Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The Brook Trout is a beautifully-colored fish, iridescent blue to green with yellow spots and sometimes orange to red spots with blue halos across its side. The back may darken to an olive green with dark, wavy, worm-like lines which are lacking in other salmonids. While their undersides lighten to a silvery white, their lower fins are orange with white margins. They have teeth located only in the front of their mouths. Average size of the fish is ten to twelve inches long and one to four pounds, but largest on record was over 14 pounds. The Brook Trout eats a wide variety of insects and small animals. A juvenile will eat insect larva, plankton, and small crustaceans while a larger adult may eat small fish and crayfish.

In the late fall the female will scoop out a shallow hole in the gravel of the streambed or lake bottom around the shoreline. The male and female together then extrude eggs and milt into the hole, the female then covering the fertilized eggs (100 to 5000, depending on her size) to incubate them during the winter. In two or three months the surviving eggs hatch. The young go through a couple of stages before they reach adulthood. During the fry and fingerling stages they eat plankton and as they grow into adulthood they will begin to eat insects and larger prey. The Brook Trout commonly lives its entire life in the same streams and lakes in which it was born or sometimes it may travel out to sea, returning to freshwater to spawn. Maximum life expectancy is about five years old.

Although the Brook Trout is more commonly found at high elevations in the cold water of mountain streams, rivers, lakes and ponds, it populates many watersheds in New England at nearly all elevations. It requires high oxygen content in the water and does not do well in water that gets above 68 degrees in the summer. The Brook Trout is distinguished as being the only trout native to New England waters: brown trout originated from Europe, and rainbow trout came from the northwest United States.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Occurs in clear, cool, well-oxygenated creeks, small to medium rivers, and lakes (Ref. 5723, 44894, 10294). Nerito-pelagic (Ref. 58426). In its native range, general upstream movements have been observed in early spring, summer and late fall; downstream movements, in late spring and fall (Ref. 28546, 28548, 28549, 28550). Some fish, popularly known as salters, run to the sea in the spring as stream temperatures rises, but never venture more than a few kilometers from river mouths. It may remain at sea for up to three months (Ref. 28546, 28549, 28551). Feeds on a wide range of organisms including worms, leeches, crustaceans, insects (chironomids, caddisflies, blackflies, mayflies, stoneflies and dragonflies (Ref. 5951), mollusks, fishes and amphibians (Ref. 3348, 10294); also small mammals (Ref. 1998). Stomachs of some individuals contained traces of plant remains (Ref. 1998). There are reports of introduced fish reaching 15 years of age in California, USA (Ref. 28545). Cultured for food and for stocking (Ref. 27547). Extensively used as an experimental animal (Ref. 1998). Marketed fresh and smoked; eaten fried, broiled, boiled, microwaved, and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Brook trout are found as far south as Georgia in the Appalachian mountain range and extend north all the way to Hudson Bay. From the east coast their native range extends westward to eastern Manitoba and the Great Lakes (Willers, 1991). The fish has been introduced, very successfully in some areas, into many parts of the world including western North America, South America, New Zealand, Asia, and many parts of Europe (Scott and Crossman, 1973).

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); neotropical (Introduced ); australian (Introduced )

  • Willlers, B. 1991. Trout Biology. New York City, New York: Lyons and Burford.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Newfoundland to western side of Hudson Bay; south in Atlantic, Great Lakes, and Mississippi River basins to Minnesota and northern Georgia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, British Columbia, Canadian Exclusive Economic Zone [Arctic part], Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, Gulf of Maine, Gulf of St. Lawrence, Hudson Bay, Hudson Strait, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, North West Territories, Portugese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Ungava Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species is native to most of eastern Canada and the northeastern United States, from Newfoundland to the southwestern side of Hudson Bay, and south in the Atlantic, Great Lakes, and Mississippi River basins to Minnesota, northeastern Iowa, Wisconsin, Lake Michigan (but not Illinois streams), Chagrin River (Lake Erie drainage) in northeastern Ohio, northern New Jersey, New England, and southward in the Atlantic and Mississippi basins of the Appalachian Mountains to northern Georgia (Smith 1979, Trautman 1981, Becker 1983, Cooper 1983, Smith 1985, Etnier and Starnes 1993, Jenkins and Burkhead 1994, Menhinick 2001, Behnke 2002, Hartel et al. 2002, Moyle 2002, Bailey et al. 2004). Sea-run populations at least formerly extended from the Atlantic provinces of Canada to Long Island, New York (Scott and Crossman 1973), including Hudson Bay (Behnke 2002). Brook trout have been introduced in most of the lower peninsula of Michigan, western North America, and temperate regions in many other parts of the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North America, north to the Southern coast of Labrador, west to Minnesota, and southward to Georgia along the Allegheny Mountains.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: most of eastern Canada from Newfoundland to western side of Hudson Bay; south in Atlantic, Great Lakes, and Mississippi River basins to Minnesota and northern Georgia in USA. South America: Argentina (Ref. 9086). Widely introduced in temperate regions of other continents. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The brook trout's body is elongate with an average length of 38.1-50.8 cm, is only slightly laterally compressed; the body has its greatest depth at or in front of the origin of the dorsal fin (Scott and Crossman, 1985). Another physical characteristic of the brook trout is an adipose fin and a caudal fin that is slightly forked (Hubbs and Lagler, 1949). Brook trout have 10-14 principle dorsal rays, 9-13 principle anal rays, 8-10 pelvic rays, and 11-14 pectoral rays (Scott and Crossman, 1985). The brook trout also has a large terminal mouth with breeding males developing a hook or kype on the front of the lower jaw (Scott and Crossman, 1985).

The coloration of the brook trout is very distinct and can be spectacular. The back of the brook trout is dark olive-green to dark brown, sometimes almost black, the sides are lighter and become silvery white ventrally (Scott and Crossman, 1985). On the back and top of the head there are wormy cream colored wavy lines known as vermiculations which break up into spots on the side (Scott and Crossman, 1985). In addition to the pale spots on the side there are smaller more discrete red spots with bluish halos (Scott and Crossman 1985). The fins of the brook trout are also distinct; the dorsal fin has heavy black wavy lines, the caudal fin has black lines, the anal, pelvic and pectoral fins have white edges followed by black and then reddish coloration (Scott and Crossman, 1985).

Range mass: 1 to 6 kg.

Range length: 38.1 to 50.8 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 3 - 4; Dorsal soft rays (total): 8 - 14; Anal spines: 3 - 4; Analsoft rays: 8 - 14; Vertebrae: 58 - 62
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 40 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 860 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 86 cm SL; max. weight: 9,390 g.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

86.0 cm SL (male/unsexed; (Ref. 7248)); max. published weight: 9,390 g (Ref. 4699); max. reported age: 24 years (Ref. 72501)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished by the combination of dark green marbling on its back and dorsal fin and by the red spots with blue halos on its sides (Ref. 27547). Pelvic fins with axillary process; caudal nearly straight or with a shallow indentation (Ref. 27547). Color varies, but generally rather green to brownish on back, marked with paler vermiculations or marbling that extend onto the dorsal fin and sometimes the caudal; sides lighter than back, marked with numerous pale spots and some red spots, each of the latter surrounded by a blue halo; anal, pelvic and pectoral fins with a white leading edge followed by a dark stripe, the rest of the fins reddish (Ref. 27547). In spawning fish the lower sides and fins become red (Ref. 27547). Sea-run fish are dark green above with silvery sides, white bellies and very pale pink spots (Ref. 27547). Caudal fin with 19 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Brook trout are found in three types of aquatic environments: rivers, lakes, and marine areas. Their living requirements in these environments are very specific. The freshwater populations occur in clear, cool, well-oxygenated streams and lakes (Scott and Crossman, 1985). Brook trout thrive in these environments with temperatures that remain below 18.8 C and where there is little to no siltation (LaConte, 1997). Stream dwelling brook trout require three habitat components, which include resting areas in pools, feeding sites near riffles or swiftly flowing water, and escape cover which normally is found along undercut banks, under woody debris, trees or large rock ledges ("Brook Trout," 1987). Brook trout that reside in marine environments migrate there from freshwater tributaries and tend to stay close to river mouths.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

  • 1987. Brook Trout. J Mayhew, ed. Iowa Fish and Fishing. Des Moines, Iowa, USA: Iowa Department of Natural Resources. Accessed November 04, 2004 at http://www.iowadnr.com/fish/iafish/brooktro.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

anadromous; found in cool, clear streams and lakes, most venture out to the sea for 2-3 months of the year
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 4.5
  Temperature range (°C): 2.279 - 2.279
  Nitrate (umol/L): 3.660 - 3.660
  Salinity (PPS): 33.515 - 33.515
  Oxygen (ml/l): 7.696 - 7.696
  Phosphate (umol/l): 0.700 - 0.700
  Silicate (umol/l): 4.428 - 4.428

Graphical representation

Depth range (m): 0 - 4.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Most populations occur in clear, cool, well-oxygenated creeks, small to medium rivers, and lakes. Individuals may move from streams into lakes or the sea to avoid high temperatures in summer. Some populations migrate between freshwater and saltwater habitats. Other populations (known as "coasters") live in lakes and migrate to streams to spawn, or they remain in the lake to spawn. Preferred water temperature is around 14-16 C; brook trout do poorly where water temperature exceeds 20 C for extended periods (see Sublette et al. 1990). Spawning occurs in cool water (usually less than 15 C) usually over gravel beds in shallow headwaters but also may occur in gravelly shallows of lakes if spring (groundwater) upwelling and moderate current or nearby surficial inflow (Quinn 1995) are present. Eggs are buried in nests in gravel. In Ontario, eggs were buried at 7-20 cm in bottom substrate (Snucins et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 15 - 27m.
From 15 to 27 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; freshwater; brackish; marine; depth range 15 - 27 m. Occurs in clear, cool, well-oxygenated creeks, small to medium rivers, and lakes. ?Salters? run to the sea in the spring as stream temperatures rises, remain close to river mouths. May stay at sea for up to three months.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 15 - 27 m (Ref. 3899)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Introduction

This species has been introduced or released in Dutch waters.
  • Nijssen, H.; de Groot, S.J. (1987). De vissen van Nederland: systematische indeling, historisch overzicht, het ontstaan van de viskweek, uitheemse vissoorten, determineersleutels, beschrijvingen, afbeeldingen, literatuur, van alle in Nederlandse wateren voor komende zee- en zoetwatervissoorten [Fishes of the Netherlands: systematic classification, historical overview, origins of fish culture, non-indigenous species, determination keys, descriptions, drawings, literature references on all marine and freshwater fish species living in Dutch waters]. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-006-1. 224 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=73 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Some populations spawn and undergo considerable development in fresh water but also feed and develop to some extent in salt water (Hartel et al. 2002). These "salters" or "sea trout" may coexist with nonmigratory brook trout. The timing of seaward migration is variable but generally occurs in spring in northern latitudes (Naiman et al. 1987). Migrants spend a few days to 4 months in coastal seawater not far (usually less than 45 kilometers) from their natal stream (Mullan 1958, Smith and Saunders 1958, Bergin 1984, Naiman et al. 1987, Montgomery et al. 1990, Ryther 1997). Although sea-run populations often are referred to as being "anadromous," they are most accurately classified as "amphidromous" because they make regular feeding migrations to the sea while still undergoing significant freshwater growth (Collette and Klein-McPhee 2002).

Adults in some populations migrate seasonally between lakes and tributary streams. In the Great Lakes, these brook trout are known as "coasters." Some coasters remain permanently in lakes.

Movement can be extensive even within streams. For example, in the Kennebecasis River, New Brunswick, brook trout moved upstream 65-100 kilometers in spring after ice loss; summer movements were minimal; movements to spawning areas in fall were less than 10 kilometers, then the fish moved back downstream to wintering areas in the lower to middle reaches of the river (Curry et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The food habits of brook trout vary according to their age and life history stage. As fry, or very young fish, brook trout feed primarily on immature stages of aquatic insects (Everhart, 1961). In general a brook trout's diet can be likened to a smorgasbord of organisms with prey ranging from mayflies to salamanders (Wittman, 2001). A brook trout will virtually eat anything its mouth will accommodate, including mostly many aquatic insect larvae such as caddisflies, mayflies, midges, and black flies. Other organisms consumed include worms, leeches, crustaceans, terrestrial insects, spiders, mollusks, a number of other fish species (cannibalism is limited to spawning time and spring), frogs, salamanders, snakes and even small mammals like voles (e.g. Microtus, Cleithrionomys), should they find one in the water (Scott and Crossman, 1985). As brook trout become larger their diet shifts more towards a piscovourus one (Everhart, 1961). Sea-run brook trout eat fish and intertebrates that are commonly found in marine environments (Scott and Crossman, 1985).

Animal Foods: mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Insectivore )

  • Wittman, S. 2001. "Brook Trout" (On-line). Fish of the Great Lakes. Accessed 11/05/04 at http://www.seagrant.wisc.edu/greatlakesfish/brooktrout.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits cold, well-oxygenated waters of rivers, lakes and reservoirs (Ref. 30578). Anadromous (Ref. 5951). Feeding effort in juveniles is directed toward sub-surface, invertebrate drift (Ref. 28091). It is preyed upon by eels, white perch, yellow perch, chain pickerel, eastern belted kingfisher and American merganser (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on various invertebrate and vertebrate animals, including primarily terrestrial and aquatic insects and planktonic crustaceans. In estuarine and marine habitats, the diet includes various fishes and crustaceans (see Collette and Klein-McPhee 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wide range of organisms including worms, leeches, crustaceans, insects, mollusks, fishes, amphibians, and small mammals.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Salvelinus fontinalis (Brook trout (N=2)) is prey of:
Salvelinus fontinalis

Based on studies in:
USA: New York, Bridge Brook (Lake or pond)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection 8. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camallanus Infection 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Adults in streams may defend small feeding territories that extend several body lengths in diameter (Grant et al. 1989). In experimental stream communities, Resetarits 1991 found that brook trout negatively affected both growth and survival of the salamander Gyrinophilus porphyriticus; the presence of Gyrinophilus had no affect on relative condition or fecundity of Salvelinus. Salvelinus and Gyrinophilus affected the growth of the two-lined salamander Eurycea and the crayfish Cambarus bartonii. Salvelinus caused Cambarus and Eurycea to alter their activity levels and habitat; Eurycea and Cambarus were able to avoid predation by Salvelinus and Gyrinophilus but at a significant cost to growth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Most feeding in early morning and evening (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Courtship begins with a male attempting to drive a female toward suitable spawning gravel. A receptive female chooses a spot and digs a redd. While the female is digging, the male continues courtship activity, darting alongside the female and quivering, swimming over and under her and rubbing her with his fins; most of the time however, is spent driving off other males. When the redd is completed, the pair enter the nest and deposit eggs and milt. After spawning the female covers the eggs by sweeping small pebbles at the downstream edge of the redd upstream. Once the eggs are completely covered, she moves to the upstream end of the redd and begins digging a new redd (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
24.0 years.

Average lifespan

Sex: female

Status: wild:
16.0 years.

Average lifespan

Sex: male

Status: wild:
16.0 years.

Average lifespan

Status: wild:
8.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (wild) Observations: Environmental factors impact greatly on the lifespan of these animals (Das 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Usually only a single male is able to fertilize the eggs that a female lays in a redd, but occasionally more than one male is able to do so. Usually the largest males are the most successful breeders.

Mating System: monogamous ; polyandrous

Brook trout spawn in late summer or autumn depending on the latitude and temperature (Scott and Crossman, 1985). The type of area required for brook trout spawning is one that offers loose, clean gravel in shallow riffles or shoreline area with an excellent supply of upwelling, oxygen-rich water (LaConte, 1997). Mature fish have been known to travel many miles upstream to reach adequate spawning grounds (Scott and Crossman, 1985). Females are able to detect upwelling springs or other areas of ground-water flow, which make for excellent spawning grounds. Brook trout reach maturity on an average at the age of two and spawn every year, although their size at first maturity depends on growth rate and the productivity of thier habitat (Everhart, 1961). Males often outnumber females at the spawning site, but only rarely is more than one male able to fertilize the eggs in a particular redd (Scott and Crossman, 1985; Blanchfield et al., 2003). The females clear away debris and silt with rapid fanning of her caudal fin while on her side, creating a redd (Scott and Crossman, 1985). The redd is where the eggs will be deposited and fertilized after the males compete for spawning right to the female (Scott and Crossman, 1985). The redd actually resembles a pit that is 4-12 inches in depth (Everhart, 1961). To gain the spawning right of the female the males compete for position by nipping and displaying themselves to the competitor males (Mills, 1971). When spawning is actually taking place the male takes a position to hold the female against the bottom of the redd and both of the fish vibrate intensely while eggs and milt are simultaneously discharged (Scott and Crossman, 1985). Very shortly after this exchange takes place the female works to cover the fertilized eggs with gravel by digging slightly upstream and letting the current carry the gravel down to fill the redd (Everhart, 1961). The eggs are initially adhesive to prevent them from washing away so they are able to incubate within the gravel (Scott and Crossman, 1985). The total time of incubation depends on factors such as temperature and oxygen (Scott and Crossman, 1985). After hatch the fry remain in the gravel until the yolk sac is absorbed then the fry swim up out of the gravel to begin the next stage of their life (Scott and Crossman, 1985).

Breeding interval: Brook trout breed once per year

Breeding season: Spawning occurs in late summer or autumn

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

  • Blanchfield, P., M. Ridgway, C. Wilson. 2003. Breeding success of male brook trout (Salvelinus fontinalis) in the wild. Molecular Ecology, 12(9): 2417-2428.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning occurs in late summer (in north) or fall (October-November in many areas). Eggs hatch in 47 days at 10 C, in 165 days at 2.8 C. In Ontario, alevin emergence occurred over a 71-day period, coinciding with the spring thaw and an episodic pH depression (Snucins et al. 1992). Sexually mature in 2-3 years (also reported as first year for males, 2nd year for females). Only small percentages of returning migrants actually spawn; post-spawning mortality generally is low (Stearley 1992). In dense, small-stream populations, few live more than 3 years, whereas some live 9-10 years in large rivers and lakes in the northern part of the range (Behnke 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nest built in gravel by female, while being courted by male. After spawning, female covers the eggs with small pebbles.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Bigelow, H. B., 1963; Page, L. M. and B. M. Burr, 1991; White, H. C., 1941; Smith, M. W. and J. W. Saunders, 1958; Smith, M. W. and J. W. Saunders, 1967; White, H. C., 1942; Scott, W. B. and E. J. Crossman, 1973; Ricker, W. E., 1932; Morrow, J. E., 1980.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Salvelinus fontinalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 29 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1483-06|NC_000860|Salvelinus fontinalis| ACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTCGGCACCGCCCTT---AGCCTCTTAATTCGGGCAGAGTTAAGCCAACCTGGAGCTCTTCTAGGGGAT---GACCAAATCTATAACGTAATCGTAACAGCCCATGCCTTCGTTATGATCTTCTTTATAGTTATACCAATTATGATTGGAGGATTTGGAAACTGATTAATTCCTCTAATA---ATTGGAGCCCCAGACATAGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTCCCGCCCTCCTTTCTACTTCTCCTGGCTTCGTCCGGAGTTGAAGCCGGCGCCGGTACGGGGTGAACAGTTTACCCCCCTCTAGCTGGGAACCTCGCCCACGCAGGAGCTTCCGTTGATTTA---ACTATTTTTTCCCTACATTTAGCTGGCATTTCCTCAATTTTAGGAGCCATTAACTTTATTACAACTATTATTAACATGAAACCCCCAGCTATTTCTCAGTATCAAACCCCACTTTTTGTTTGAGCTGTATTAGTTACTGCTGTCCTTTTATTACTTTCCCTCCCCGTTCTAGCAGCA---GGGATTACTATGTTACTCACCGACCGAAATTTAAATACCACTTTCTTTGACCCGGCAGGCGGAGGAGACCCAATTTTATACCAGCACCTCTTTTGATTCTTTGGCCACCCAGAGGTCTATATTCTTATTCTCCCAGGCTTCGGTATGATTTCCCACATCGTTGCATACTATTCCGGTAAAAAA---GAGCCCTTCGGGTATATAGGAATAGTCTGAGCTATAATAGCCATCGGACTCCTAGGATTCATCGTTTGAGCCCACCATATGTTTACTGTCGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Salvelinus fontinalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Species: 32
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

There are many extensive conservation efforts directed towards brook trout, especially naturally reproducing brook trout populations. This is because in many northeastern states and Canada brook trout, the only native stream dwelling trout in many of these places, are very susceptible to urbanization and deforestation and its effects on the surrounding aquatic ecosystems. Ohio for example has only two naturally reproducing populations of brook trout left and breeds these populations in hatcheries then placing them in other suitable habitats to reestablish these populations (LaConte, 1997). Many other states and areas in Canada are performing similar projects to preserve this treasured and threatened natural resource.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Poor land management associated with agriculture and urbanization ranks as the most widely distributed negative impact on stream populations of brook trout across the range in the eastern United States (Hudy et al. 2005, Trout Unlimited 2006). Non-native fishes rank as the largest biological threat to lake populations (Hudy et al. 2005, Trout Unlimited 2006).

Range has contracted in southern Appalachian region due to impacts of logging, fires, river impoundment, road and railroad construction, land clearance for agriculture and human habitation, and encroachment of introduced rainbow trout and brown trout (Larson and Moore 1985, Galbreath et al. 2001). Introduction of hatchery-reared brook trout from the northeastern United States has also affected native populations, but genetic sampling of populations in the Pigeon River system in North Carolina indicates that a high proportion of sampled populations consist of unaltered native fish (Galbreath et al. 2001).

Sea-run populations in eastern Canada and the northeastern United States were decimated over the past 200 years by overharvest, habitat degradation, and stocking of hatchery-reared brook trout and other non-native salmonids (Ryther 1997).

Historically, most of Lake Superior's 3,000 miles of shoreline and tributary streams supported coaster brook trout populations. In the mid-1800s, unregulated fishing decimated these stocks, and in-stream habitat loss due to wide-scale logging further reduced numbers and prevented stocks from recovering (USFWS, Region 3). Exploitation of coaster stocks and demands on their habitat accelerated in the twentieth century. The opening of the Lake Superior watershed by road, rail, and water removed protection by isolation. Fishing pressure increased, and habitat damge from hydroelectric dams, road and railway construction, and mining probably also contributed to the decline. In some areas, sea lamprey (Petromyzon marinus) predation, which peaked in the late 1950s (Curtis 1990), and the introduction of Pacific salmon and rainbow trout (Onchoryhychus mykiss) and brown trout (Salmo trutta) were additional stressors that probably reduced coaster abundance and distribution (Newman and DuBois 1996). By the mid-1900s only a handful of tiny remnant stocks still existed (USFWS, Region 3).

In general, brook trout populations respond most negatively to factors that decrease survival of large juveniles and small adults and that decrease growth rates of small juveniles (Marschall and Crowder 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See Thompson and Rahel (1996) for information on a depletion-removal electrofishing protocol that significantly reduced populations and recruitment but did not totally eradicate brook trout in streams managed for Colorado River cutthroat trout.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

As a gamefish the brook trout is very highly sought after and one of the most popular, especially in north eastern North America (Scott and Crossman, 1985). The brook trout can be caught by fishing with artificial flies, spin casting, or with live bait (Scott and Crossman, 1985). Brook trout and their vastly popular sport fishing bring to a community related recreational activities such as camping, boating, and the need for gear, guides and transportation, all of which provide positive economic opportunities (Hubbs and Lagler, 1949). Brook trout have been raised in hatcheries and distributed world wide in hope of creating the above mentioned opportunities in places where they do not natively occur or to reestablish and strengthen native populations (Scott and Crossman, 1985).

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Has been used in carcinogen testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Introduced populations of brook trout have contributed to the decline of native fishes (e.g., rare forms of cutthroat trout in the Rocky Mountains, bull trout in Columbia River basin), amphibians, and invertebrates in cold streams and lakes in western North America (see Adams et al. 2002). Prevention of further invasion has become a major concern (Adams et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brook trout

The brook trout, Salvelinus fontinalis, (sometimes called the eastern brook trout) is a species of fish in the salmon family of order Salmoniformes. In many parts of its range, it is known as the speckled trout or squaretail. A potamodromous population in Lake Superior are known as coaster trout or, simply, as coasters. Though commonly called a trout, the brook trout is actually a char, along with lake trout, bull trout, Dolly Varden and the Arctic char.

The term fontinalis comes from the Latin fontīnālis (of or from a spring or fountain).

Contents

Habitats and range

The brook trout is native to small streams, creeks, lakes, and spring ponds. Some brook trout, referred to as sea-run brook trout, are anadromous. It is native to a wide area of eastern North America but increasingly confined to higher elevations southward in the Appalachian Mountains to northern Georgia, Canada from the Hudson Bay basin east, the Great LakesSaint Lawrence system, and the upper Mississippi River drainage as far west as eastern Iowa.[2]

Typical pH range: 5 to 7.5 Unusual pH recordings: 3.5, 9.8.[3] Typical temperature range: 34 to 72°F (1 to 22°C)

Description

Brook trout from lake in Wyoming's Wind River Range.

Colouration: green to brown basic colouration with a distinctive marbled pattern (called vermiculations) of lighter shades across the flanks and back and extending at least to the dorsal fin, and often to the tail. There is a distinctive sprinkling of red dots, surrounded by blue haloes, along the flank. The belly and lower fins are reddish in color, the latter with white leading edges. Often the belly, particularly of the males, becomes very red or orange when the fish are spawning. The species reaches a maximum recorded length of 86 cm (33 in) and a maximum recorded weight of 6.6 kg (14.5 lb). It can reach at least seven years of age, with reports of 15-year-old specimens observed in California habitats to which the species has been introduced.

Captive Brook trout in aquarium


Typical length: 25 to 65 cm (10 to 26 in). Typical weight: 0.3 to 3 kg (11 oz to 7 lb).

Environmental requirements

S. fontinalis prefers clear waters of high purity and a narrow pH range in lakes, rivers, and streams, being sensitive to poor oxygenation, pollution, and changes in pH caused by environmental effects such as acid rain. Its diverse diet includes crustaceans, frogs and other amphibians, insects, molluscs, smaller fish, invertebrates, and even small aquatic mammals such as voles. It provides food for seabirds and suffers attack by lampreys. The brook trout is a short-lived species, rarely surviving beyond four or five years in the wild.

Individuals normally spend their entire life in fresh water, but some—colloquially called "salters" or "sea run"—may spend up to three months at sea in the spring, not straying more than a few kilometres from the river mouth. The fish return upstream to spawn in the late summer or autumn. The female constructs a depression in a location in the stream bed, sometimes referred to as a "redd", where groundwater percolates upward through the gravel. One or more males approaches the female, fertilizing the eggs as the female expresses them. The eggs are slightly denser than water. The female then buries the eggs in a small gravel mound. The eggs hatch in 95 to 100 days.

A potamodromous population of brook trout native to Lake Superior, which run into inflowing rivers to spawn, are called "coasters". Coasters tend to be larger than most other populations of brook trout, often reaching 2 to 3 kg in size. Many coaster populations have been severely damaged by overfishing and by habitat alterations, especially by the construction of hydro-electric power dams, on their inflowing streams. In Ontario and Michigan, efforts are under way to restore and recover coaster populations.

Angling and commercial use

Fly fishing
BrookTroutAmericanFishes.JPG
targets
bluefish
brook trout
crappie
hucho taimen
largemouth bass
northern pike
peacock bass
shoal bass
smallmouth bass
more fly fish...
other sport fish...

fishing

I N D E X
Brook trout chasing an artificial fly from American Fishes (1903) [4]

The brook trout is a popular game fish with anglers, particularly fly fishermen. Today, many anglers practice catch-and-release tactics to preserve remaining brook trout populations, and organizations such as Trout Unlimited have been in the forefront of efforts to institute air and water quality standards sufficient to protect the brook trout. Revenues derived from the sale of fishing licenses have been used to restore many sections of creeks and streams to brook trout habitat. Brook trout are also commercially raised in large numbers for food production, being sold for human consumption in both fresh and smoked forms. Because of its dependence on pure water and a variety of aquatic and insect life forms, the brook trout is also used for scientific experimentation in assessing the effects of pollution and contaminated waters.

Partially as a result of its popularity as a game fish, the brook trout has been introduced in some areas to which it was not originally native, and has become established widely throughout the world. In some parts of the world, the brook trout has had a harmful effect on native species, and is a potential pest.

Hybrids

Tiger trout

Brook trout can sometimes hybridise with other species and both natural and artificial hybrids are known. Native populations of bull trout (S. confluentus) are in danger of hybridization with introduced brook trout in the Pacific Northwest.[5]

Tiger trout

One such intergeneric hybrid, between the brook trout and the brown trout (genus Salmo) is the tiger trout. Tiger trout occur very rarely naturally but are sometimes artificially propagated. Such crosses are almost always reproductively sterile. They are popular with many fish stocking programs because they can grow quickly, and may help keep rough fish populations in check due to their highly piscivorous (fish-eating) nature.[6]

Splake

A less frequent natural hybrid is the splake, a hybrid between the brook trout and lake trout. Although uncommon in nature, some jurisdictions artificially propagate splake in substantial numbers for planting into brook trout or lake trout habitats. An example would be in Ontario, where both F1 splake and a fish known as the lake trout backcross have been planted for several years.[7] The backcross is the result of an F1 splake male being crossed with a female lake trout (i.e., 75% lake trout and 25% brook trout).

Although splake were first described in 1880, Ontario began experimenting with the hybrids in the 1960s in an effort to replace collapsed lake trout stocks in the Great Lakes. Due to mediocre results, the experiment never really progressed beyond Georgian Bay. The theory was that splake would grow more quickly and mature sooner than lake trout with the hope that they would be able to reproduce before being attacked by the invasive sea lamprey. Unfortunately, although splake are relatively unusual among hybrids in that they are fertile, fertility in nature is behaviourally problematic—very few natural progeny are produced by introduced splake populations.

After some experimentation in the late 1970s, stocking in the Great Lakes and, especially, in Georgian Bay, was converted entirely to the so-called lake trout backcross in the early 1980s. Although the backcross program did succeed in creating some localised angling opportunities, it never achieved any degree of success in terms of natural reproduction—the backcross was only marginally better at reproducing than was the F1 splake. The F1 splake has proved to be a success, however, in providing angling opportunities in smaller lakes and most of the planting of splake in Ontario now goes to those situations. There are two general cases. In the first case, former brook trout waters which have become infested with spiny-rayed fish to the point where they no longer produce brook trout are stocked with splake. The splake grow more quickly than do wild-strain brook trout and become piscivorous at a younger age and, hence, are more tolerant of competitors than are brook trout. In the second case, relatively small lake trout lakes that experienced poor recruitment due to insufficient deep-water juvenile lake trout habitat will support fairly good splake fisheries since splake are less dependent on extreme deep water than are the lake trout and they grow more quickly, providing a better return to anglers. In both cases, due to the behavioural sterility of splake, all such fisheries are entirely dependent on artificial propagation.

Human-caused habitat destruction

Drawing of a brook trout from John Treadwell Nichols's(1918) noting that the fish is now uncommon in the New York City area.

Brook-trout populations depend on cold, clear, well-oxygenated water of high purity. As early as the late 19th century, native brook trout in North America became extirpated from many watercourses as land development, forest clear-cutting, and industrialization took hold. Streams and creeks that were polluted, dammed, or silted up often became too warm to hold native brook trout, and were colonized by transplanted smallmouth bass and perch or other introduced salmonids such as brown and rainbow trout. The brown trout, a species not native to North America, has replaced the brook trout in much of the brook trout's native water. Brook trout populations, if already stressed by overharvest or by temperature, are very susceptible to damage by the introduction of exogenous species. Many lacustrine populations of brook trout have been extirpated by the introduction of other species, particularly percids but sometimes other spiny-rayed fishes.

In addition to chemical pollution and algae growth caused by runoff containing chemicals and fertilizers, air pollution has also been a significant factor in the disappearance of brook trout from their native habitats. In the United States, acid rain caused by air pollution has resulted in pH levels too low to sustain brook trout in all but the highest headwaters of some Appalachian streams and creeks.[8] Brook trout populations across large parts of eastern Canada have been similarly challenged; a subspecies known as the aurora trout was extirpated from the wild by the effects of acid rain.[9]

Today, in many parts of the range, efforts are underway to restore brook trout to those waters that once held native populations, stocking other trout species only in habitats that can no longer be recovered sufficiently to sustain brook trout populations.

Records

The current brook trout world angling record was caught by Dr. W. J. Cook on the Nipigon River, Ontario, in July 1915. The 31 inch trout weighed only 14.5 lbs because, at the time of weighing, it was badly decomposed after 21 days in the bush without refrigeration. This is the longest-standing angling world record.[10] A 29 inch brook trout, caught in October 2006 in Manitoba, is not eligible for record status since it was released alive.[11]

See also

References

  1. ^ "Salvelinus fontinalis". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=162003. Retrieved 30 January 2006. 
  2. ^ Trout Science: "Science of Trout"
  3. ^ Brook Trout (Salvelinus fontinalis)
  4. ^ Gill, Theodore; Goode, G. Brown (1903). American Fishes-A Popular Treatise upon the Game and Food Fishes of North America. Boston: L. C. Page and Company. 
  5. ^ Washington's Native Chars, Washington Department of Fish and Wildlife
  6. ^ Watch out, Utah chubs: Tiger trout placed in Scofield Reservoir Utah Division of Wildlife Resources, 24 May 2005. Retrieved 11 September 2006
  7. ^ http://publicdocs.mnr.gov.on.ca/View.asp?Document_ID=12760&Attachment_ID=25089 F1 Splake: An Annotated Bibliography and Literature Review (pdf)
  8. ^ Camuto, Christopher, A Fly Fisherman's Blue Ridge, Henry Holt & Company (1990)
  9. ^ Royal Ontario Museum's page on the Aurora trout
  10. ^ Dr. JW Cook's World Record Brook Trout Was Caught in 1915
  11. ^ Browny. The Fish, Fish'n Line Magazine.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Splake

The splake (Salvelinus namaycush X Salvelinus fontinalis) is a hybrid of two fish species resulting from the crossing of a male brook trout (Salvelinus fontinalis) and a female lake trout (Salvelinus namaycush). The name itself is a hybrid between 'SP'eckled trout (another name for brook trout) and 'LAKE' trout, and may have been used to describe such hybrids as early as the 1880s (Kerr, S.J. 2000). Hybrids of the male lake trout with the female brook trout (the so-called "brookinaw") have also been produced but are not as successful (Sowards, 1959).

3 versions of the Tiger Trout hybrid (above) and 1 Splake hybrid (below)

The intrageneric hybrid is of the genus Salvelinus and, hence, is most properly known as a char or charr. In some locales, the fish is referred to as the wendigo. Although the hybrid is genetically stable and is, theoretically, capable of reproducing, splake reproduction is extremely rare, for behavioural reasons, outside the hatchery environment. The only known natural reproduction has occurred in 5 lakes in Algonquin Provincial Park in Ontario, Canada and, in each case, only a handful of progeny were produced. Because splake typically do not reproduce, they are used as a sport fish in many lakes across the US. Fisheries managers are able to control populations numbers due to the extremely poor spawning success rate.

The fish possesses characteristics of both parent species. Splake exhibit higher growth rates than either parent species and can attain 46 cm (18 in) in length only 2 years after being planted as fingerlings (i.e., at 2½ years of age). By way of contrast, lacustrine brook trout would approach 25 cm (10 in) in length at a similar age and similarly-aged lake trout would be expected to be less than 40 cm (16 in) long.[1]

Splake are considered "easier to catch" than other salmonids and often live longer and fare better in certain situations. Hence, splake are well suited for stocking in a variety of cold water lakes and ponds. The maximum size is about 9 kg (20 lb) but fish over 4 kg (9 lb) are rare and are considered trophies.

Literature

  • Ayles, B. (1974): Relative importance of additive genetic and maternal sources of variation in early survival of young splake hybrids (Salvelinus fontinalis x S. namaycush). J. Fish. Res. Bd. Canada 31: 1499-1502.
  • Berst, A. H., Ihssen, P. E., Spangler, G. R., Ayles, G. B., Martin, G. W. (1980): The splake, a hybrid charr Salvelinus namaycush x S. fontinalis. In: Balon, E. K.(ed.): Charrs, Salmonid Fishes of the Genus Salvelinus. Dr. W. Junk Publishers, The Hague, 841-887.
  • Kerr, S. J. (2000): F1 Splake: An Annotated Bibliography and Literature Review. Fish and Wildlife Branch, Ontario Ministry of Natural Resources, Peterborough, Ontario. 79p. + appendices.
  • Sowards, C. L. 1959. Experiments in hybridizing several species of trout. Progressive Fish Culturist 21(4) : 147-150.

References

  1. ^ http://welcome.warnercnr.colostate.edu/~brett/lab/coldwater/trophic_economics.pdf Trophic Economics of Lake Trout Management in Reservoirs of Differing Productivity
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Analyses of mtDNA variation indicate that diversity is highest in the southern part of the range and lowest in the north; mid-Atlantic populations are transitional between these regions of high and low haplotypic diversity (Perkins et al. 1993, Hayes et al. 1996, Hall et al. 2002).

Genetic data from 30 populations representing six major river drainages in Maine "provided evidence for the role of contemporary landscape features in shaping the observed pattern of genetic diversity at smaller geographic scales (within and among populations within river drainage). On a broader geographic scale, contemporary landscape structure appeared to be only a minor factor determining the observed pattern of genetic structuring among drainages" (Castric et al. 2001).

Hybrids between this species and Salmo trutta and Salvelinus namaycush are known. Extinct subspecies agassizi (silver trout) sometimes has been regarded as a distinct species. The aurora trout, maintained only as hatchery stocks in lakes in the Temiskaming District of Ontario, may be a distinct subspecies, S. f. timagamiensis (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!