Lake Superior, it can also be variously known as siscowet, paperbelly and lean. The lake trout is prized both as a game fish and as a food fish.

Range[edit]

From a zoogeographical perspective, lake trout are quite rare. They are native only to the northern parts of North America, principally Canada, but also Alaska and, to some extent, the northeastern United States.[2] Lake trout have been widely introduced into non-native waters in North America[3] and into many other parts of the world, mainly Europe, but also into South America and certain parts of Asia. Although lake trout were introduced into Yellowstone National Park's Shoshone, Lewis and Heart lakes legally in the 1890s, they were illegally or accidentally introduced into Yellowstone lake in the 1980s where they are now considered invasive.[4]

Description[edit]

A lake trout

Lake trout are the largest of the chars; the record weighed almost 46.3 kilograms (102 lb) (netted) with a length of 50 inches (127 cm), and 15– to 40-pound fish are not uncommon. The average length is 24-36 inches (61–92 cm). The largest caught on a rod and reel according to the IGFA was 72 pounds (33 kg), caught in Great Bear Lake in 1995 with a length of 59 inches (150 cm).[5]

Life history[edit]

Lake trout inhabit cold, oxygen-rich waters. They are pelagic during the period of summer stratification in dimictic lakes, often living at depths of 20–60 m (60–200 ft).

The lake trout is a slow-growing fish, typical of oligotrophic waters. It is also very late to mature. Populations are extremely susceptible to overfishing. Many native lake trout populations have been severely damaged through the combined effects of hatchery stocking (planting) and over harvest.

Two basic types of lake trout populations are generally accepted. Some lakes do not have pelagic forage fish during the period of summer stratification. In these lakes, lake trout take on a life history known as planktivory. Lake trout in planktivorous populations are highly abundant, grow very slowly and mature at relatively small sizes. In those lakes that do contain deep-water forage, lake trout become piscivorous. Piscivorous lake trout grow much more quickly, mature at a larger size and are less abundant. Notwithstanding differences in abundance, the density of biomass of lake trout is fairly consistent in similar lakes, regardless of whether the lake trout populations they contain are planktivorous or piscivorous.

A lake trout in spawning dress.

In Lake Superior, three distinct phenotypes of lake trout persist, commonly known as "siscowet", "paperbelly" and "lean". The distinct groups operate, to some level at least, under genetic control and are not mere environmental adaptations.[6] Siscowet numbers, especially, have become greatly depressed over the years due to a combination of the extirpation of some of the fish's deep water coregonine prey and to overexploitation. Siscowet tend to grow extremely large and fat and attracted great commercial interest in the last century. Their populations have rebounded since 1970, with one estimate putting the number in Lake Superior at 100 million.[7]

Hybrids[edit]

Lake trout are known to hybridize in nature with the brook trout, but such hybrids, known as "splake", are normally sterile but self-sustaining populations exist in some lakes.[8] Splake are also artificially propagated in hatcheries, and then planted into lakes in an effort to provide sport-fishing opportunities.[9]

Commercial fishing[edit]

Lake trout were fished commercially in the Great Lakes until lampreys, overharvest and pollution extirpated or severely reduced the stocks. Commercial fisheries still exist in some areas of the Great Lakes and smaller lakes in northern Canada. Commercial fishing by Ojibwe for Lake Trout in the Lake Superior is permitted under various treaties and regulated by the Great Lakes Indian Fish & Wildlife Commission (GLIFWC).[10]

Origin of name[edit]

The specific epithet namaycush derives from namekush, a form of the word used in some inland Southern East Cree communities in referring to this species of fish. Other variations found in East Cree are kûkamâs[h], kûkamâw and kûkamesh.[11] Similar cognate words are found in Ojibwe: namegos = "lake trout"; namegoshens = "rainbow trout", literally meaning "little lake trout".[12]

Popular culture[edit]

Geneva, New York claims the title "Lake Trout Capital of the World," and holds an annual lake trout fishing derby.[13]

References[edit]

  1. ^ "Salvelinus namaycush". Integrated Taxonomic Information System. Retrieved 23 November 2013. 
  2. ^ "Salvelinus namaycush Lake trout". Animal Diversity Web. Retrieved 2013-11-23. 
  3. ^ "NAS - Nonindigenous Aquatic Species Lake Trout". US Geological Survey. Retrieved 2013-11-23. 
  4. ^ Munro, Andrew R.; Thomas E. McMahon; James R. Ruzycki (Spring 2006). "Source and Date of Lake Trout Introduction". Yellowstone Science 14 (2). 
  5. ^ "International Game Fish Association-Lake Trout". International Game Fish Association. Retrieved 2013-11-23. 
  6. ^ Burnham-Curtis, M.K. and G.R. Smith, 1994. Osteological evidence of genetic divergence of lake trout (Salvelinus namaycush) in Lake Superior. Copeia (4):845-850.
  7. ^ Moen, Sharon (December 2002). "Siscowet Trout: A Plague of Riches". Minnesota Sea Grant. Retrieved 20 December 2007. 
  8. ^ Berst, A. H.; Ihssen, P. E.; Spangler, G. R.; Ayles, G. B.; Martin, G. W. (1980). "The splake, a hybrid charr Salvelinus namaycush x S. fontinalis.". In Balon, E. K. Charrs, Salmonid Fishes of the Genus Salvelinus. The Hague: Dr. W. Junk Publishers. pp. 841–887. 
  9. ^ "Why Splake?". Maine.gov Department of Inland Fisheries and Wildlife. Retrieved 2013-11-23. 
  10. ^ "Lake Superior Treaty Fishery". Great Lakes Indian Fish & Wildlife Commission. Retrieved 2013-11-24. 
  11. ^ Berkes, Fikret and Marguerite MacKenzie. "Cree Fish Names from Eastern James Bay, Quebec" in Arctic, Vol. 31, No. 4 (Dec 1978), pp. 489-495
  12. ^ Weshki-ayaad, Lippert and Gambill. Freelang Ojibwe Dictionary Online. Accessed September 21, 2010.
  13. ^ Lake trout derby, Geneva, NY Accessed September 29, 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Three phenotypes, lean, siscowet, humper (or paperbelly) occur in Lake Superior; there is evidence that the morphological differences among these phenotypes are under some genetic control, and there is evidence of limited gene flow among the phenotypes; the siscowet and humper phenotypes apparently originated in Lake Superior in postglacial time (Burnham-Curtis and Smith 1994). Nearshore lean lake trout have low fat content and are valued by anglers and commerical fishers. Offshore siscowet lake trout have low commercial value because of their high fat content. Humpers live primarily on offshore shoals.

A hybrid between lake trout and brook trout is called a slake.

Placed in genus Cristivomer by some authors in the 1960s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!