Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

Occur in oceanic and coastal waters (Ref. 26340). They are most common along surf beaches and rock headlands in clean, high energy waters, although adults can also be found in estuaries and into brackish water (Ref. 6492). Small fish may be found in shallow coastal waters at least 2 m depth (Ref. 9563), in schools pursuing and attacking small fishes (Ref. 9626). Adults are in loose groups, often attacking shoals of mullets or other fishes and destroying numbers apparently far in excess of feeding requirements (Ref. 9860). Feed on other fish (Ref. 5377), crustaceans and cephalopods (Ref. 47377). Associated with sharks and billfishes (Ref. 26340). Voracious and aggressive (Ref. 9626), reported to bite when handled. Migrate to warmer water during winter and to cooler water in summer (Ref. 9987). Popular game fish (Ref. 6638). Good food fish; marketed mostly fresh (Ref. 9860), but also dried or salted (Ref. 5284), and frozen (Ref. 9987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pomatomus saltatrix is an oblong, laterally compressed and streamlined predatory species that reaches 1m (3.3 feet) in total length (TL). Older juveniles and adult fishes tend to segregate into schools of similarly sized individuals (Olla and Studholme 1971; Wilk 1977). The head is large and compressed with the mouth set obliquely. The maxilla extends to the rear of the eye. The lower jaw projects from the mouth and has a row of long, unequal teeth on each side. The tongue, vomer, and palatine bones of the head all have bands of villiform teeth. Body color is bluish to greenish dorsally, fading to silver ventrally. The only obvious markings on the body surface occur at the bases of the pectoral fins, which are each blotched with a small dark patch. Ctenoid scales cover the opercule, cheek, and body, but not the top of the head or a ridge that runs above the cheeks. Ninety-five scales run along the lateral line. The spinous portion of the dorsal fin has 8 - 9 spines and is separated by a notch from the soft dorsal fin, which has 24- 25 soft rays. The anal fin reflects the soft dorsal fin, though it originates somewhat posterior to the dorsal fin, and has 2-3 small spines and 26-28 soft rays. The pectoral fins are set low on the body, with the pelvic fins set directly inferior to them. (Oliver et al. 1989; Pottern et al. 1989). Bluefish can be harmful and are reported to bite when handled.
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal: In tropical to subtropical waters; except the eastern Pacific (Ref. 33390). Eastern Atlantic: Portugal to South Africa, including the Mediterranean and Black Sea, Madeira, and the Canary Islands. Western Atlantic: Canada and Bermuda to Argentina (Ref. 7251). Indian Ocean: along the coast of East Africa, Madagascar, southern Oman, southwest India, the Malay Peninsula, and Western Australia (Ref. 11441). Southwest Pacific: Australia except the Northern Territory, and New Zealand (Ref. 11441). Absent from eastern Pacific and northwest Pacific. Barely entering the Western Central Pacific region. Records from the Northern Territory, Australia and from Indonesia appear to be erroneous (Ref. 9860). Occurrence in Taiwan (Ref. 5193) and Hawaii (Ref. 4517) need verification.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bluefish are found in all oceanic and coastal waters except the eastern and northwest Pacific. The adults can be found in estuaries and brackish water, but are most common in clean, high-energy waters, such as surf beaches and rock headlands (Agbayani 2001).

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Azores, Azores Exclusive Economic Zone, Black Sea, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, North West Atlantic, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species ranges in the western North Atlantic from Nova Scotia and Bermuda to Argentina (including the Gulf of Mexico), but it is rare between southern Florida and northern South America (Shepherd and Packer 2006). It also occurs in other warm seas worldwide but not in the eastern Pacific Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The bluefish has a nearly worldwide range in temperate and tropical waters around continental shelves and estuaries. It is absent only from the northern and central Pacific Ocean. In the Western Atlantic, it occurs from Nova Scotia south through Brazil, Uruguay and Argentina, including Bermuda, the Gulf of Mexico, the Bahamas, and northern Cuba (Oliver et al. 1989; Pottern et al. 1989). Bluefish can be seasonally abundant along the coast of Florida (Oliver et al. 1989), especially in late fall and winter when overwintering fish migrate to the east coast of Florida. During this time, bluefish can be common within the Indian River Lagoon, especially in the vicinity of inlets.
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through temperate seas (including Mediterranean Sea, Black Sea, Madagascar, Mascarenes), but excluding eastern and northwestern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: outer Nova Scotia and Cape Cod to Brazil and Argentina; Bermuda. Eastern Atlantic: off northwestern Africa; Mediterranean; both coasts of southern Africa. Madagascar; eastern Indian Ocean and Malay Peninsula; southern Australia and New Zealand.
  • Anon., 1990; Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Claro, R., 1994; Collette, B.B., 1999; Dooley, J.K., 1990; Frimodt, C., 1995; Grant, E.M., 1982; Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve, 1993; May, J.L. and J.G.H. Maxwell, 1986; Maigret, J. and B. Ly, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay of Fundy to Bermuda
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 23 - 28; Anal spines: 2 - 3; Analsoft rays: 23 - 27
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult P. saltatrix reach an average length of 30 cm but can grow as large as 120 cm. Coloration is greenish-blue to dark blue above giving way to a silvery white on the sides and below. They are covered in relatively small scales, have a straight lateral line, a forked tail, and dorsal and anal fins. Bluefish have an extended, down-turned lower jaw, with both jaws being lined with extremely sharp, conical teeth.

Range mass: 2 to 6 kg.

Range length: 120 (high) cm.

Average length: 30 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

130 cm TL (male/unsexed; (Ref. 11441)); max. published weight: 14.4 kg (Ref. 4699); max. reported age: 9 years (Ref. 6845)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pomatomus saltatrix grows to a maximum size of 130 cm TL (4.3 feet) (Randall 1995), and a maximum weight of 14.4 kg (31.7 pounds) (Intl. Game Fish Assoc. 1991).They live approximately 9 - 11 years. Males and females grow at approximately the same rates (Richards 1976).Two distinct stocks of bluefish occur along the Atlantic coast of the U.S. One stock spawns in late summer in the waters of the continental shelf between Cape Cod and Cape Hatteras, NC. The other spawns in early spring along the edge of the Gulf Stream between North Carolina and northern Florida. The stocks are physically distinguished using multivariate morphometric analyses and by differences in growth patterns on the scales. (Lassiter 1962; Kendall and Walford 1979). Yearlings of the spring-spawning group, when compared to the summer-spawning group, were shown to have somewhat larger heads, eyes, pectoral fins and longer maxillae; and relatively shorter dorsal, anal, and ventral fins (Wilk 1977). There is also a Gulf of Mexico stock that is apparently somewhat less migratory than those that occur along the eastern seaboard. However, genetic analysis revealed that Gulf of Mexico bluefish mix at least occasionally with those in south Florida such that they can be considered as one stock (Graves et al. 1993).
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 120.0 cm TL (male/unsexed); max. weight: 14 kg.
  • Anon., 1990; Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Claro, R., 1994; Collette, B.B., 1999; Dooley, J.K., 1990; Frimodt, C., 1995; Grant, E.M., 1982; Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve, 1993; May, J.L. and J.G.H. Maxwell, 1986; Maigret, J. and B. Ly, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Jaw teeth prominent, sharp, compressed, in a single series. Two dorsal fins, the first short and low, with 7 or 8 feeble spines connected by a membrane. Back greenish, sides and belly silvery (Ref. 9860).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 200 m (Ref. 54708)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Smaller bluefish live nearly year-round in estuaries and bays along the coasts. As they mature, they begin annual migrations. As the size of the bluefish increases, the distance they migrate also increases. They can tolerate water temperatures as low as 14°C, and can maintain a body temperature up to 40°C above the temperature of the surroundings. These coastal fish will sometimes enter brackish water, where they can tolerate a salinity concentration as low as 7 parts per thousand (Meyer; Bachand 1994).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths of 2- 200 m in oceanic and coastal waters, most common in surf areas.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3178 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1534 samples.

Environmental ranges
  Depth range (m): 0 - 800
  Temperature range (°C): 6.054 - 27.366
  Nitrate (umol/L): 0.286 - 18.243
  Salinity (PPS): 32.397 - 37.633
  Oxygen (ml/l): 3.453 - 6.835
  Phosphate (umol/l): 0.088 - 1.676
  Silicate (umol/l): 0.756 - 11.723

Graphical representation

Depth range (m): 0 - 800

Temperature range (°C): 6.054 - 27.366

Nitrate (umol/L): 0.286 - 18.243

Salinity (PPS): 32.397 - 37.633

Oxygen (ml/l): 3.453 - 6.835

Phosphate (umol/l): 0.088 - 1.676

Silicate (umol/l): 0.756 - 11.723
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Within the Middle Atlantic Bight (MAB) they occur in large bays and estuaries as well as across the entire continental shelf. Adults occur in bays and estuaries primarily in the warmest summer months. Juvenile stages have been recorded from all estuaries surveyed within the MAB, but eggs and larvae occur in oceanic waters. Spawning occurs offshore in spring-summer (possibly in fall off Florida). Juveniles move into estuaries in spring or summer (earlier in the south than in the north) and move out to sea in fall as temperatures decline. [Source: Shepherd and Packard 2006]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; brackish; marine; depth range 2 - 200 m. Found in oceanic and coastal waters, but most frequently occurs along surf beaches and rocky headlands in clean, high energy waters. Adults can also occur in estuaries and into brackish water. Juveniles and small adults may be in shallow coastal waters at least 2 m depth. Bluefish form schools and pursue and attack small fishes. Associated with sharks and billfishes. In summer blue fish migrate to cooler water and to warmer water during winter.
  • Anon., 1990; Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Claro, R., 1994; Collette, B.B., 1999; Dooley, J.K., 1990; Frimodt, C., 1995; Grant, E.M., 1982; Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve, 1993; May, J.L. and J.G.H. Maxwell, 1986; Maigret, J. and B. Ly, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Bluefish travel in schools of like-sized individuals and undertake seasonal migrations. Along the U.S. Atlantic coast they generally move north in spring-summer to centers of abundance in the New York Bight and southern New England and south in autumn-winter to the waters as far as southeastern Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 7300). In Western North Atlantic, it undergoes ontogenetic shift in the diet associated with the transition from oceanic to coastal habitats. Pelagic juveniles feed mainly on copepods prior to entry to the estuary, and primarily on fishes after entry to estuary (Ref. 12139). Tailor populations in South Africa and North America display definite seasonal migratory patterns, moving from higher latitudes to sub-tropical waters in winter (Ref. 1120, 6845). Tagging studies in Queensland and New South Wales have confirmed that a similar migratory pattern occurs in eastern Australian waters, at least north of Sydney (Ref. 6390).Tailor are cannibalistic and can be caught readily by anglers using tailor flesh as bait although the extent of their predation upon other tailor is probably limited by the species' tendency to school by size (Ref. 27687).One of the main predators during winter in a sandy beach at Canto Grande, Santa Catarina, Brazil (Ref. 55758).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Bluefish are strictly carnivorous, eating squid, shrimp, crabs, and fish, such as herring, atlantic mackeral, menhaden, spot, butterfish, and mullet. They are visual feeders that hunt in schools and will attack anything that moves or slightly resembles food. Bluefish will often first bite the tail off their prey, will then consume the food, will regurgitate, and will again eat (Bachand 1994; Meyer).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pomatomus saltatrix are opportunistic, visual, predators whose diet reflects the availability of prey species (Naughton and Saloman 1984). Larvae prey primarily copepods, cladocerans, and invertebrate eggs (Kendall and Naplin 1981). Juvenile bluefish prey on small shrimp, anchovies, killifishes, crabs and silversides (Pottern et al. 1989). Older juveniles and adults prey on schooling fishes, some of which include: croakers, striped mullet, menhaden, sardines, Atlantic bumper and round scad. Invertebrate prey includes small portunid crabs, penaeid shrimps, squid and gastropods. Kendall and Naplin (1981) reported that the diet of a juvenile bluefish consists of approximately 18% invertebrates, mostly penaeid shrimp and squid; and 82% vertebrates, primarily pinfish (Lagodon rhomboides) and silversides (Menida spp.). As juveniles grow, invertebrates become less important in the diet and can be entirely eliminated in favor of small, schooling fishes (Lassiter 1962).Naughton and Saloman (1984) reported the food habits of bluefishes captured in North and South Carolina showed a distinct preference for other bluefish, as well as for members of the Sciaenidae, Clupeidae, Mugilidae and Engraulidae as preferred prey.Feeding activity peaks in early morning and continues throughout daylight hours (Lund and Maltezos 1970). Under laboratory conditions, schools were observed breaking up as prey were pursued, with schools reforming after all prey had been consumed. Interestingly, Olla et al. (1970) found that prey size motivates feeding in bluefish. Captive bluefish fed to satiation on small prey immediately resumed feeding when larger prey of the same species were offered. Only large predators such as sharks, swordfishes, wahoo, and tunas are known to prey on bluefishes. Competitors: Possible competitors of bluefish include the king mackerel, Spanish mackerel, weakfish, striped bass, bonito and little tunny (Manooch 1984). Activity Time: As visual predators, bluefish are most active during the daylight hours. Activity increases at daybreak and continues increasing until midday. Thereafter, activity begins to gradually decline until 1-2 hours after dark when slower night time activity resumes (Lund and Maltezos 1970; Olla and Studholme 1972). Habitats: Bluefish are a migratory, pelagic species that are dependent on both continental shelf waters and estuaries for spawning and nursery areas respectively. Adults are found at depths of 2 - 200m (6.6 - 219 feet). In inshore areas, they tend to be most common along high energy beaches, but can also be common in estuaries and, sometimes, in brackish water areas. Small fish are common in shallow coastal waters where depths exceed 2m (6.6 feet).
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish. Adults are voracious and aggressive; attacking shoals of mullet or other fishes
  • Anon., 1990; Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Claro, R., 1994; Collette, B.B., 1999; Dooley, J.K., 1990; Frimodt, C., 1995; Grant, E.M., 1982; Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve, 1993; May, J.L. and J.G.H. Maxwell, 1986; Maigret, J. and B. Ly, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Pomatomus saltatrix (Bluefish) is prey of:
Homo sapiens
Mustelus canis
Squalus acanthias
Pomatomus saltatrix
Chondrichthyes
Leiostomus xanthurus

Based on studies in:
USA: Rhode Island (Coastal)
USA, Northeastern US contintental shelf (Coastal)
USA: Maryland, Chesapeake Bay (Estuarine)

This list may not be complete but is based on published studies.
  • J. N. Kremer and S. W. Nixon, A Coastal Marine Ecosystem: Simulation and Analysis, Vol. 24 of Ecol. Studies (Springer-Verlag, Berlin, 1978), from p. 12.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

  • J. N. Kremer and S. W. Nixon, A Coastal Marine Ecosystem: Simulation and Analysis, Vol. 24 of Ecol. Studies (Springer-Verlag, Berlin, 1978), from p. 12.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
  • Baird D, Ulanowicz RE (1989) The seasonal dynamics of the Chesapeake Bay ecosystem. Ecol Monogr 59:329–364
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Caligus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

The bluefish is abundant, especially in fall and winter in Florida waters. In the Carolinas it is ranked as the #1 gamefish of recreational anglers. In Florida, anglers often harvest more pounds of bluefish than commercial enterprises. Bluefish travel offshore in large schools following schools of baitfishes and other smaller prey species. Juveniles also school in large numbers, but tend to remain in shallow coastal waters or in estuaries. They later migrate in fall and winter to join adults offshore for migration to Florida waters. Locomotion: Bluefish passively ventilate their gills when swimming at speeds above 4 - 4.6 body lengths per second.Below this rate, the gills are ventilated by actively pumping the operculum.In laboratory studies, Olla et al. (1975) acclimated a captive bluefish population measuring 45 - 55 cm (1.5 - 1.8 feet) at 20ºC, which approximately corresponds to conditions in the Mid-Atlantic bight at the time of summer spawning. Olla et al. (1975) reported that bluefish under these conditions swam in daylight at a rate of approximately 50cm (1.6 feet) per second. At night, this rate was reduced to 50 cm (0.5 feet) per second.
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Fecundity varies from 400,000 to 2,000,000 eggs depending on the size of the individual (ranging from 370,000 in a 31 cm fish to 1,240,000 in a 54 cm fish) (Ref. 27695).Tailor are serial spawners (Ref. 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Bluefish have no external characteristics that can be used to distinguish males from females. However, males mature at an earlier age but their eventual size is not an indicator of gender. During their second year, bluefish reach sexual maturity. The females extrude between 0.6 and 1.4 million eggs in spurts as they migrate along the coasts. Males then spread their milt and fertilization occurs. Depending on water temperature, the free-floating, oil-filled eggs can hatch within 44 to 48 hours of fertilization. The newly hatched bluefish then migrate into estuaries and bays until they reach a weight of approximately 3 lbs. (Bachand 1994; Meyer).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eggs hatch in about 2 days at 18-22°C.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Several geographic races of bluefish are recognized (Lund 1961). However, based on mtDNA analyses and tagging information, Atlantic coast bluefishes and those that occur in the Gulf of Mexico mix often enough to be considered as a single genetic stock (Graves et al. 1993). Pomatomus saltatrix mature sexually during the second year upon reaching approximately 35 - 45 cm (1.15 - 1.48 feet) fork length (FL), with males maturing somewhat earlier than females (Wilk 1977). Fecundity of 3-4 year old females ranged from 0.6 - 1.4 million eggs (Lippson and Moran 1974). The south Atlantic, spring-spawning stock of bluefish reproduces primarily in April and May at the interface of the continental slope and the edge of the Gulf Stream between Cape Hatteras, NC and northern Florida (Wilk 1977). The mid-Atlantic stock of bluefish spawns in summer from May through September in outer continental shelf waters approximately 50 - 150 km offshore between Cape Cod and Cape Hatteras, NC (Lund and Maltezos 1970; Kendall and Walford 1979). Norcross et al. (1974) reported that over 80% of the bluefish eggs they collected were taken more than 55 km offshore. Spent bluefish in the Middle Atlantic tend to move inshore to Bays and estuaries throughout July and August.
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning season in spring and summer; eggs are pelagic. Fecundity varies from 400,000 to 2,000,000 eggs and is positively correlated with female size (ranging from 370,000 in a 31 cm fish to 1,240,000 in a 54 cm fish).
  • Anon., 1990; Bigelow, H.B. and W.C. Schroeder, 1953; Cervigón, F., 1993; Claro, R., 1994; Collette, B.B., 1999; Dooley, J.K., 1990; Frimodt, C., 1995; Grant, E.M., 1982; Kailola, P.J., M.J. Williams, P.C. Stewart, R.E. Reichelt, A. McNee and C. Grieve, 1993; May, J.L. and J.G.H. Maxwell, 1986; Maigret, J. and B. Ly, 1986; Whiteheat, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen, and E. Tortonese, 1984.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

Eggs are buoyant, spherical and measure 0.9 - 1.2 mm in diameter. The membrane is smooth and transparent, with amber-colored yolk and a single darker colored oil globule measuring approximately 0.3 mm in diameter. Eggs hatch after 46 - 48 hours into larvae measuring 2.0 - 2.4 mm in total length (TL) (Deuel et al. 1966; Kendall and Walford 1979). In newly hatched larvae, the yolk sac comprises over half of body length and melanophores are scattered along the head and back. Four days after hatching, the yolk is nearly entirely absorbed, the mouth is developed and pigment bands begin to emerge mid-dorsally and mid-ventrally. Fin rays can be seen when larvae reach approximately 6.0 mm TL, and are fully developed at 13 -14 mm TL. At this size, larvae resemble adults in overall body form and meristic counts, except that the head appears disproportionately large (Norcross et al. 1974; Lippson and Moran 1974). Larvae feed on plankton in surface waters until they metamorphose and begin to migrate back to estuaries and other coastal nursery areas. (Kendall and Walford 1979).Larval development takes place on outer continental shelf, generally in the upper 6m of surface waters (Kendall and Walford 1979). Larvae demonstrate diel vertical migration, concentrating at depths of approximately 4m (13 feet) around midday, and at the surface during the evening hours.
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomatomus saltatrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTTTATAGTAATACCAATTATGATCGGGGGATTCGGAAACTGGCTTATCCCCCTAATG---ATCGGGGCTCCAGACATGGCATTCCCTCGAATAAATAACATGAGCTTCTGACTCCTTCCACCCTCTTTCCTACTCCTCCTTGCCTCCTCCGGAGTTGAAGCCGGTGCTGGAACTGGATGAACGGTTTACCCGCCTTTAGCTGGAAACCTAGCCCATGCTGGAGCATCCGTTGACTTA---ACTATTTTTTCTCTTCACCTAGCAGGAATCTCCTCAATCCTTGGAGCAATCAACTTCATTACAACCATTATTAACATGAAACCTGCGGCTATTTCCCAGTATCAAACACCCCTATTTGTGTGAGCCGTTCTAATCACAGCTGTCCTTCTCCTACTATCTCTTCCAGTCCTTGCTGCT---GGAATTACAATGCTCCTAACAGACCGAAACCTAAACACAACCTTCTTTGACCCTGCAGGTGGAGGAGACCCCATTCTTTACCAGCACTTATTCTGATTCTTCGGACACCCCGAAGTGTACATTCTTATCCTTCCTGGATTCGGAATGATTTCTCACATTGTTGCCTACTATTCCGGTAAAAAA---GAACCTTTTGGCTATATAGGAATAGTATGAGCCATGATGGCCATCGGACTTCTAGGCTTTATCGTATGGGCCCACCATATGTTTACAGTTGGAATGGACGTGGATACACGAGCATACTTTACATCTGCAACAATAATTATCGCAATTCCAACCGGTGTCAAAGTCTTCAGCTGACTT---GCGACCCTCCACGGAGGA---GCCGTTAAATGAGAAACCCCTCTCCTATGAGCCATCGGCTTCATTTTCCTGTTCACAGTTGGTGGCCTAACAGGCATTGTTCTAGCTAATTCATCTTTAGACATTGTCCTTCATGATACATACTACGTTGTAGCCCACTTCCACTATGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pomatomus saltatrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 78
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; bait: usually; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Bluefish are economically important as both a sportfish and as a food. The bluefish's aggressive feeding habits and the fight it puts up makes it a very popular sportfish. Each year, about 55 million kilograms of bluefish are caught by anglers. In the United States, bluefish account for about 1% of the commercial fishery landings, but over the past 20 years, the catch was tripled (Manooch 2001; Species bluefish).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fisheries Importance: COMMERCIAL FISHERY: The bluefish is an important commercial and recreational species along nearly the entire east coast. In the southern states, from North Carolina through Florida, the recreational catch can exceed the commercial catch. The statewide commercial catch of Pomatomus saltatrix between the years 1987 - 2001 was 15.3 million pounds, with a dollar value of over $4.5 million. Within the 5-county area encompassing the IRL (Volusia, Brevard, Indian River, St. Lucie and Martin Counties) the commercial catch of Pomatomus saltatrix accounts for approximately 58% of the statewide total, with a harvest of 8.9 million pounds, and a value in excess of $2.6 million.This ranks the bluefish twenty-first in commercial value to IRL counties, and tenth in pounds harvested.Figure 1 below shows the dollar value of the bluefish fishery to IRL counties by year. As shown, commercial catch ranged from a low of $43,077 in 2001 to a high of over $342,328 in 1993. Of interest is the drastic reduction in the commercial catch following the 1995 banning of gill nets from Florida waters. This trend is reflective of both the gill net ban and a reduced number of commercial fishers. Muller (2001) reported that the number of commercial fishers was reduced from 347 in 1984 - 1994 to an average of 127 following the gill net ban. Martin and St. Lucie Counties account for the bulk of the commercial harvest, with 38.8% and 31.9% of the catch respectively (Figure 2, Table 3). From 1987 - 2001, the annual dollar value to Martin County ranged from $151,650 in 1987, dropping to only $6,046 in 2001, with an annual average of $66,727. In St. Lucie county, the annual dollar amount ranged from a high of $114,217 in 1993 to a low of $3,966 in 1997, with an annual average of $54,832. Of note is the trend in the data that suggests that while the fishery in the Martin County area declined to $3,000 - $6,000 annually after 1999, harvests in St. Lucie County and Brevard County were much stronger.RECREATIONAL FISHERY: Throughout Florida, recreational landings of bluefish are often significantly higher than commercial landings. In 2000, recreational landings of bluefish statewide were 6 times higher than commercial landings. Angler survey information shows that while the bag limit of 10 bluefish per trip is observed by the vast majority of anglers, the minimum size limit is not complied with as often. Muller (2001) reported in a bluefish stock assessment that 31% of bluefish harvested recreationally in 2001 were sublegal. However, the bluefish stock Figures 3 and 4 below show the recreational harvest of bluefish based on angler surveys from the 5-county area that encompasses the Indian River Lagoon from 1997 - 2001. By far, the largest percentage of bluefish (77.3%) are captured in coastal waters less than 3 miles from the shoreline, with many captures made from beaches and jetties. Inland waters other than the Indian River Lagoon accounted for 14.4% of the total, while the Indian River Lagoon harvest was less than half that (6.2%), and offshore waters to 200 miles accounted for only 2.1% of the harvest.
  • Austin, H., D. Scoles, and A Abell. 1999. Morphometric separation of annual cohorts within mid-Atlantic bluefish, Pomatomus saltatrix, using discriminant function analysis. Fish. Bull. 97: 411-420.
  • Bentley, T.B. and M.L. Wiley. 1982. Intra- and inter-specific variation in buoyancy of some estuarine fishes. Environ. Biol. Fishes 7(1):77-81.
  • Deuel, D., J. Clark, and A. Mansueti. 1966. Description of embryonic and early larval stages of the bluefish, Pomatomus saltatrix. Trans. Am. Fish. Soc. 95(3):264-271.
  • Graves, J., J. McDowell, A. Beardsley, and D. Scopes. 1993. Population genetic structure of the bluefish, Pomatomus saltatrix, in Atlantic coastal waters. Fish. Bull. 90:469-475.
  • Hare, J. and R. Cowen. 1993. Ecological and evolutionary implications of the larval transport and reproductive strategy of bluefish, Pomatomus saltatrix. Mar. Ecol. Progr. Ser. 98:1-16.
  • International Game Fish Association. 1991. World record game fishes. International Game Fish Association, Florida, USA.
  • Kendall, A. and L. Walford. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fish. Bull. 77(1):213-227.
  • Lassiter, R.R. 1962. Life history aspects of the bluefish Pomatomus saltatrix, from the coast of north Carolina. M.S. Thesis. N.C. Stat University, Raleigh, NC. 103 pp.
  • Lippson A.J. and R.L. Lippson. 1984. Life on the Chesapeake Bay. Johns Hopkins University Press, Baltimore, MD. 230 pp.
  • Lippson A.J. and R.L. Moran. 1974. Manual for identification of early developmental stages of fishes of the Potomac River Estuary. Martin Marietta Corporation Environmental Technical Center Report. PPSP-MP-13. 282 pp.
  • Lund, W.A. Jr. 1961. A racial investigation of the bluefish Pomatomus saltatrix of the Atlantic coast of North America. Bol. Inst. Oceanogr. Univ. Oriente Cumana (Venezuela), 1(1):73-129.
  • Lund, W.A. Jr. and G.C. Maltezos. 1970. Movements and migrations of the bluefish Pomatomus saltatrix tagged in waters of New York and southern New England. Trans. Am. Fish. Soc. 99(4):719-725.
  • Manooch, C.S. 1984. Fisherman's guide - fishes of the southeastern United States. N.C. State Museum of Natural History. Raleigh, NC. 362 pp.
  • McBride, R. J. Ross, and D. Conover. 1993. Recruitment of bluefish Pomatomussaltatrix to estuaries of the U.S. South Atlantic Bight. Fish. Bull. 91:389-395.
  • Muller, R.G. 2001. The 2000 update of the quota and stock assessment of bluefish,Pomatomus saltatrix, on Florida's Atlantic coast. Florida Fish and Wildlife Commission, Florida marine Research Institute, St. Petersburg, FL. 26 pp.
  • Naughton, S. and C. Saloman. 1984. Food of the bluefish (Pomatomus saltatrix)from the U.S. south Atlantic and GOM. U.S. Department of Commerce, NOAA Technical Memo. NMFS-SEFC-150, 37 pp.
  • Norcross, J.J., S.L. Richardson, W.H. Massmann, and E.B. Joseph. 1974. Development of young bluefish (Pomatomus saltatrix) and distribution of eggs and young in Virginia coastal waters. Trans. Am. Fish. Soc. 103(3):477-497.
  • Oliver, J.D. M.J. Van Den Avyle, and E.L. Bozeman, Jr. 1989. Species Profiles: Life histories and Environmental Requirements of Coastal Fishes and invertebrates (South Atlantic): Bluefish. U.S. Fish and Wildlife Services Biological Report. 82(11.96), U.S. Army Corps of Engineers. TR EL-82-4. 23 pp.
  • Olla, B.L., H.M. Katz, and A.L. Studholme. 1970. Prey capture and feeding motivation in the bluefish Pomatomus saltatrix. Copeia 1970(2):360-362.
  • Olla, B.L. and A. L. Studholme. 1972. Daily and seasonal rhythms of activity in thebluefish Pomatomus saltatrix. Pages 303-326 in: H.E. Winn and B.L. Olla, eds. Behavior of Marine Animals: Recent Advances. Vol. 2, Chapter 8. Plenum Publishing Corp., New York, NY.
  • Olla, B.L. and A. L. Studholme. 1975. Environmental stress and behavior: response capabilities of marine fishes. Pages 25-31 in: Second Joint U.S./U.S.S.R. symposium on the comprehensive analysis of the environment. Honolulu, HI, 21-26 October 1975. U.S. Environmental Protection Agency.
  • Pottern, G., M. Huish and J. Kerby. 1989. Species profiles: life histories and environmental requirements of coastal fishes and invertebrates (mid Atlantic): Bluefish. U.S. Fish and Wildlife Service Biological Reports 82111.94. U.S. Army Corps of engineers, TR EL-82-4. 20 pp.
  • Randall, J.E., 1995 Coastal fishes of Oman. University of Hawaii Press, Honolulu, Hawaii. 439 p.Richards, S.W. 1976. Age, growth and food of bluefish (Pomatomus saltatrix) from east-central Long Island Sound from July through November 1975. Trans. Am. Fish. Soc. 105(4):523-525.
  • Smith, W. P. Berrien, and T. Potoff. 1994. Spawning patterns of bluefish, Pomatomus saltatrix, in the northeast continental shelf ecosystem. Bull. Mar. Sci. 54(1):8-16.
  • Swanson, R.L. and C.J. Sinderman. 1979. Oxygen depletion and associated benthic mortalities in New York Bight, 1976. NOAA Prof. Papers 11.
  • Wilk, S.J. 1977. Biological and fisheries data on bluefish Pomatomus saltatrix. U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 11.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bluefish

The bluefish (Pomatomus saltatrix) is the only extant species of the Pomatomidae family. It is a marine pelagic fish found around the world in temperate and sub-tropical waters, except for the Northern Pacific Ocean. Bluefish are known as tailor in Australia,[1] shad on the east coast of South Africa, elf on the west coast, γοφάρι (gofari) or λουφάρι (loufari) in Modern Greek, and similarly, lüfer[2] in Turkish and луфарь/lufar in Russian. Other common names are blue, chopper, and anchoa.[3] It is good eating and a popular gamefish.

The bluefish is a moderately proportioned fish, with a broad, forked tail. The spiny first dorsal fin is normally folded back in a groove, as are its pectoral fins. Coloration is a grayish blue-green dorsally, fading to white on the lower sides and belly. Its single row of teeth in each jaw are uniform in size, knife-edged and sharp. Bluefish commonly range in size from seven-inch (18-cm) "snappers" to much larger, sometimes weighing as much as 40 pounds (18 kg), though fish heavier than 20 pounds (9 kg) are exceptional.

Contents

Distribution [edit]

"Trolling for blue fish" lithograph by Currier & Ives, 1866

Bluefish are widely distributed around the world in tropical and subtropical waters. They are found in pelagic waters on much of the continental shelves along eastern America (though not between south Florida and northern South America), Africa, the Mediterranean and Black Seas (and during migration in between), Southeast Asia and Australia. They are found in a variety of coastal habitats: above the continental shelf, in energetic waters near surf beaches or by rock headlands.[4] They also enter estuaries and inhabit brackish waters.[5][6][7] Periodically, they leave the coasts and migrate in schools through open waters.[8][9]

Along the U.S. east coast, bluefish are found off Florida in the winter months. By April, they have disappeared, heading north. By June, they may be found off Massachusetts; in years of high abundance, stragglers may be found as far north as Nova Scotia. By October, they leave New England waters, heading south (whereas some Bluefish, perhaps less migratory,[10][11] are present in the Gulf of Mexico throughout the year). In a similar pattern overall, the economically significant population that spawns in Europe's Black Sea migrates South through Istanbul (Bosphorus, Sea of Marmara, Dardanelles, Aegean Sea) and on toward Turkey's Mediterranean coast in the autumn for the cold season.[12] Along the South African coast and environs, movement patterns are roughly in parallel.[13]

Life history [edit]

Adult bluefish are typically between 20 and 60 cm long, with a maximum reported size of 120 cm and 14 kilograms. They reproduce during spring and summer, and can live for up to 9 years.[8][9] Bluefish fry are zooplankton, and are largely at the mercy of currents.[14][15] Spent bluefish have been found off east central Florida, migrating north. As with most marine fish, their spawning habits are not well known. In the western side of the North Atlantic, at least two populations occur, separated by Cape Hatteras in North Carolina. The Gulf Stream can carry fry spawned to the south of Cape Hatteras to the north, and eddies can spin off, carrying them into populations found off the coast of the mid-Atlantic, and the New England states.[16]

Feeding habits [edit]

Large bluefish, about 20 pounds
External video
Bluefish blitzYouTube
Bluefish Feeding FrenzyYouTube
Fishing for Gator BluefishYouTube

Adult bluefish are strong and aggressive, and live in loose groups. They are fast swimmers which prey on schools of forage fish, and continue attacking them in feeding frenzies even after they appear to have eaten their fill.[8][9] Depending on area and season, they favor menhaden and other sardine-like fish (Clupeidae), jacks (Scombridae), weakfish (Sciaenidae), grunts (Haemulidae), striped anchovies (Engraulidae), shrimp and squid. They are cannibalistic and can destroy their own young.[17] Bluefish sometimes chase bait through the surf zone, attacking schools in very shallow water, churning the water like a washing machine. This behavior is sometimes referred to as a "bluefish blitz".

In turn, bluefish are preyed upon by larger predators at all stages of their life cycle. As juveniles, they fall victim to a wide variety of oceanic predators, including striped bass, larger bluefish, fluke (summer flounder), weakfish, tuna, sharks, rays, and dolphins. As adults, bluefish are taken by tuna, sharks, billfish, seals, sea lions, dolphins, porpoises, and many other species.

Bluefish should be handled with caution due to their ability to snap at unwary hands. Fishermen have been severely bitten, and it can help to wear gloves. It a not good idea to wade or swim among feeding bluefish schools.[18] In July 2006, a seven-year-old girl was attacked on a beach, near the Spanish town of Alicante, allegedly by a bluefish.[19]

Commercial fisheries [edit]

Bluefish populations are cyclical
Wild capture of bluefish by countries in thousand tonnes, 1950–2010, as reported by the FAO[20]

In the U.S., bluefish are landed primarily in recreational fisheries, but important commercial fisheries also exist in temperate and subtropical waters.[21] Bluefish population abundance is typically cyclical, with abundance varying widely over a span of ten years or more (see chart).[22]

Management [edit]

Bluefish is a highly sought-after sportfish (and restaurant fish in some places) that had been widely overfished across the world's fisheries of this species.[23] Restrictions set forth by management organizations have somewhat helped the species' population stabilize. In the U.S., specifically along the seaboard of the middle Atlantic states, bluefish were at unhealthy levels in the late 1990s, but management resulted in this stocks being fully rebuilt by 2007 [24] In other parts of the world, public awareness efforts like Bluefish festivals, combined with catch limits, may be having positive effects in reducing the stress on the regional stocks.[25] Some of these efforts are regionally controversial.[13]

As food [edit]

Other uses [edit]

Bluefish are often caught and used as live bait for tuna, shark, or billfish.

Similar species [edit]

Bluefish are the only members now included in the Pomatomidae family. At one time, gnomefishes were included, but these are now in grouped in a separate family, Scombropidae.

Notes [edit]

  1. ^ CAAB taxon report for Pomatomus saltatrix at the CSIRO
  2. ^ See Turkisk Vikipedi, http://tr.wikipedia.org/wiki/L%C3%BCfer; also see, http://www.treehugger.com/green-food/istanbul-celebrates-new-hope-for-a-favorite-fish-with-first-annual-la14fer-festival.html
  3. ^ "Bluefish Identification". Retrieved 2009-02-17. 
  4. ^ http://www.nefsc.noaa.gov/publications/tm/tm144/tm144.pdf
  5. ^ McBride, R. S., Conover, D. O. 1991. Recruitment of young-of-the-year bluefish Pomatomus saltatrix to the New York Bight - variation in abundance and growth of spring-spawned and summer-spawned cohorts. Marine Ecology-Progress Series. 78(3): 205-216, www.int-res.com/articles/meps/78/m078p205.pdf
  6. ^ McBride, R. S., Ross, J. L., Conover, D. O. 1993. Recruitment of bluefish Pomatomus saltatrix to estuaries of the U.S. South Atlantic bight. Fishery Bulletin, U.S. 91(2): 389-395, http://fishbull.noaa.gov/912/mcbride.pdf
  7. ^ McBride, R. S., Scherer, M. D., Powell, J. C. 1995. Correlated variations in abundances, size, growth, and loss rates of age-0 bluefish in a southern New England estuary. Transactions of the American Fisheries Society. 124(6): 898-910, DOI: 10.1577/1548-8659(1995)124<0898:CVIASG>2.3.CO;2
  8. ^ a b c Froese, Rainer and Pauly, Daniel, eds. (2006). "Pomatomus saltatrix" in FishBase. March 2006 version.
  9. ^ a b c Pomatomus saltatrix (Linnaeus, 1766) FAO, Species Fact Sheet. Retrieved October 2012.
  10. ^ http://www.sms.si.edu/irlspec/pomatom_saltat.htm
  11. ^ ~~~~http://combat-fishing.com/fishencyclo1/bluefishes/bluefish.htm
  12. ^ http://www.slowfood.com/slowfish/pagine/eng/pagina.lasso?-id_pg=199
  13. ^ a b http://mosselbaai.wordpress.com/2012/05/13/pomatomus-saltatrix-shad-or-elf/
  14. ^ Norcross, J. J., Richardson, S. L., Massmann, W. H., Joseph, E. B. 1974. Development of young bluefish Pomatomus saltatrix and distribution of eggs and young in Virginian coastal waters. Trans. Am. Fish. Soc. 103:477-497.
  15. ^ Ditty, J. G., Shaw, R. F. 1993. http://www.galvestonlab.sefsc.noaa.gov/publications/pdf/832.pdf
  16. ^ Kendall, A. W., Jr., Walford, L. A. 1979. Sources and distribution of bluefish, Pomatomus saltatrix, larvae and juveniles off the east coast of the United States. Fishery Bulletin, U.S. 77(1): 213-227, http://fishbull.noaa.gov/77-1/kendall.pdf
  17. ^ Schultz, Ken (2009) Ken Schultz's Essentials of Fishing John Wiley & Sons. ISBN 9780470444313.
  18. ^ Lovko, Vincent J. (2008) Pathogenicity of the Purportedly Toxic Dinoflagellates Pfiesteria Piscicida and Pseudopfiesteria Shumwayae and Related Species ProQuest. ISBN 9780549882640.
  19. ^ "Un depredador rápido y muy voraz con dientes de sierra (in Spanish)" El País, July 14, 2006
  20. ^ Based on data sourced from the FishStat database
  21. ^ http://www.nefsc.noaa.gov/sos/spsyn/op/bluefish/
  22. ^ Ulanski, Stan (2011) Fishing North Carolina's Outer Banks University of North Carolina Press. ISBN 9780807872079.
  23. ^ http://icesjms.oxfordjournals.org/content/64/3/531.full
  24. ^ Bluefish FishWatch, NOAA. Retrieved 5 October 2012.
  25. ^ http://www.treehugger.com/green-food/istanbul-celebrates-new-hope-for-a-favorite-fish-with-first-annual-la14fer-festival.html

Other references [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!