Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Roach rarely grow larger than 35 centimeters. They are found in stationary as well as moving water. Roach swim in schools which forage in the vicinity of vegetation (reed, rush), therefore shallow waters, but also in deeper open water. They are true omnivores. Young roach eat mostly water fleas while older specimen eat small snails, zebra mussels, insect larvae, worms and crustaceans. They use the teeth in their throat to crack open shellfish. Adult roach eat mainly plant material, such as algae and detritus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Roach feed on both animal matter and vegetation, principal foods being insect larvae, small molluscs and waterweed. They are tolerant of poor water conditions, even polluted water low in oxygen. The fish spawn from April to June in shallow water and attach their eggs – as many as 100,000 – to stones and plants. These hatch within four to 10 days, the fish larvae remaining attached to the vegetation until they have exhausted their yolk sacs. The young roach remain in shallow water and grow slowly, the males reaching maturity at two years, the females at three. Although used as a source of cheap food in some eastern parts of its range, the roach is known primarily as a sport-fish. Its sheer abundance and ability to tolerate poor quality water means that it one of the most common fish caught by anglers. The fish's natural predators include pike, eels and other large carnivorous fish, herons, osprey and aquatic mammals such as mink and otter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The roach is a common fish of fresh and brackish water, and one that is likely to be the most familiar to anglers. The eyes are red; the body silvery with a blue iridescence and prominent scales; the rays of the fins and tail are blue, with the webbing between fin spines an orange-red. They are not large fish and the body size varies considerably depending on the food available and other local conditions. The largest roach recorded weighed less than two kilograms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Rutilus rutilus ZBK (Linnaeus, 1758)

Inland water: 28900-852 (1 spc.), 1975, Bueyuekcekmece Lagoon , Istanbul , N. Meriç ; 28900-831 (2 spc.), 23.06.1981 , Karasu Stream, Bueyuekcekmece , Istanbul , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 36-36, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in a wide variety of habitats, mainly in lowland areas. Most abundant in nutrient-rich lakes and large to medium sized rivers and backwaters. Also recorded from small lowland streams and from brackish coastal lagoons. In fast-flowing rivers, confined to stretches where backwaters or shelters allow for overwintering. Larvae and juveniles live in wide variety of littoral habitats. Preys predominantly on benthic invertebrates, zooplankton, plant material and detritus. May shift from littoral to pelagic habitats and between benthic food and zooplankton when abundance of a specific food item is high or for avoidance of predation and/or competition. Breeds among dense submerged vegetation in backwaters or lakes, flooded meadows or in shallow, fast-flowing river habitats on plant or gravel bottom. Undertakes short spawning migrations. Stays in backwaters or in deep parts of lakes to overwinter. Produces fertile hybrids with Abramis brama (Ref. 59043). Pale yellow eggs are found attached to vegetation and tree roots (Ref. 41678). There is only little commercial fishing for this species, but valued for recreational fishing. Utilized fresh and dried or salted; can be pan-fried, broiled and baked (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Europe north of Pyrénées and Alps, eastward to Ural and Eya drainages (Caspian basin). Aegean basin, in Pinios, Vardar, Vegoritis, Kastoria, Struma and Maritza drainages. Asia: Aral basin and Siberia from Ob eastward to Lena drainages. Naturally absent from Iberian Peninsula, Adriatic basin, Italy, Great Britain north of 56°N, Scandinavia north of 69°N. Locally introduced in Spain. Introduced and invasive in northeastern Italy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe: north to Pyrenees and Alps, eastward to Ural and Eya drainages (Caspian basin); Aegean basin in Pinios, Vardar, Vegoritis, Kastoria, Struma and Maritza drainages. Asia: Marmara basin and lower Sakarya in Anatolia, Aral basin, and Siberia from Ob eastward to Lena drainages. Naturally absent from Iberian Peninsula, Adriatic basin, Italy, Great Britain north of 56 N, Scandinavia north of 69° N. Locally introduced in Spain; introduced and invasive in northeastern Italy. At least one country reports adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Europe and Asia; introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The roaches range extends from the UK, through central Europe and eastern Scandinavia, south and east through Asia Minor, Russia and into Siberia. They have also been introduced into Australia, Cypress, Morocco, Ireland, Italy and Spain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 9 - 12; Analspines: 3; Analsoft rays: 9 - 13; Vertebrae: 39 - 41
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 460 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

50.0 cm SL (male/unsexed; (Ref. 59043)); max. published weight: 1,840 g (Ref. 4699); max. reported age: 14 years (Ref. 41616)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

The only species of the genus in Atlantic basin north of Pyrénées which can be distinguished from its congeners in Black and Caspian Sea basins and Apennine Peninsula by the combination of the following characters: 39-41 + 2-3 (41-44 total) scales along lateral line; dorsal and anal fins with 10½ branched rays; body laterally compressed, depth 25-35% SL; mouth terminal; snout pointed; iris from yellow in juveniles to deep red in adults; pectoral, pelvic and anal fins orange to red; and no midlateral stripe. Differs from its congeners in Balkan Peninsula by uniquely possessing 10½ branched anal rays (Ref. 59043). Caudal fin with 18-19 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
In a wide variety of habitats, mainly in lowland areas. Most abundant in nutrient-rich lakes and large to medium sized rivers and backwaters. Takes advantage of channelization, damming and slight organic pollution. Known also from small lowland streams and from brackish coastal lagoons. In fast-flowing rivers, restricted to stretches where backwaters or shelters allow for overwintering. Spawns among dense submerged vegetation in backwaters or lakes, flooded meadows or in shallow, fast-flowing river habitats on plant or gravel bottom.

Biology:
Lives up to 13 years. Males reproduce for the first time at 2-3 years, females one year later, usually at about 100 mm SL. Undertakes short spawning migrations, sometimes starting as early as September, usually with a peak at temperatures above 9°C in spring. Spawns in April-May, when temperature rises above 12°C. Usually, a whole population spawns within a period of 5-10 days. Spawns in shoals. Eggs are sticky and hatch in about 12 days. Larvae and juveniles inhabit a wide variety of littoral habitats. Feeds mainly on benthic invertebrates, zooplankton, plant material and detritus. Populations predominantly feeding on detritus are often stunted (stunted populations may also be associated with strong year classes). May shift from littoral to pelagic habitats and between benthic food and zooplankton when abundance of a specific food item is high or in order to avoid predation and/or competition. The decision whether to stay in open water or among littoral vegetation is often described as a trade-off between food uptake and predator avoidance. When growing, there is an energetic need to switch from zooplankton to benthic food (chironomids, molluscs). Individuals able to feed on Dreissena mussels increase their growth rate but do not exploit this food source until they have reached about 120 mm SL (at which size they are able to crush the mussels). In some area (Volga reservoirs), pelagic and benthic roach can be distinguished by life-history traits (spawning time, spawning sites). Overwinters in backwaters or in deep parts of lakes. Frequently produces fertile hybrids with Abramis brama.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; potamodromous (Ref. 51243); freshwater; brackish; pH range: 7.0 - 7.5; dH range: 10 - 15; depth range 15 - ? m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 12055 specimens in 1 taxon.
Water temperature and chemistry ranges based on 925 samples.

Environmental ranges
  Depth range (m): 1 - 48
  Temperature range (°C): 4.324 - 7.898
  Nitrate (umol/L): 1.212 - 2.178
  Salinity (PPS): 5.681 - 10.036
  Oxygen (ml/l): 7.360 - 8.684
  Phosphate (umol/l): 0.114 - 0.469
  Silicate (umol/l): 10.213 - 14.574

Graphical representation

Depth range (m): 1 - 48

Temperature range (°C): 4.324 - 7.898

Nitrate (umol/L): 1.212 - 2.178

Salinity (PPS): 5.681 - 10.036

Oxygen (ml/l): 7.360 - 8.684

Phosphate (umol/l): 0.114 - 0.469

Silicate (umol/l): 10.213 - 14.574
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Roach are found in freshwater lakes, canals and slow-moving rivers, and brackish waters and lakes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Facultative schooling fish (Ref. 46093). Large fish are solitary or congregate in small groups of up to 8 fish (Ref. 46637). Specimens ranging from 1.1 - 3.59 cm start exogenous feeding on pollen grains and vegetal cells (Ref 4938). Omnivore (Ref. 75154); feed on benthic organisms, plants and detritus (Ref. 26323).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Rutilus rutilus

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises skin of Rutilus rutilus

Animal / parasite / endoparasite
tapeworm of Caryophyllaeides fennica endoparasitises intestine of Rutilus rutilus

Animal / parasite / endoparasite
tapeworm of Caryophyllaeus laticeps endoparasitises intestine of Rutilus rutilus

Animal / parasite / endoparasite
Cryptobia borelli endoparasitises blood of Rutilus rutilus

Animal / parasite / ectoparasite
fluke of Dactylogyrus ectoparasitises gill of Rutilus rutilus

Animal / parasite
fluke of Dactylogyrus vistulae parasitises Rutilus rutilus

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Rutilus rutilus

Animal / parasite
tapeworm of Ligula intestinalis parasitises Rutilus rutilus

Animal / parasite / endoparasite
Myxobolus endoparasitises gills of Rutilus rutilus

Animal / parasite / ectoparasite
fluke of Neodactylogyrus ectoparasitises gill of Rutilus rutilus

Animal / parasite / ectoparasite
colony of Trichodina ectoparasitises skin of Rutilus rutilus

Animal / parasite / endoparasite
metacaria of Tylodelphys clavata endoparasitises eye (humour) of Rutilus rutilus

Animal / parasite / endoparasite
metacaria (diplostomula) of Tyrodelphys clavata endoparasitises vitreous humour of Rutilus rutilus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Rutilus rutilus is prey of:
Esocidae
Perca

Based on studies in:
Finland (Lake or pond, Littoral)

This list may not be complete but is based on published studies.
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78:181-190, from p. 185.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • K. Aulio, K. Jumppanen, H. Molsa, J. Nevalainen, M. Rajasilta, I. Vuorinen, Litoraalin merkitys Pyhajarven kalatuotannolle, Sakylan Pyhajarven Tila Ja Biologinen Tuotanto (Lounais-Suomen Vesiensuojeluyhdistys R. Y., Turku, Finland, 1981) 47:173-176.
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78:181-190, from p. 185.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Worm Cataract. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Black Spot Disease 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns in shoals among dense among dense submerged vegetation in backwaters or lakes, flooded meadows or in shallow, fast-flowing river habitats on plant or gravel bottom. Eggs are sticky and hatch in about 12 days (Ref. 59043). Pale yellow eggs are attached to vegetation and tree roots (Ref. 41678).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Rutilus rutilus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Specimens with Barcodes: 153
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rutilus rutilus aralensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Rutilus rutilus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 40 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTTGTATTTGGTGCCTGAGCCGGAATAGTGGGGACTGCCCTAAGCCTCCTTATTCGGGCCGAACTAAGCCAACCCGGGTCACTTTTAGGCGATGACCAAATTTATAATGTCATCGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATTCTTATTGGTGGATTCGGCAACTGACTCGTCCCACTAATAATTGGTGCACCTGACATAGCATTCCCACGAATAAATAATATGAGCTTCTGACTTCTCCCCCCATCATTCCTGTTATTATTAGCCTCTTCTGGTGTTGAGGCCGGTGCCGGAACGGGGTGAACAGTATACCCGCCTCTTGCAGGTAACCTCGCTCACGCCGGGGCATCAGTAGATTTAACAATCTTCTCACTTCACCTGGCAGGTGTATCATCAATTTTAGGGGCAGTTAATTTCATTACTACAATTATTAATATGAAACCCCCAGCCATCTCCCAGTATCAAACACCTCTCTTTGTATGAGCCGTACTAGTAACAGCCGTCCTTCTCCTTCTATCACTACCAGTGCTGGCTGCCGGAATTACAATGCTTCTTACAGATCGTAATCTTAATACTACATTCTTCGACCCAGCAGGAGGAGGGGACCCAATCCTATATCAGCACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species with no known major widespread threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Common
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There appears to be no major threat to this species, and its ability to live in conditions that other fish find intolerable has meant that the roach is a common species across most of its range. In some areas where it has been introduced, it has become to be regarded as a nuisance species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Apart from the close season for coarse angling in the UK (15 March to 15 June), roach can be fished from any river provided the angler holds a standard rod license and has the permission of the owner of that stretch of river. Commercially, the fish is of little value apart from around parts of the Black Sea coast where it is caught as a source of cheap food. However, the roach is an important part of the aquatic food chain in its native rivers and, by being a prey species in its own right, supports populations of other animals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common roach

The roach (Rutilus rutilus), also known as the common roach, is a fresh and brackish water fish of the Cyprinidae family, native to most of Europe and western Asia. Note that name "roach" is not unique, but fishes called roach can be any species of the genera Rutilus and Hesperoleucus depending on locality. The plural of the term is also roach.

Description[edit]

The roach is typically a small fish, often reaching no more than about 35 cm (14 inches). Maximum length is 45-50 cm. The body has a blueish silvery colour and becomes white at the belly. The fins are red. The number of scales along the lateral line is 39-48. The dorsal and anal fin has 12-14 rays. Young specimens have a slender build, older specimens get a higher and broader body shape. The roach can often be recognized by the big red spot in the iris above and beside the pupil. Colours of the eye and fins can be very pale however in some environments.

In Central and Northern Europe, the common roach can most easily be confused with the common rudd (Scardinius erythropthalmus), the dace (Leuciscus leuciscus) or the ide (Leuciscus idus). They can however be distinguished by the following characters:

  • The common rudd has a more yellow/greenish or golden colour. The backfin is placed more backwards and between the tip of the ventral scales and the first ray of the anal fin there are only one or two scales. The roach has 4 or 5 scales there. The mouth of the rudd is more upturned and the head appears sharper.
  • The dace has a greenish body, colorless eyes and fins and a distinct 'nose'.
  • The ide has a higher number of scales along the lateral line (55-61), a rounder body and a bigger mouth and head.

Distribution[edit]

Roach in aquarium

The common roach is found throughout Europe except for the area around the Mediterranean and its distribution reaches eastward into Siberia. In Eastern Europe and Asia there are several subspecies, some with an anadromous lifecycle living around the Caspian and Black Sea. Around the Mediterranean and in northwestern part of Spain and Portugal several closely related species occur with no overlap in their distribution.

It was introduced in Australia in the Murray River and coastal drainages of southern New South Wales and Victoria from Europe during the 1860s and 1880s for sport purposes.

Ecology[edit]

The common roach prefers to feed in the deeper parts of water bodies but can be found in any water body deeper than 20 centimetres (7.9 in) and wider than 1.5 metres (4 ft 11 in) and adapts to local circumstances,although in the summer months it can be caught using surface floats and bread. It tolerates organic pollution and is one of the last species to disappear in polluted waters, but is also often the most numerous cyprinid in nutrient-poor waters. It also tolerates brackish water. The lethal temperature is around 31 °C (88 °F).

Large female roach before spawning season

In most parts of its distribution it is the most numerous fish, but it can be surpassed by the carp bream in biomass in water bodies with high turbidity and sparse vegetation. The roach is a shoaling fish and is not very migratory with the exception of the anadromous subspecies. In the cold season they migrate to deep waters where they form large and dense shoals (small inland harbours are a favourite).

The roach prefers waters that are somewhat vegetated, because larval and young fish are protected by the vegetation and the mature fish can use it for food.

The common roach eats plant material, bottom dwelling (benthic) invertebrates and plankton. Young fish feed mainly on plankton, while the mature fish feeds mainly on benthos. It can adapt to environments where invertebrates are scarce by slowing its growth, maintaining a slender body shape and early maturation.

Reproduction[edit]

The spawning season is in April and May. Most often spawning occurs on sunny days. Roach generally spawn at the same location each year. Large males form schools that females enter. Males trail the female and fertilize the eggs. The behaviour is rough and the fish often jump out of the water. A female can lay up to 100,000 eggs. When the pH of the water is below 5.5 the roach cannot reproduce successfully.

Fishing[edit]

Fishing for roach in Britain is relatively easy because the species is found in most rivers, lakes and ponds throughout the country. Larger specimens tend to be elusive, but smaller individuals are easy to catch on relatively light line and with a bait such as maggot or worm. They also take particle baits such as sweetcorn and can be caught on a variety of baits. The only limit is the size of the bait, because the mouth of the roach is relatively small and the pharyngeal teeth are not particularly strong. A popular bait particularly in France and Belgium is germinated, cooked hemp seed.

Essential for good catches is regular feeding to keep the shoal active and feeding around the bait. Mostly fixed rods and floats are used for a controlled presentation of the bait, and for larger distances and specimens, match rods and swim feeders are used. The line doesn't need to be thicker than 0.12 mm and the hook not more than a size 12. Thinner lines and smaller hooks produce more fish especially when the roach are of small size. The best catches with fixed float fishing are often made when the bait is presented just a few centimeters above the bottom.

Boilies and luncheon meat are generally avoided by roach because they are too large for roaches to swallow. Because it is a schooling species, it is not unusual for an individual to be caught many times during a single session.[clarification needed] Sometimes a larger specimen could be waiting outside the shoal. Roach are infamous for their ability to throw the hook during retrieval, which perpetuates the idea that larger roach are notoriously difficult to bank. The maximum recorded weight for the species in Britain is 4 pounds (1.8 kg). Any fish over a pound is regarded as a specimen individual.

It is possible to make large catches in harbours where large shoals concentrate in the winter season. Flyfishing in such places with sinking artificial flies with a gold colored bead for a head on long leaders can produce good catches.

See also[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!