Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The Brook Trout is a beautifully-colored fish, iridescent blue to green with yellow spots and sometimes orange to red spots with blue halos across its side. The back may darken to an olive green with dark, wavy, worm-like lines which are lacking in other salmonids. While their undersides lighten to a silvery white, their lower fins are orange with white margins. They have teeth located only in the front of their mouths. Average size of the fish is ten to twelve inches long and one to four pounds, but largest on record was over 14 pounds. The Brook Trout eats a wide variety of insects and small animals. A juvenile will eat insect larva, plankton, and small crustaceans while a larger adult may eat small fish and crayfish.

In the late fall the female will scoop out a shallow hole in the gravel of the streambed or lake bottom around the shoreline. The male and female together then extrude eggs and milt into the hole, the female then covering the fertilized eggs (100 to 5000, depending on her size) to incubate them during the winter. In two or three months the surviving eggs hatch. The young go through a couple of stages before they reach adulthood. During the fry and fingerling stages they eat plankton and as they grow into adulthood they will begin to eat insects and larger prey. The Brook Trout commonly lives its entire life in the same streams and lakes in which it was born or sometimes it may travel out to sea, returning to freshwater to spawn. Maximum life expectancy is about five years old.

Although the Brook Trout is more commonly found at high elevations in the cold water of mountain streams, rivers, lakes and ponds, it populates many watersheds in New England at nearly all elevations. It requires high oxygen content in the water and does not do well in water that gets above 68 degrees in the summer. The Brook Trout is distinguished as being the only trout native to New England waters: brown trout originated from Europe, and rainbow trout came from the northwest United States.

Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Occurs in clear, cool, well-oxygenated creeks, small to medium rivers, and lakes (Ref. 5723, 44894, 10294). Nerito-pelagic (Ref. 58426). In its native range, general upstream movements have been observed in early spring, summer and late fall; downstream movements, in late spring and fall (Ref. 28546, 28548, 28549, 28550). Some fish, popularly known as salters, run to the sea in the spring as stream temperatures rises, but never venture more than a few kilometers from river mouths. It may remain at sea for up to three months (Ref. 28546, 28549, 28551). Feeds on a wide range of organisms including worms, leeches, crustaceans, insects (chironomids, caddisflies, blackflies, mayflies, stoneflies and dragonflies (Ref. 5951), mollusks, fishes and amphibians (Ref. 3348, 10294); also small mammals (Ref. 1998). Stomachs of some individuals contained traces of plant remains (Ref. 1998). There are reports of introduced fish reaching 15 years of age in California, USA (Ref. 28545). Cultured for food and for stocking (Ref. 27547). Extensively used as an experimental animal (Ref. 1998). Marketed fresh and smoked; eaten fried, broiled, boiled, microwaved, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Newfoundland to western side of Hudson Bay; south in Atlantic, Great Lakes, and Mississippi River basins to Minnesota and northern Georgia
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: This species is native to most of eastern Canada and the northeastern United States, from Newfoundland to the southwestern side of Hudson Bay, and south in the Atlantic, Great Lakes, and Mississippi River basins to Minnesota, northeastern Iowa, Wisconsin, Lake Michigan (but not Illinois streams), Chagrin River (Lake Erie drainage) in northeastern Ohio, northern New Jersey, New England, and southward in the Atlantic and Mississippi basins of the Appalachian Mountains to northern Georgia (Smith 1979, Trautman 1981, Becker 1983, Cooper 1983, Smith 1985, Etnier and Starnes 1993, Jenkins and Burkhead 1994, Menhinick 2001, Behnke 2002, Hartel et al. 2002, Moyle 2002, Bailey et al. 2004). Sea-run populations at least formerly extended from the Atlantic provinces of Canada to Long Island, New York (Scott and Crossman 1973), including Hudson Bay (Behnke 2002). Brook trout have been introduced in most of the lower peninsula of Michigan, western North America, and temperate regions in many other parts of the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Brook trout are found as far south as Georgia in the Appalachian mountain range and extend north all the way to Hudson Bay. From the east coast their native range extends westward to eastern Manitoba and the Great Lakes (Willers, 1991). The fish has been introduced, very successfully in some areas, into many parts of the world including western North America, South America, New Zealand, Asia, and many parts of Europe (Scott and Crossman, 1973).

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced ); australian (Introduced )

  • Scott, W., E. Crossman. 1985. Freshwater Fishes of Canada. Ottawa, Canada: Minister of Supply and Services Canada.
  • Willlers, B. 1991. Trout Biology. New York City, New York: Lyons and Burford.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: most of eastern Canada from Newfoundland to western side of Hudson Bay; south in Atlantic, Great Lakes, and Mississippi River basins to Minnesota and northern Georgia in USA. South America: Argentina (Ref. 9086). Widely introduced in temperate regions of other continents. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Brook trout are found as far south as Georgia in the Appalachian mountain range and extend north all the way to Hudson Bay. From the east coast their native range extends westward to eastern Manitoba and the Great Lakes (Willers, 1991). The fish has been introduced, very successfully in some areas, into many parts of the world including western North America, South America, New Zealand, Asia, and many parts of Europe (Scott and Crossman, 1973).

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced ); australian (Introduced )

  • Scott, W., E. Crossman. 1985. Freshwater Fishes of Canada. Ottawa, Canada: Minister of Supply and Services Canada.
  • Willlers, B. 1991. Trout Biology. New York City, New York: Lyons and Burford.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America, introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern North America, north to the Southern coast of Labrador, west to Minnesota, and southward to Georgia along the Allegheny Mountains.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The brook trout's body is elongate with an average length of 38.1-50.8 cm, is only slightly laterally compressed; the body has its greatest depth at or in front of the origin of the dorsal fin (Scott and Crossman, 1985). Another physical characteristic of the brook trout is an adipose fin and a caudal fin that is slightly forked (Hubbs and Lagler, 1949). Brook trout have 10-14 principle dorsal rays, 9-13 principle anal rays, 8-10 pelvic rays, and 11-14 pectoral rays (Scott and Crossman, 1985). The brook trout also has a large terminal mouth with breeding males developing a hook or kype on the front of the lower jaw (Scott and Crossman, 1985).

The coloration of the brook trout is very distinct and can be spectacular. The back of the brook trout is dark olive-green to dark brown, sometimes almost black, the sides are lighter and become silvery white ventrally (Scott and Crossman, 1985). On the back and top of the head there are wormy cream colored wavy lines known as vermiculations which break up into spots on the side (Scott and Crossman, 1985). In addition to the pale spots on the side there are smaller more discrete red spots with bluish halos (Scott and Crossman 1985). The fins of the brook trout are also distinct; the dorsal fin has heavy black wavy lines, the caudal fin has black lines, the anal, pelvic and pectoral fins have white edges followed by black and then reddish coloration (Scott and Crossman, 1985).

Range mass: 1 to 6 kg.

Range length: 38.1 to 50.8 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Hubbs, C., K. Lagler. 1949. Fishes of the Great Lakes Region. Ann Arbor, Michigan: University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 3 - 4; Dorsal soft rays (total): 8 - 14; Anal spines: 3 - 4; Analsoft rays: 8 - 14; Vertebrae: 58 - 62
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

The brook trout's body is elongate with an average length of 38.1-50.8 cm, is only slightly laterally compressed; the body has its greatest depth at or in front of the origin of the dorsal fin (Scott and Crossman, 1985). Another physical characteristic of the brook trout is an adipose fin and a caudal fin that is slightly forked (Hubbs and Lagler, 1949). Brook trout have 10-14 principle dorsal rays, 9-13 principle anal rays, 8-10 pelvic rays, and 11-14 pectoral rays (Scott and Crossman, 1985). The brook trout also has a large terminal mouth with breeding males developing a hook or kype on the front of the lower jaw (Scott and Crossman, 1985).

The coloration of the brook trout is very distinct and can be spectacular. The back of the brook trout is dark olive-green to dark brown, sometimes almost black, the sides are lighter and become silvery white ventrally (Scott and Crossman, 1985). On the back and top of the head there are wormy cream colored wavy lines known as vermiculations which break up into spots on the side (Scott and Crossman, 1985). In addition to the pale spots on the side there are smaller more discrete red spots with bluish halos (Scott and Crossman 1985). The fins of the brook trout are also distinct; the dorsal fin has heavy black wavy lines, the caudal fin has black lines, the anal, pelvic and pectoral fins have white edges followed by black and then reddish coloration (Scott and Crossman, 1985).

Range mass: 1 to 6 kg.

Range length: 38.1 to 50.8 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Hubbs, C., K. Lagler. 1949. Fishes of the Great Lakes Region. Ann Arbor, Michigan: University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 40 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 860 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

86.0 cm SL (male/unsexed; (Ref. 7248)); max. published weight: 9,390 g (Ref. 4699); max. reported age: 24 years (Ref. 72501)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 86 cm SL; max. weight: 9,390 g.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by the combination of dark green marbling on its back and dorsal fin and by the red spots with blue halos on its sides (Ref. 27547). Pelvic fins with axillary process; caudal nearly straight or with a shallow indentation (Ref. 27547). Color varies, but generally rather green to brownish on back, marked with paler vermiculations or marbling that extend onto the dorsal fin and sometimes the caudal; sides lighter than back, marked with numerous pale spots and some red spots, each of the latter surrounded by a blue halo; anal, pelvic and pectoral fins with a white leading edge followed by a dark stripe, the rest of the fins reddish (Ref. 27547). In spawning fish the lower sides and fins become red (Ref. 27547). Sea-run fish are dark green above with silvery sides, white bellies and very pale pink spots (Ref. 27547). Caudal fin with 19 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

anadromous; found in cool, clear streams and lakes, most venture out to the sea for 2-3 months of the year
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Most populations occur in clear, cool, well-oxygenated creeks, small to medium rivers, and lakes. Individuals may move from streams into lakes or the sea to avoid high temperatures in summer. Some populations migrate between freshwater and saltwater habitats. Other populations (known as "coasters") live in lakes and migrate to streams to spawn, or they remain in the lake to spawn. Preferred water temperature is around 14-16 C; brook trout do poorly where water temperature exceeds 20 C for extended periods (see Sublette et al. 1990). Spawning occurs in cool water (usually less than 15 C) usually over gravel beds in shallow headwaters but also may occur in gravelly shallows of lakes if spring (groundwater) upwelling and moderate current or nearby surficial inflow (Quinn 1995) are present. Eggs are buried in nests in gravel. In Ontario, eggs were buried at 7-20 cm in bottom substrate (Snucins et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brook trout are found in three types of aquatic environments: rivers, lakes, and marine areas. Their living requirements in these environments are very specific. The freshwater populations occur in clear, cool, well-oxygenated streams and lakes (Scott and Crossman, 1985). Brook trout thrive in these environments with temperatures that remain below 18.8 C and where there is little to no siltation (LaConte, 1997). Stream dwelling brook trout require three habitat components, which include resting areas in pools, feeding sites near riffles or swiftly flowing water, and escape cover which normally is found along undercut banks, under woody debris, trees or large rock ledges ("Brook Trout," 1987). Brook trout that reside in marine environments migrate there from freshwater tributaries and tend to stay close to river mouths.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

  • LaConte, V. 1997. Ohio's Native Brook Trout. Wild Ohio, Fall.
  • 1987. Brook Trout. J Mayhew, ed. Iowa Fish and Fishing. Des Moines, Iowa, USA: Iowa Department of Natural Resources. Accessed November 04, 2004 at http://www.iowadnr.com/fish/iafish/brooktro.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 15 - 27 m (Ref. 3899)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brook trout are found in three types of aquatic environments: rivers, lakes, and marine areas. Their living requirements in these environments are very specific. The freshwater populations occur in clear, cool, well-oxygenated streams and lakes (Scott and Crossman, 1985). Brook trout thrive in these environments with temperatures that remain below 18.8 C and where there is little to no siltation (LaConte, 1997). Stream dwelling brook trout require three habitat components, which include resting areas in pools, feeding sites near riffles or swiftly flowing water, and escape cover which normally is found along undercut banks, under woody debris, trees or large rock ledges ("Brook Trout," 1987). Brook trout that reside in marine environments migrate there from freshwater tributaries and tend to stay close to river mouths.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

  • LaConte, V. 1997. Ohio's Native Brook Trout. Wild Ohio, Fall.
  • 1987. Brook Trout. J Mayhew, ed. Iowa Fish and Fishing. Des Moines, Iowa, USA: Iowa Department of Natural Resources. Accessed November 04, 2004 at http://www.iowadnr.com/fish/iafish/brooktro.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 4.5
  Temperature range (°C): 2.279 - 2.279
  Nitrate (umol/L): 3.660 - 3.660
  Salinity (PPS): 33.515 - 33.515
  Oxygen (ml/l): 7.696 - 7.696
  Phosphate (umol/l): 0.700 - 0.700
  Silicate (umol/l): 4.428 - 4.428

Graphical representation

Depth range (m): 0 - 4.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 15 - 27m.
From 15 to 27 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; freshwater; brackish; marine; depth range 15 - 27 m. Occurs in clear, cool, well-oxygenated creeks, small to medium rivers, and lakes. ?Salters? run to the sea in the spring as stream temperatures rises, remain close to river mouths. May stay at sea for up to three months.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Introduction

This species has been introduced or released in Dutch waters.
  • Nijssen, H.; de Groot, S.J. (1987). De vissen van Nederland: systematische indeling, historisch overzicht, het ontstaan van de viskweek, uitheemse vissoorten, determineersleutels, beschrijvingen, afbeeldingen, literatuur, van alle in Nederlandse wateren voor komende zee- en zoetwatervissoorten [Fishes of the Netherlands: systematic classification, historical overview, origins of fish culture, non-indigenous species, determination keys, descriptions, drawings, literature references on all marine and freshwater fish species living in Dutch waters]. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-006-1. 224 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Some populations spawn and undergo considerable development in fresh water but also feed and develop to some extent in salt water (Hartel et al. 2002). These "salters" or "sea trout" may coexist with nonmigratory brook trout. The timing of seaward migration is variable but generally occurs in spring in northern latitudes (Naiman et al. 1987). Migrants spend a few days to 4 months in coastal seawater not far (usually less than 45 kilometers) from their natal stream (Mullan 1958, Smith and Saunders 1958, Bergin 1984, Naiman et al. 1987, Montgomery et al. 1990, Ryther 1997). Although sea-run populations often are referred to as being "anadromous," they are most accurately classified as "amphidromous" because they make regular feeding migrations to the sea while still undergoing significant freshwater growth (Collette and Klein-McPhee 2002).

Adults in some populations migrate seasonally between lakes and tributary streams. In the Great Lakes, these brook trout are known as "coasters." Some coasters remain permanently in lakes.

Movement can be extensive even within streams. For example, in the Kennebecasis River, New Brunswick, brook trout moved upstream 65-100 kilometers in spring after ice loss; summer movements were minimal; movements to spawning areas in fall were less than 10 kilometers, then the fish moved back downstream to wintering areas in the lower to middle reaches of the river (Curry et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds opportunistically on various invertebrate and vertebrate animals, including primarily terrestrial and aquatic insects and planktonic crustaceans. In estuarine and marine habitats, the diet includes various fishes and crustaceans (see Collette and Klein-McPhee 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The food habits of brook trout vary according to their age and life history stage. As fry, or very young fish, brook trout feed primarily on immature stages of aquatic insects (Everhart, 1961). In general a brook trout's diet can be likened to a smorgasbord of organisms with prey ranging from Ephemeroptera to Caudata (Wittman, 2001). A brook trout will virtually eat anything its mouth will accommodate, including mostly many aquatic insect larvae such as Trichoptera, mayflies, Chironomidae, and Simuliidae. Other organisms consumed include worms, leeches, crustaceans, terrestrial insects, spiders, mollusks, a number of other fish species (cannibalism is limited to spawning time and spring), frogs, salamanders, snakes and even small mammals like voles (e.g. Microtus, Cleithrionomys), should they find one in the water (Scott and Crossman, 1985). As brook trout become larger their diet shifts more towards a piscovourus one (Everhart, 1961). Sea-run brook trout eat fish and intertebrates that are commonly found in marine environments (Scott and Crossman, 1985).

Animal Foods: mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; mollusks; aquatic or marine worms; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits cold, well-oxygenated waters of rivers, lakes and reservoirs (Ref. 30578). Anadromous (Ref. 5951). Feeding effort in juveniles is directed toward sub-surface, invertebrate drift (Ref. 28091). It is preyed upon by eels, white perch, yellow perch, chain pickerel, eastern belted kingfisher and American merganser (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The food habits of brook trout vary according to their age and life history stage. As fry, or very young fish, brook trout feed primarily on immature stages of aquatic insects (Everhart, 1961). In general a brook trout's diet can be likened to a smorgasbord of organisms with prey ranging from mayflies to salamanders (Wittman, 2001). A brook trout will virtually eat anything its mouth will accommodate, including mostly many aquatic insect larvae such as caddisflies, mayflies, midges, and black flies. Other organisms consumed include worms, leeches, crustaceans, terrestrial insects, spiders, mollusks, a number of other fish species (cannibalism is limited to spawning time and spring), frogs, salamanders, snakes and even small mammals like voles (e.g. Microtus, Cleithrionomys), should they find one in the water (Scott and Crossman, 1985). As brook trout become larger their diet shifts more towards a piscovourus one (Everhart, 1961). Sea-run brook trout eat fish and intertebrates that are commonly found in marine environments (Scott and Crossman, 1985).

Animal Foods: mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wide range of organisms including worms, leeches, crustaceans, insects, mollusks, fishes, amphibians, and small mammals.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Salvelinus fontinalis (Brook trout (N=2)) is prey of:
Salvelinus fontinalis

Based on studies in:
USA: New York, Bridge Brook (Lake or pond)

This list may not be complete but is based on published studies.
  • Havens K (1992) Scale and structure in natural food webs. Science 257:1107–1109
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • W. E. Ricker, 1934. An ecological classification of certain Ontario streams. Univ. Toronto Studies, Biol. Serv. 37, Publ. Ontario Fish. Res. Lab. 49:7-114, from pp. 78, 89.
  • Thompson, RM and Townsend, CR. 2003. Impacts on stream food webs of native and exotic forest: an intercontinental comparison. Ecology 84:145-161
  • W. E. Ricker, 1934. An ecological classification of certain Ontario streams. Univ. Toronto Studies, Biol. Serv. 37, Publ. Ontario Fish. Res. Lab. 49:7-114, from pp. 105-106.
  • J. D. Allan, 1982. The effects of reduction in trout density on the invertebrate community of a mountain stream. Ecology 63:1444-1455, from p. 1452.
  • Havens K (1992) Scale and structure in natural food webs. Science 257:1107–1109
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hysterothylacium Infection 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Camallanus Infection 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Adults in streams may defend small feeding territories that extend several body lengths in diameter (Grant et al. 1989). In experimental stream communities, Resetarits 1991 found that brook trout negatively affected both growth and survival of the salamander GYRINOPHILUS PORPHYRITICUS; the presence of GYRINOPHILUS had no affect on relative condition or fecundity of SALVELINUS. SALVELINUS and GYRINOPHILUS affected the growth of the two-lined salamander EURYCEA and the crayfish CAMBARUS BARTONII. SALVELINUS caused CAMBARUS and EURYCEA to alter their activity levels and habitat; EURYCEA and CAMBARUS were able to avoid predation by SALVELINUS and GYRINOPHILUS but at a significant cost to growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on worms, leeches, crustaceans, insects, molluscs, fishes and amphibians
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Most feeding in early morning and evening (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Courtship begins with a male attempting to drive a female toward suitable spawning gravel. A receptive female chooses a spot and digs a redd. While the female is digging, the male continues courtship activity, darting alongside the female and quivering, swimming over and under her and rubbing her with his fins; most of the time however, is spent driving off other males. When the redd is completed, the pair enter the nest and deposit eggs and milt. After spawning the female covers the eggs by sweeping small pebbles at the downstream edge of the redd upstream. Once the eggs are completely covered, she moves to the upstream end of the redd and begins digging a new redd (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
24.0 years.

Average lifespan

Sex: female

Status: wild:
16.0 years.

Average lifespan

Sex: male

Status: wild:
16.0 years.

Average lifespan

Status: wild:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
24.0 years.

Average lifespan

Sex: female

Status: wild:
16.0 years.

Average lifespan

Sex: male

Status: wild:
16.0 years.

Average lifespan

Status: wild:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (wild) Observations: Environmental factors impact greatly on the lifespan of these animals (Das 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawning occurs in late summer (in north) or fall (October-November in many areas). Eggs hatch in 47 days at 10 C, in 165 days at 2.8 C. In Ontario, alevin emergence occurred over a 71-day period, coinciding with the spring thaw and an episodic pH depression (Snucins et al. 1992). Sexually mature in 2-3 years (also reported as first year for males, 2nd year for females). Only small percentages of returning migrants actually spawn; post-spawning mortality generally is low (Stearley 1992). In dense, small-stream populations, few live more than 3 years, whereas some live 9-10 years in large rivers and lakes in the northern part of the range (Behnke 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually only a single male is able to fertilize the eggs that a female lays in a redd, but occasionally more than one male is able to do so. Usually the largest males are the most successful breeders.

Mating System: monogamous ; polyandrous

Brook trout spawn in late summer or autumn depending on the latitude and temperature (Scott and Crossman, 1985). The type of area required for brook trout spawning is one that offers loose, clean gravel in shallow riffles or shoreline area with an excellent supply of upwelling, oxygen-rich water (LaConte, 1997). Mature fish have been known to travel many miles upstream to reach adequate spawning grounds (Scott and Crossman, 1985). Females are able to detect upwelling springs or other areas of ground-water flow, which make for excellent spawning grounds. Brook trout reach maturity on an average at the age of two and spawn every year, although their size at first maturity depends on growth rate and the productivity of thier habitat (Everhart, 1961). Males often outnumber females at the spawning site, but only rarely is more than one male able to fertilize the eggs in a particular redd (Scott and Crossman, 1985; Blanchfield et al., 2003). The females clear away debris and silt with rapid fanning of her caudal fin while on her side, creating a redd (Scott and Crossman, 1985). The redd is where the eggs will be deposited and fertilized after the males compete for spawning right to the female (Scott and Crossman, 1985). The redd actually resembles a pit that is 4-12 inches in depth (Everhart, 1961). To gain the spawning right of the female the males compete for position by nipping and displaying themselves to the competitor males (Mills, 1971). When spawning is actually taking place the male takes a position to hold the female against the bottom of the redd and both of the fish vibrate intensely while eggs and milt are simultaneously discharged (Scott and Crossman, 1985). Very shortly after this exchange takes place the female works to cover the fertilized eggs with gravel by digging slightly upstream and letting the current carry the gravel down to fill the redd (Everhart, 1961). The eggs are initially adhesive to prevent them from washing away so they are able to incubate within the gravel (Scott and Crossman, 1985). The total time of incubation depends on factors such as temperature and oxygen (Scott and Crossman, 1985). After hatch the fry remain in the gravel until the yolk sac is absorbed then the fry swim up out of the gravel to begin the next stage of their life (Scott and Crossman, 1985).

Breeding interval: Brook trout breed once per year

Breeding season: Spawning occurs in late summer or autumn

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

  • Scott, W., E. Crossman. 1985. Freshwater Fishes of Canada. Ottawa, Canada: Minister of Supply and Services Canada.
  • Everhart, W. 1961. Fishes of Maine. Augusta, Maine, USA: The Maine Department of Inland Fisheries and Game.
  • Mills, D. 1971. Salmon and Trout: A resource, its ecology, and management. Bungay, Suffolk, Great Britain: The Chaucer Press.
  • LaConte, V. 1997. Ohio's Native Brook Trout. Wild Ohio, Fall.
  • Blanchfield, P., M. Ridgway, C. Wilson. 2003. Breeding success of male brook trout (Salvelinus fontinalis) in the wild. Molecular Ecology, 12(9): 2417-2428.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually only a single male is able to fertilize the eggs that a female lays in a redd, but occasionally more than one male is able to do so. Usually the largest males are the most successful breeders.

Mating System: monogamous ; polyandrous

Brook trout spawn in late summer or autumn depending on the latitude and temperature (Scott and Crossman, 1985). The type of area required for brook trout spawning is one that offers loose, clean gravel in shallow riffles or shoreline area with an excellent supply of upwelling, oxygen-rich water (LaConte, 1997). Mature fish have been known to travel many miles upstream to reach adequate spawning grounds (Scott and Crossman, 1985). Females are able to detect upwelling springs or other areas of ground-water flow, which make for excellent spawning grounds. Brook trout reach maturity on an average at the age of two and spawn every year, although their size at first maturity depends on growth rate and the productivity of thier habitat (Everhart, 1961). Males often outnumber females at the spawning site, but only rarely is more than one male able to fertilize the eggs in a particular redd (Scott and Crossman, 1985; Blanchfield et al., 2003). The females clear away debris and silt with rapid fanning of her caudal fin while on her side, creating a redd (Scott and Crossman, 1985). The redd is where the eggs will be deposited and fertilized after the males compete for spawning right to the female (Scott and Crossman, 1985). The redd actually resembles a pit that is 4-12 inches in depth (Everhart, 1961). To gain the spawning right of the female the males compete for position by nipping and displaying themselves to the competitor males (Mills, 1971). When spawning is actually taking place the male takes a position to hold the female against the bottom of the redd and both of the fish vibrate intensely while eggs and milt are simultaneously discharged (Scott and Crossman, 1985). Very shortly after this exchange takes place the female works to cover the fertilized eggs with gravel by digging slightly upstream and letting the current carry the gravel down to fill the redd (Everhart, 1961). The eggs are initially adhesive to prevent them from washing away so they are able to incubate within the gravel (Scott and Crossman, 1985). The total time of incubation depends on factors such as temperature and oxygen (Scott and Crossman, 1985). After hatch the fry remain in the gravel until the yolk sac is absorbed then the fry swim up out of the gravel to begin the next stage of their life (Scott and Crossman, 1985).

Breeding interval: Brook trout breed once per year

Breeding season: Spawning occurs in late summer or autumn

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

  • Scott, W., E. Crossman. 1985. Freshwater Fishes of Canada. Ottawa, Canada: Minister of Supply and Services Canada.
  • Everhart, W. 1961. Fishes of Maine. Augusta, Maine, USA: The Maine Department of Inland Fisheries and Game.
  • Mills, D. 1971. Salmon and Trout: A resource, its ecology, and management. Bungay, Suffolk, Great Britain: The Chaucer Press.
  • LaConte, V. 1997. Ohio's Native Brook Trout. Wild Ohio, Fall.
  • Blanchfield, P., M. Ridgway, C. Wilson. 2003. Breeding success of male brook trout (Salvelinus fontinalis) in the wild. Molecular Ecology, 12(9): 2417-2428.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nest built in gravel by female, while being courted by male. After spawning, female covers the eggs with small pebbles.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salvelinus fontinalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATCACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACCGCCCTTAGCCTCTTAATTCGGGCAGAGTTAAGCCAACCTGGAGCTCTTCTAGGGGATGACCAAATCTATAACGTAATCGTAACAGCCCATGCCTTCGTTATGATCTTCTTTATAGTTATACCAATTATGATTGGAGGATTTGGAAACTGATTAATTCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCGCCCTCCTTTCTACTTCTCCTGGCTTCGTCCGGAGTTGAAGCCGGCGCCGGTACGGGGTGAACAGTTTACCCCCCTCTAGCTGGGAACCTCGCCCACGCAGGAGCTTCCGTTGATTTAACTATTTTTTCCCTACATTTAGCTGGCATTTCCTCAATTTTAGGAGCCATTAACTTTATTACAACTATTATTAACATGAAACCCCCAGCTATTTCTCAGTATCAAACCCCACTTTTTGTTTGAGCTGTATTAGTTACTGCTGTCCTTTTATTACTTTCCCTCCCCGTTCTAGCAGCAGGGATTACTATGTTACTCACCGACCGAAATTTAAATACCACTTTCTTTGACCCGGCAGGCGGAGGAGACCCAATTTTATACCAGCACCTCTTTTGATTCTTTGGCCACCCAGAGGTCTATATTCTTATTCTCCCAGGCTTCGGTATGATTTCCCACATCGTTGCATACTATTCCGGTAAAAAAGAGCCCTTCGGGTATATAGGAATAGTCTGAGCTATAATAGCCATCGGACTCCTAGGATTCATCGTTTGAGCCCACCATATGTTTACTGTCGGGATGGATGTAGACACTCGTGCCTACTTTACATCTGCTACCATGATCATCGCCATCCCCACCGGAGTAAAAGTATTTAGCTGACTAGCTACACTACACGGAGGCTCAATTAAATGAGAAACACCGCTTCTTTGAGCCCTGGGGTTTATTTTCCTATTTACGGTCGGGGGACTCACAGGCATTGTCCTTGCTAATTCCTCATTAGACATTGTTCTCCACGACACTTATTATGTGGTCGCCCACTTTCACTACGTATTATCTATGGGAGCTGTCTTTGCCATCATAGGTGCTTTCGTACACTGATTCCCACTATTCACTGGGTATACCCTCCACAGCACATGAACTAAAATCCACTTTGGAATTATATTTATCGGTGTAAATTTAACCTTTTTCCCACAGCATTTCCTAGGCCTCGCAGGAATACCCCGACGATACTCTGATTACCCAGACGCCTATACACTATGAAATACTGTGTCCTCAATCGGGTCTCTTATCTCCTTAGTGGCTGTAATTATGTTCCTGTTTATTCTTTGAGAGGCTTTTGCCGCCAAACGAGAAGTAGCGTCAATCGAAATAACTTCAACAAATGTAGAGTGACTGCATGGATGCCCCCCACCCTACCACACATTTGAAGAACCCGCATTTGTTCAAGTACAGGCAAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Salvelinus fontinalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 30
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are many extensive conservation efforts directed towards brook trout, especially naturally reproducing brook trout populations. This is because in many northeastern states and Canada brook trout, the only native stream dwelling trout in many of these places, are very susceptible to urbanization and deforestation and its effects on the surrounding aquatic ecosystems. Ohio for example has only two naturally reproducing populations of brook trout left and breeds these populations in hatcheries then placing them in other suitable habitats to reestablish these populations (LaConte, 1997). Many other states and areas in Canada are performing similar projects to preserve this treasured and threatened natural resource.

IUCN Red List of Threatened Species: not evaluated

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are many extensive conservation efforts directed towards brook trout, especially naturally reproducing brook trout populations. This is because in many northeastern states and Canada brook trout, the only native stream dwelling trout in many of these places, are very susceptible to urbanization and deforestation and its effects on the surrounding aquatic ecosystems. Ohio for example has only two naturally reproducing populations of brook trout left and breeds these populations in hatcheries then placing them in other suitable habitats to reestablish these populations (LaConte, 1997). Many other states and areas in Canada are performing similar projects to preserve this treasured and threatened natural resource.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Poor land management associated with agriculture and urbanization ranks as the most widely distributed negative impact on stream populations of brook trout across the range in the eastern United States (Hudy et al. 2005, Trout Unlimited 2006). Non-native fishes rank as the largest biological threat to lake populations (Hudy et al. 2005, Trout Unlimited 2006).

Range has contracted in southern Appalachian region due to impacts of logging, fires, river impoundment, road and railroad construction, land clearance for agriculture and human habitation, and encroachment of introduced rainbow trout and brown trout (Larson and Moore 1985, Galbreath et al. 2001). Introduction of hatchery-reared brook trout from the northeastern United States has also affected native populations, but genetic sampling of populations in the Pigeon River system in North Carolina indicates that a high proportion of sampled populations consist of unaltered native fish (Galbreath et al. 2001).

Sea-run populations in eastern Canada and the northeastern United States were decimated over the past 200 years by overharvest, habitat degradation, and stocking of hatchery-reared brook trout and other non-native salmonids (Ryther 1997).

Historically, most of Lake Superior's 3,000 miles of shoreline and tributary streams supported coaster brook trout populations. In the mid-1800s, unregulated fishing decimated these stocks, and in-stream habitat loss due to wide-scale logging further reduced numbers and prevented stocks from recovering (USFWS, Region 3). Exploitation of coaster stocks and demands on their habitat accelerated in the twentieth century. The opening of the Lake Superior watershed by road, rail, and water removed protection by isolation. Fishing pressure increased, and habitat damage from hydroelectric dams, road and railway construction, and mining probably also contributed to the decline. In some areas, sea lamprey (Petromyzon marinus) predation, which peaked in the late 1950s (Curtis 1990), and the introduction of Pacific salmon and rainbow trout (Onchoryhychus mykiss) and brown trout (Salmo trutta) were additional stressors that probably reduced coaster abundance and distribution (Newman and DuBois 1996). By the mid-1900s only a handful of tiny remnant stocks still existed (USFWS, Region 3).

In general, brook trout populations respond most negatively to factors that decrease survival of large juveniles and small adults and that decrease growth rates of small juveniles (Marschall and Crowder 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Thompson and Rahel (1996) for information on a depletion-removal electrofishing protocol that significantly reduced populations and recruitment but did not totally eradicate brook trout in streams managed for Colorado River cutthroat trout.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Has been used in carcinogen testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As a gamefish the brook trout is very highly sought after and one of the most popular, especially in north eastern North America (Scott and Crossman, 1985). The brook trout can be caught by fishing with artificial flies, spin casting, or with live bait (Scott and Crossman, 1985). Brook trout and their vastly popular sport fishing bring to a community related recreational activities such as camping, boating, and the need for gear, guides and transportation, all of which provide positive economic opportunities (Hubbs and Lagler, 1949). Brook trout have been raised in hatcheries and distributed world wide in hope of creating the above mentioned opportunities in places where they do not natively occur or to reestablish and strengthen native populations (Scott and Crossman, 1985).

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As a gamefish the brook trout is very highly sought after and one of the most popular, especially in north eastern North America (Scott and Crossman, 1985). The brook trout can be caught by fishing with artificial flies, spin casting, or with live bait (Scott and Crossman, 1985). Brook trout and their vastly popular sport fishing bring to a community related recreational activities such as camping, boating, and the need for gear, guides and transportation, all of which provide positive economic opportunities (Hubbs and Lagler, 1949). Brook trout have been raised in hatcheries and distributed world wide in hope of creating the above mentioned opportunities in places where they do not natively occur or to reestablish and strengthen native populations (Scott and Crossman, 1985).

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Introduced populations of brook trout have contributed to the decline of native fishes (e.g., rare forms of cutthroat trout in the Rocky Mountains, bull trout in Columbia River basin), amphibians, and invertebrates in cold streams and lakes in western North America (see Adams et al. 2002). Prevention of further invasion has become a major concern (Adams et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Brook trout

The brook trout (Salvelinus fontinalis), sometimes called the eastern brook trout, is a species of fish in the salmon family of order Salmoniformes. It is native to Eastern North America in the United States and Canada. In many parts of its range, it is known as the speckled trout or squaretail. A potamodromous population in Lake Superior is known as coaster trout or, simply, as coasters. Though commonly called a trout, the brook trout is actually a char (Salvelinus) which in North America, includes the lake trout, bull trout, Dolly Varden and the arctic char. The brook trout is the state fish for eight states: Michigan, New Hampshire, New Jersey, New York, Pennsylvania, Vermont, Virginia and West Virginia

The specific epithet "fontinalis" comes from the Latin for "of or from a spring or fountain".

Taxonomy[edit]

The scientific name of the brook trout is Salvelinus fontinalis and was first described by naturalist Samuel Latham Mitchill in 1814. The specific epithet "fontinalis" comes from the Latin for "of or from a spring or fountain" in reference to the clear, cold streams and ponds in its native habitat. Few if any, subspecies exist. The brook trout produces two intrageneric hybrids— the Splake (S. fontinalis × S. namaycush) and the Sparctic char (S. fontinalis × S. alpinus)[3] plus one intergeneric hybrid—the Tiger trout (S. fontinalis × Salmo trutta).[citation needed]

Subspecies[edit]


Splake[edit]

Photo of four trout lying in grass
Tiger trout (top 3), Splake (bottom)

The splake is an intrageneric hybrid between the brook trout and lake trout (Salvelinus namaycush). Although uncommon in nature, they are artificially propagated in substantial numbers for stocking into brook trout or lake trout habitats.[7] Although they are fertile, back-crossing in nature is behaviorally problematic and very little natural reproduction occures. Splake grow more quickly than brook trout and become piscivorous sooner and are more tolerant of competitors than brook trout.[8]

Tiger trout[edit]

The Tiger trout is an intergeneric hybrid between the brook trout and the brown trout (Salmo trutta). Tiger trout occur very rarely naturally, but are sometimes artificially propagated. Such crosses are almost always reproductively sterile. They are popular with many fish stocking programs because they can grow quickly, and may help keep rough fish populations in check due to their highly piscivorous (fish-eating) nature.[9]

Sparctic char[edit]

The Sparctic char is an intergeneric hybrid between the brook trout and the arctic char (Salvelinus apinus).[10]

Description[edit]

Photo of hand holding a trout
Brook trout from lake in Wyoming's Wind River Range
Photo of a trout in an aquarium
Captive brook trout in aquarium

Fisheries biologist Robert Behnke describes three forms of the brook trout. A large lake form evolved in the larger lakes in the northern reaches of it range and is generally piscivorous as adults. A sea-run form that migrates into salt-water for short periods of time to feed evolved along the Atlantic coastline. Finally, Behnke describes a smaller generalist form that evolved in the small lakes, ponds, rivers and streams throughout most of the original native range. This generalist form rarely attains sizes larger than 12 inches (30 cm) or lives for more than 3 years.[11] All three forms have the same general appearance. The brook trout has a dark green to brown color, with a distinctive marbled pattern (called vermiculations) of lighter shades across the flanks and back and extending at least to the dorsal fin, and often to the tail. A distinctive sprinkling of red dots, surrounded by blue haloes, occur along the flanks. The belly and lower fins are reddish in color, the latter with white leading edges. Often, the belly, particularly of the males, becomes very red or orange when the fish are spawning.[citation needed]

The species reaches a maximum recorded length of 86 cm (33 in) and a maximum recorded weight of 6.6 kg (14.5 lb). It can reach at least seven years of age, with reports of 15 year old specimens observed in California habitats to which the species has been introduced. Typical lengths vary from 25 to 65 cm (10 to 26 in), and weights vary from 0.3 to 3.0 kg (0.7 to 7.0 lb). Growth rates are dependent on season, age, water and ambient air temperatures, and flow rates. In general flow rates affect the rate of change in the relationship between temperature and growth rate. For example in spring growth increased with temperature at a faster rate with high flow rates than with low flow rates.[12]

Range and habitat[edit]

Map of native and non-native range of Brook trout in U.S.
U.S. Native and Introduced ranges of Brook Trout (Salvelinus fontinalis)[13]
Hand holding small trout
Native Appalachian brook trout

Brook trout are native to a wide area of Eastern North America, but increasingly confined to higher elevations southward in the Appalachian Mountains to northern Georgia and northwest South Carolina, Canada from the Hudson Bay basin east, the Great LakesSaint Lawrence system, the Canadian maritime provinces and the upper Mississippi River drainage as far west as eastern Iowa.[11] Their southern historic native range has been drastically reduced, with fish being restricted to higher elevation, remote steams due to habitat loss and introductions of brown and rainbow trout. As early as 1850, the brook trout's range started to extend west from its native range through introductions. The brook trout was eventually introduced into suitable habitats throughout the western U.S. during the late 19th and early 20th century at the behest of the American Acclimatization Society and by private, state and federal fisheries authorities.[14] Acclimatization movements in Europe, South America and Oceania resulted in brook trout introductions throughout Europe,[10] in Argentina[15] and New Zealand.[16] Although not all introductions were successful, a great many established wild, self-sustaining populations of brook trout in non-native waters.

Habitat[edit]

Photo of tree covered stream in mountains
Typical southern Appalachian brook trout habitat

The brook trout inhabits large and small lakes, rivers, streams, creeks and spring ponds. They prefer clear waters of high purity and a narrow pH range and are sensitive to poor oxygenation, pollution and changes in pH caused by environmental effects such as acid rain. The typical pH range of brook trout waters is 5.0 to 7.5, with pH extremes of 3.5 to 9.8 possible.[17] Water temperatures typically range from 34 to 72 °F (1 to 22 °C). Warm summer temperatures and low flow rates are stressful on brook trout populations—especially larger fish.[18] Brook trout have a diverse diet that includes larval, pupal and adult forms of aquatic insects (typically caddisflies, stoneflies, mayflies and aquatic dipterans), and adult forms of terrestrial insects (typically ants, beetles, grasshoppers and crickets) that fall into the water, crustaceans, frogs and other amphibians, molluscs, smaller fish, invertebrates and even small aquatic mammals such as voles.[citation needed]

The female constructs a depression in a location in the stream bed, sometimes referred to as a "redd", where groundwater percolates upward through the gravel. One or more males approaches the female, fertilizing the eggs as the female expresses them. A majority of spawnings involve peripheral males which directly influences the amount of eggs that survive into adulthood. In general the larger the number of peripheral males present the more likely the eggs will be cannibalized.[19] The eggs are slightly denser than water. The female then buries the eggs in a small gravel mound; they hatch in 95 to 100 days.[citation needed]

Coasters[edit]

A potamodromous population of brook trout native to Lake Superior, which migrate into tributary rivers to spawn, are called "coasters".[20] Coasters tend to be larger than most other populations of brook trout, often reaching 6 to 7 pounds (2.7 to 3.2 kg) in size.[21] Many coaster populations have been severely reduced by overfishing and habitat loss by the construction of hydroelectric power dams on Lake Superior tributaries. In Ontario and Michigan, efforts are underway to restore and recover coaster populations.[22]

Salters[edit]

When Europeans first settled Eastern North America, semi-anadromous or sea-run brook trout, commonly called "salters" ranged from southern New Jersey, north throughout the Canadian maritime provinces and west to Hudson Bay. Salters may spend up to three months at sea feeding on crustaceans, fish and marine worms in the spring not straying more than a few miles from the river mouth. The fish return to freshwater tributaries to spawn in the late summer or autumn. While in saltwater, salters gain a more silvery color, losing much of the distinctive markings seen in freshwater. However, within two weeks of returning to freshwater, they assume typical brook trout color and markings.[21]

Angling[edit]

Old colored print of three men fishing from a boat
Nathan Currier lithograph of Arthur Fitzwilliam Tait's painting "Catching a Trout", 1854 - Depicts fishermen catching a brook trout near South Haven Church in a mill pond on Carman's river Long Island, New York
Colored drawing of trout jumping for a fly
Brook trout chasing an artificial fly from American Fishes (1903) [23]

Although there's an element of myth about the story, purportedly Daniel Webster, an avid angler, caught a large (~14.5 pounds (6.6 kg)) brook trout near the Old South Haven Church in a mill pond on Carman's river on Long Island, New York in 1823 (or 1827).[24] The event was immortalized in Arthur Fitzwilliam Tait's 1854 painting "Catching a trout". Until it was displaced by introduced brown trout (1883) and rainbow trout (1875), the brook trout was the trout that attracted the most attention of anglers from colonial times through the first 100 years of U.S. history. Sporting writers like Genio Scott Fishing in American Waters (1869), Thaddeus Norris American Anglers Book (1864), Robert Barnwell Roosevelt Game fish of North America (1864) and Charles Hallock The Fishing Tourist (1873) produced guides to the best-known brook trout waters in America.[25] As brook trout populations declined in the mid 19th century near urban areas, anglers flocked to the Adirondacks in upstate New York and the Rangeley lakes region in Maine to pursue brook trout.[25] In July, 1916 on the Nipigon river in northern Ontario, an Ontario physician, John W. Cook, caught a 14.5 pounds (6.6 kg) brook trout which stands as the world record.[26]

The brook trout is a popular game fish with anglers, particularly fly fishermen. Today, many anglers practice catch-and-release tactics to preserve remaining populations, and organizations such as Trout Unlimited have been in the forefront of efforts to institute air and water quality standards sufficient to protect the brook trout. Revenues derived from the sale of fishing licenses have been used to restore many sections of creeks and streams to brook trout habitat.[27]

The current world angling record brook trout was caught by Dr. W. J. Cook on the Nipigon River, Ontario, in July 1915. The 31 inch (79 cm) trout weighed only 14.5 lbs (6.6 kg) because, at the time of weighing, it was badly decomposed after 21 days in the bush without refrigeration. This is the longest-standing angling world record.[28] A 29 inch (74 cm) brook trout, caught in October 2006 in Manitoba, is not eligible for record status since it was released alive.[29] This trout weighed approximately 15.98 lbs based on the accepted formula for calculating weight by measurements and it currently stands as the record brook trout for Manitoba.[30]

Artificial propagation and aquaculture[edit]

Brook trout are also commercially raised in large numbers for food production, being sold for human consumption in both fresh and smoked forms.[31] Because of its dependence on pure water and a variety of aquatic and insect life forms, the brook trout is also used for scientific experimentation in assessing the effects of pollution and contaminated waters.[citation needed]

Conservation status[edit]

Old colored drawing of a trout
Drawing of a brook trout from John Treadwell Nichols's Fishes of the Vicinity of New York City (1918) noting that the fish is now uncommon in the New York City area

Brook trout populations depend on cold, clear, well-oxygenated water of high purity. As early as the late 19th century, native brook trout in North America became extirpated from many watercourses as land development, forest clear-cutting, and industrialization took hold.[32] Streams and creeks that were polluted, dammed, or silted up often became too warm to hold native brook trout, and were colonized by transplanted smallmouth bass and perch or other introduced salmonids such as brown and rainbow trout. The brown trout, a species not native to North America, has replaced the brook trout in much of the brook trout's native water. Brook trout populations, if already stressed by overharvest or by temperature, are very susceptible to damage by the introduction of exogenous species. Many lacustrine populations of brook trout have been extirpated by the introduction of other species, particularly percids, but sometimes other spiny-rayed fishes.[citation needed]

In addition to chemical pollution and algae growth caused by runoff containing chemicals and fertilizers, air pollution has also been a significant factor in the disappearance of brook trout from their native habitats. In the U.S., acid rain caused by air pollution has resulted in pH levels too low to sustain brook trout in all but the highest headwaters of some Appalachian streams and creeks.[33] Brook trout populations across large parts of eastern Canada have been similarly challenged; a subspecies known as the aurora trout was extirpated from the wild by the effects of acid rain.[34] Today, in many parts of the range, efforts are underway to restore brook trout to those waters that once held native populations, stocking other trout species only in habitats that can no longer be recovered sufficiently to sustain brook trout populations.[citation needed]

Organizations such as Trout Unlimited and Trout Unlimited Canada[22] are partnering with other organizations such as the Southern Appalachian Brook Trout Foundation,[35] the Eastern Brook Trout Joint Venture,[36] state, provincial and federal agencies to undertake projects that restore native brook trout habitat and populations.[citation needed]

As an invasive species[edit]

Although brook trout populations are under stress in their native range, they are considered an invasive species where they have been introduced outside their historic native range.[37][38][39] In the Northern Rocky Mountains, non-native brook trout are considered a significant contributor to the decline or extirpation of native cutthroat trout (Oncorhynchus clarki) in headwater streams.[40] Non-native Brook trout populations have been subject to eradication programs in efforts to preserve native species.[41][42] In Yellowstone National Park anglers may take an unlimited number of non-native brook trout in some drainages. In the Lamar river drainage, there is a mandatory kill regulation for any brook trout caught.[43] In Europe, introduced brook trout, once established have had negative impacts on growth rates of native brown trout (S. trutta).[10]

Notes[edit]

  1. ^ "Salvelinus fontinalis". Integrated Taxonomic Information System. Retrieved 30 January 2006. 
  2. ^ "Synonyms of Salvelinus fontinalis (Mitchill, 1814)". Fishbase. Retrieved 2014-02-23. 
  3. ^ "Sparctic Char: Strange Nighttime Saltwater Spawners from Europe!". http://www.fishwithjd.com/. Retrieved 2013-12-25. 
  4. ^ Aurora trout Recovery Team (ATRT) (July 2006). "Recovery Strategy for the Aurora trout (Salvelinus fontinalis timagamiensis) in Canada" (PDF). Fisheries and Oceans Canada. Retrieved 2014-01-06. 
  5. ^ World Conservation Monitoring Centre (1996). "Salvelinus agassizi". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 10 May 2006. 
  6. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Brook Trout Salvelinus fontinalis". Trout and Salmon of North America. The Free Press. pp. 275–280. ISBN 0-7432-2220-2. 
  7. ^ "Splake". Maine Department of Inland Fisheries. Retrieved 2013-01-06. 
  8. ^ "NAS - Nonindigenous Aquatic Species Salvelinus fontinalis x namaycush". U.S. Geological Survey. Retrieved 2014-01-06. 
  9. ^ "Tiger trout". UtahFishingInfo.com - Utah Fishing Information. Retrieved 2014-05-28. 
  10. ^ a b c K. Jannson (2013). "NOBANIS – Invasive Alien Species Fact Sheet Salvelinus fontinalis" (PDF). Online Database of the European Network on Invasive Alien Species – NOBANIS www.nobanis.org. Retrieved 2013-12-26. 
  11. ^ a b Behnke, Robert J.. "Brook Trout". About Trout-The Best of Robert J. Behnke from Trout Magazine. Guilford, CT: The Lyons Press. pp. 85–90. ISBN 978-1-59921-203-6. 
  12. ^ Xu, Calin (Nov 2010). "Context-specific influence of water temperature on brook trout growth rates in the field". Freshwater Biology 55 (11): 2253–2264. doi:10.1111/j.1365-2427.2010.02430.x. Retrieved 2013-09-27. 
  13. ^ "NAS - Nonindigenous Aquatic Species Salvelinus fontinalis". U.S. Geological Survey. Retrieved 2014-01-06. 
  14. ^ Karas, Nick (2002). "Expansion of the Brook Trout's Range Within the United States". Brook Trout: A Thorough Look at North America's Great Native Trout- Its History, Biology, and Angling Possibilities, Revised Edition. NY: Lyons Press. pp. 331–339. ISBN 978-1-58574-733-7. 
  15. ^ "Salvelinus fontinalis Aurora trout". http://animaldiversity.ummz.umich.edu/. Retrieved 2013-12-26. 
  16. ^ "Brook Char or Brook Trout". http://www.fishingmag.co.nz/. Retrieved 2013-12-26. 
  17. ^ "Brook Trout (''Salvelinus fontinalis'')". Chebucto.ns.ca. Retrieved 2013-07-10. 
  18. ^ Xu, C.L. (June 2010). "Size-dependent survival of brook trout Salvelinus fontinalis in summer: effects of water temperature and stream flow". Journal of Fish Biology 76 (10): 2342–2369. doi:10.1111/j.1095-8649.2010.02619.x. Retrieved 2013-09-27. 
  19. ^ Blanchfield, Paul (Mar 1999). "The cost of peripheral males in a brook trout mating system". Animal Behaviour 57 (3): 537–544. doi:10.1006/anbe.1998.1014. Retrieved 2013-09-27. 
  20. ^ "A Completion Report on the Lake Superior Coaster Brook Trout Initiative". Great Lakes Fishery Commission. Retrieved 2013-12-27. 
  21. ^ a b Karas, Nick (2002). "Salters and Coasters". Brook Trout: A Thorough Look at North America's Great Native Trout- Its History, Biology, and Angling Possibilities, Revised Edition. NY: Lyons Press. pp. 100–119. ISBN 978-1-58574-733-7. 
  22. ^ a b "Coaster Brook Trout". Trout Unlimited Canada. Retrieved 2014-05-28. 
  23. ^ Gill, Theodore; Goode, G. Brown (1903). American Fishes-A Popular Treatise upon the Game and Food Fishes of North America. Boston: L. C. Page and Company. 
  24. ^ Karas, Nick (2002). "Daniel Webster and his "Devil Trout"". Brook Trout: A Thorough Look at North America's Great Native Trout- Its History, Biology, and Angling Possibilities, Revised Edition. NY: Lyons Press. pp. 3–14. ISBN 978-1-58574-733-7. 
  25. ^ a b Schullery, Paul (1996). "The Fly-fishing Exploration". American Fly Fishing-A History. Norwalk, CT: The Easton Press. pp. 43–57. 
  26. ^ Karas, Nick (2002). "Dr. John William Cook and his "Devil Trout"". Brook Trout: A Thorough Look at North America's Great Native Trout- Its History, Biology, and Angling Possibilities, Revised Edition. NY: Lyons Press. pp. 15–26. ISBN 978-1-58574-733-7. 
  27. ^ Moeller, Scott (August 2009). "Species Profile-Closeup on the Brook Trout". Minnesota Department of Natural Resources. Retrieved 2014-05-30. 
  28. ^ "Dr. JW Cook's World Record Brook Trout Was Caught in 1915". Brooktrout.ca. Retrieved 2013-07-10. 
  29. ^ "Browny. ''The Fish'', Fish'n Line Magazine". Anglingmasters.com. Retrieved 2013-07-10. 
  30. ^ "Brook trout records". bigbrooktrout.com. Retrieved 2014-04-10. 
  31. ^ "Trout Profile". Agricultural Marketing Resource Center. March 2012. Retrieved 2014-05-28. 
  32. ^ "Eastern Brook Trout: Status and Threats". Trout Unlimited for the Eastern Brook Trout Joint Venture. Retrieved 2013-12-29. 
  33. ^ Camuto, Christopher (1990). "Air and Rain". A Fly Fisherman's Blue Ridge. New York: Henry Holt & Company. pp. 85–87. ISBN 0-8050-1466-7. 
  34. ^ "Royal Ontario Museum's page on the Aurora trout". Rom.on.ca. Retrieved 2013-07-10. 
  35. ^ "The Southern Appalachian Brook Trout Foundation". Retrieved 2013-12-27. 
  36. ^ "Protect, Restore and Enhance". Retrieved 2013-12-29. 
  37. ^ Jason B. Dunham, Susan B. Adams, Robert E. Schroeter and Douglas C. Novinger (2002). "Alien invasions in aquatic ecosystems: Toward an understanding of brook trout invasions and potential impacts on inland cutthroat trout in western North America" (PDF). Reviews in Fish Biology and Fisheries 12: : 373–391. 
  38. ^ "Salvelinus fontinalis (fish)". IUCN SSC Invasive Species Specialist Group (ISSG). Retrieved 2014-01-06. 
  39. ^ Peterson, Lesley (Spring 2013). "Loved in Eastern Canada, Loathed in the Rockies: The Two Sides of Brook Trout" (PDF). Currents (Trout Unlimited Canada) 19 (2): 1–3. Retrieved 2013-01-06. 
  40. ^ Shepard, Bradley B. (2009). "SWG Final Report: Factors that influence invasion of nonnative brook trout (Salvelinus fontinalis)and their displacement of native cutthroat trout (Oncorhynchus clarkii) in the Northern Rocky Mountains". Montana Department of Fish, Wildlife & Parks. Retrieved 2014-04-13. 
  41. ^ Frank, Charles W. (April 2, 2014). "Under the Radar – The Trout Eradication Program Save the Fish". eTerritorial Dispatch Yuba County, Sutter County, Nevada County and Colusa County. Retrieved 2014-04-13. 
  42. ^ Carmona-Catot, Gerard; Moyle, Peter B.; Aparicio, Enric; Crain, Patrick K.; Thompson, Lisa C.; Garci'A-Berthou, Emili (November 1, 2010). "Brook Trout Removal as a Conservation Tool to Restore Eagle Lake Rainbow Trout". North American Journal of Fisheries Management (American Fisheries Society) 30: 1315–1323. doi:10.1577/m10-077.1. 
  43. ^ "2013 Yellowstone National Park Fishing Regulations". National Park Service. Retrieved 2014-04-13. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Analyses of mtDNA variation indicate that diversity is highest in the southern part of the range and lowest in the north; mid-Atlantic populations are transitional between these regions of high and low haplotypic diversity (Perkins et al. 1993, Hayes et al. 1996, Hall et al. 2002).

Genetic data from 30 populations representing six major river drainages in Maine "provided evidence for the role of contemporary landscape features in shaping the observed pattern of genetic diversity at smaller geographic scales (within and among populations within river drainage). On a broader geographic scale, contemporary landscape structure appeared to be only a minor factor determining the observed pattern of genetic structuring among drainages" (Castric et al. 2001).

Hybrids between this species and Salmo trutta and Salvelinus namaycush are known. Extinct subspecies agassizi (silver trout) sometimes has been regarded as a distinct species. The aurora trout, maintained only as hatchery stocks in lakes in the Temiskaming District of Ontario, may be a distinct subspecies, S. f. timagamiensis (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!