Overview

Comprehensive Description

Comprehensive Description

Chinook or King Salmon (Oncorhynchus tshawytscha) are the largest salmon. They may reach around 150 cm in length and can occasionally exceed 23 kg; other salmon rarely exceed 14 kg. These fish have black spots on the back and on the dorsal, adipose and both lobes of the caudal (tail) fin. The gums are dark at the base of the teeth. At sea, these fish are blue, green, or gray above and silver below. Small males are often dull yellow while large males are often blotchy with dull red on the side. Breeding individuals are dark olive-brown to purple. (Page and Burr 1991)

The Chinook is the least abundant of the Pacific Salmon. It is anadromous (moving from the ocean to freshwater to breed), occurring in the Pacific Ocean and coastal streams. It is found in northeast Asia and, in North America, in Arctic and Pacific drainages from Point Hope, Alaska, to the Ventura River in California, occasionally straying south to San Diego, California. This species is widely stocked outside its range, notably in the Great Lakes. (Page and Burr 1991)

In comparison to other Pacific salmon: Sockeye and Chum Salmon (O. nerka and O. keta) have no large black spots; Coho Salmon (O. kisutch) have no black spots on the lower lobe of the caudal fin and have gums that are light at the base of the teeth; and Pink Salmon (O. gorbuscha) have large oval black spots on the back and caudal fin and do not exceed 76 cm in length. (Page and Burr 1991)

Chinook Salmon spawn once and die. For detailed information on the biology and status of this species, including conservation issues, see this resource from the NOAA Fisheries Office of Protected Resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Adults return to natal streams from the sea to spawn (Ref. 27547). Fry may migrate to the sea after only 3 months in fresh water, some may stay for as long as 3 years, but generally most stay a year in the stream before migrating (Ref. 27547). Some individuals remain close inshore throughout their lives, but some make extensive migrations (Ref. 27547, 44894). Also found in lakes (Ref. 1998). Possibly up to 375 m depth (Ref. 6793). Epipelagic (Ref. 58426). Food in streams is mainly terrestrial insects and small crustaceans; in the sea, major food items include fishes, crustaceans, and other invertebrates (Ref. 27547). Young are preyed upon by fishes and birds (such as mergansers and kingfishers); adults are prey of large mammals and large birds (Ref. 1998). Highly regarded game fish (Ref. 27547). Flesh is usually red, but some are white; the red meat commands a higher price (Ref. 27547). Marketed fresh, smoked, frozen, and canned. Eaten steamed, fried, broiled, boiled, microwaved, and baked (Ref. 9988). Viscera said to contain high vitamin A content and used successfully as food for hatchery fish (Ref. 28971, 28977). The Alaska Salmon fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_485.htm).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Chinook Salmon are found natively in the Pacific from Monterey Bay, California to the Chukchi Sea, Alaska in North America and from the Anadyr River, Siberia to Hokkaido, Japan in Asia. It has also been introduced to many places around the world including the Great Lakes and New Zealand.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Native ); australian (Introduced ); pacific ocean (Native )

  • Matthews, G., R. Waples. 1991. Status Review for Snake River Spring and Summer Chinook Salmon. NOAA Technical Memorandums.
  • Delehay, K., ADFG. 1994. "Chinook Salmon" (On-line). Accessed October 21, 2002 at http://www.state.ak.us/local/akpages/FISH.GAME/notebook/fish/chinook.htm.
  • NOAA, 2002. "Where do salmon go in the ocean?" (On-line). Accessed October 23, 2002 at http://www.nefsc.noaa.gov/faq/fishfaq2d.html.
  • Pacific States Marine Fisheries Commision, 1996. "Chinook Salmon" (On-line). Accessed October 21, 2002 at http://www.psmfc.org/habitat/edu_chinook_facts.html.
  • University of Wisconsin Sea Grant Institute, 2002. "Chinook Salmon" (On-line). Accessed October 21, 2002 at http://www.seagrant.wisc.edu/greatlakesfish/fchinooksalmon1.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

stocked in rivers draining in to the Gulf of Maine
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, Gulf of Maine, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North West Atlantic, North West Territories
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native range includes the Pacific Ocean and tributary drainages, in North America presently from the Sacramento-San Joaquin system (sometimes farther south) north to Point Hope, Alaska, and in northeastern Asia, from northern Japan to the Anadyr River. The species has been widely stocked elsewhere.

In the Columbia River basin, the Hanford Reach supports the largest population of fall chinook salmon; annual production is an estimated 20-25 million subyearling salmon (P. Hoffarth, Washington Department of Fish and Wildlife, unpublished data).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North America from Ventura R. in California to Point Hope, Alaska, and the Mackenzie R. area in Canada; Northeast Asia from Hokkaido, Japan, to the Anadyr R., Russia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic, Northwest to Northeast Pacific: drainages from Point Hope, Alaska to Ventura River, California, USA; occasionally strays south to San Diego in California, USA. Also in Honshu, Japan (Ref. 6793), Sea of Japan (Ref. 1998), Bering Sea (Ref. 2850) and Sea of Okhotsk (Ref. 1998). Found in Coppermine River in the Arctic. Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Chinook Salmon is the largest of all Pacific salmon species, often larger than 100 lbs and longer than 5 ft. It is characterized by a deep blue-green back, silvery sides and a white belly with black irregular spots on the back, dorsal fin and both lobes of the tail. It also has a small eye, black gum coloration, a thick caudal peduncle and 13-19 anal rays. For spawning, both males and females develop a reddish hue on the sides, although males may be deeper in color. Males can also be distinguished by a hooked nose and a ridged back. The Chinook fry look very different, with well developed parr marks (vertical bars) on their sides.

Range mass: 61.4 (high) kg.

Average mass: 13.6 kg.

Range length: 147.32 (high) cm.

Average length: 91.44 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful; sexes shaped differently

  • Government of Canada, 2002. "Salmon Biology--Pacific Region" (On-line). Accessed October 23, 2002 at http://www.pac.dfo-mpo.gc.ca/ops/fm/Salmon/chinook.htm.
  • NOAA, 2001. "Chinook Salmon (Oncorhyncus tshawytscha)" (On-line). Accessed October 21, 2002 at http://www.nmfs.noaa.gov/prot_res/species/fish/Chinook_salmon.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 14; Analspines: 0; Analsoft rays: 13 - 19; Vertebrae: 67 - 75
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 80 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 61.4 kg (Ref. 27547); max. reported age: 9 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from other Oncorhynchus by large size (to 45 kg), small black spots on both lobes of the caudal fin, black pigment along the base of the teeth, large number of pyloric caeca (>100), and variable flesh color (white to pink or red); fry and parr have large parr marks extending well below the lateral line (Healey 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distinguished by the small black spots on the back and on the upper and lower lobes of the caudal fin, and the black gums of the lower jaw (Ref. 27547). Body fusiform, streamlined, noticeably laterally compressed in large adults, somewhat deeper than other species (Ref. 6885). Gill rakers wide-spaced and rough; pelvic fins with axillary process (Ref. 27547). Fish in the sea are dark greenish to blue black on top of head and back, silvery to white on the lower sides and belly; numerous small, dark spots along back and upper sides and on both lobes of caudal; gum line of lower jaw black (Ref. 27547). In fresh water, with the approach of the breeding condition, the fish change to olive brown, red or purplish, the color change being more marked in males than in females (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Salmo cooperi
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Kennerly
Locality: Okanigan, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Salmo cooperi
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Kennerly
Locality: Okanigan R. (Okanakani R.), British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)


Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat

The Chinook Salmon is anadromous– born in freshwater, migrating to the ocean, and returning as mature adults to their natal streams to spawn. Freshwater streams, estuaries, and the open ocean are all important habitats. The freshwater streams are relatively deep with course gravel. The water must be cool, under 14 C for maximum survival, and fast flowing. Estuaries provide a transition zone between the freshwater and saltwater and the more vegetation the better because there will be more feeding and hiding opportunities. At sea, Chinook Salmon can either stay close to shore or migrate thousands of miles to deep in the Pacific.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; coastal

Other Habitat Features: estuarine

  • National Wildlife Federation, 1996-2002. "Chinook Salmon" (On-line). Accessed October 21, 2002 at http://www.nwf.org/keepthewildalive/salmon.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Migrate from natal rivers to the sea as fry where they may occupy depths of 200 m, return upriver to spawn.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 186 specimens in 1 taxon.
Water temperature and chemistry ranges based on 47 samples.

Environmental ranges
  Depth range (m): 0.055 - 268
  Temperature range (°C): 1.708 - 14.897
  Nitrate (umol/L): 1.787 - 27.924
  Salinity (PPS): 32.706 - 35.017
  Oxygen (ml/l): 2.801 - 8.585
  Phosphate (umol/l): 0.304 - 2.300
  Silicate (umol/l): 2.592 - 43.395

Graphical representation

Depth range (m): 0.055 - 268

Temperature range (°C): 1.708 - 14.897

Nitrate (umol/L): 1.787 - 27.924

Salinity (PPS): 32.706 - 35.017

Oxygen (ml/l): 2.801 - 8.585

Phosphate (umol/l): 0.304 - 2.300

Silicate (umol/l): 2.592 - 43.395
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Chinook salmon generally spend most (often 2-4 years but up to 6 years) of their lives in the ocean. For spawning, they migrate up to several hundred kilometers upstream to their natal stream, where eggs are deposited in gravel bottoms of large streams and rivers.

Populations may differ dramatically in the timing of adult migration and, to a lesser extent, timing of spawning. There are two basic behavioral forms, stream-type and ocean-type. Stream-type chinook are typical of northern populations (i.e., Alaska and northern B.C.) and headwater (high elevation) tributaries of southern populations. These spend one full year as juveniles rearing in fresh water before migrating to sea, perform extensive offshore oceanic migrations, and typically return to their natal river in spring or summer, several months prior to spawning; occasionally males mature without ever going to sea. The ocean-type is typical of populations on the North American coast south of 56 degrees north latitude; these migrate to sea during their first year of life (normally within 3 months of emerging from spawning gravel), spend most of their ocean life in coastal waters, then return to their natal river in fall, a few weeks before spawning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 375 m (Ref. 58426)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Introduction

This species has been introduced or released in Dutch waters.
  • Nijssen, H.; de Groot, S.J. (1987). De vissen van Nederland: systematische indeling, historisch overzicht, het ontstaan van de viskweek, uitheemse vissoorten, determineersleutels, beschrijvingen, afbeeldingen, literatuur, van alle in Nederlandse wateren voor komende zee- en zoetwatervissoorten [Fishes of the Netherlands: systematic classification, historical overview, origins of fish culture, non-indigenous species, determination keys, descriptions, drawings, literature references on all marine and freshwater fish species living in Dutch waters]. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-006-1. 224 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=73 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Anadromous; migrates up to several hundred km upstream to the stream in which they were spawned. Different races differ in the timing of adult migration and spawning. Oregon coastal chinook stocks vary in ocean migration; some stocks migrate north, some migrate south, and one stock has a mixed north and south migration (see Nehlsen et al. 1991). There are two basic behavioral forms, stream-type and ocean-type (see Salo 1991). Stream-type chinnok is typical of Asian populations and of northern populations and headwater tributaries of southern populations in North America; spends one or more years as fry or parr in fresh water before migrating to sea, performs extensive offshore oceanic migrations, returns to natal river in spring or summer, several months prior to spawning; occasionally males mature without ever going to sea. Ocean-type is typical of populations on the North American coast south of 56 degrees north latitude; migrates to sea during first year of life (normally within 3 months of emerging from spawning gravel), spends most of ocean life in coastal waters, return to natal river in fall, a few days or weeks before spawning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

While in freshwater, Chinook Salmon fry and smolts feed on plankton and then terrestrial and aquatic insects, amphipods and crustaceans. After migrating to the ocean, the maturing adults feed on large zooplakton, herring, pilchard, sandlance and other fishes, squid, and crustaceans. Once the adult salmon have re-entered freshwater, they do not feed. In the Great Lakes, Chinook Salmon were introduced to control the invasive alewife population (National Wildlife Federation, 2002; Delaney and ADFG, 1994; Government of Canada, 2002).

Animal Foods: fish; insects; mollusks; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods, Molluscivore ); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults return to natal streams from the sea to spawn (Ref. 27547). Fry may migrate to the sea after only 3 months in fresh water, some may stay for as long as 3 years, but generally most stay a year in the stream before migrating (Ref. 27547). Some individuals remain close inshore throughout their lives, but some make extensive migrations (Ref. 27547, 44894). Also found in lakes (Ref. 1998). Possibly up to 375 m depth (Ref. 6793). Epipelagic (Ref. 58426). Food in streams is mainly terrestrial insects and small crustaceans; in the sea, major food items include fishes, crustaceans, crabs and other invertebrates (Ref. 9137, 27547). Young are preyed upon by fishes and birds (such as mergansers and kingfishers); adults are prey of large mammals and large birds (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In fresh water juveniles feed opportunistically on terrestrial and aquatic insects. In salt water they eat crustaceans as well as other bottom invertebrates. Adults eat mostly fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Spawning Chinook Salmon are the keystone species in many streams because so many other species rely on them for food. In the ocean, they are often one of the top predators. Chinook Salmon are now the top predator in the Great Lakes where they were introduced to control other non-native fish species (University of Wisconsin Sea Grant Institute, 2002).

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

For young Chinook Salmon, predation is very high. Many species eat the fry and smolts, including striped bass, American shad, sculpins and sea gulls. Reaching adulthood does not release them from predation, however, as they are still prey to many animals when they return to spawn. Most common are bears, orcas, sea lions, seals, otters, eagles, terns and cormorants. People have made predation worse by concentrating adult salmon at dams and weirs (Pacific States Marine Fisheries Commission, 1996; National Wildlife Federation, 2002; NOAA, 2001; University of California at Berkeley).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Oncorhynchus tshawytscha preys on:
non-insect arthropods
Actinopterygii
zooplankton
Mollusca
Crustacea
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Edwardsiellosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aeromonosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

External fertilization in Chinook Salmon requires precise communication in order to ensure proper timing of gamete release. During the courtship, which can last up to several hours, the male vibrates and crosses in front of the female, while the female is preparing for spawning by digging the redd. The female has been shown to selectively choose larger males, who vibrate more. A few seconds before depositing her eggs, the female will shake quickly next to the male, inducing sperm release (Berejikian, Tezak, and LaRae, 2001).

Other Communication Modes: vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The female digs a nest (called a redd) in the gravel and then deposits her eggs and the male deposits sperm. After 90-150 days (depending on temperature) the eggs hatch, and the alevins (fry with yolksacs attached to the underside) stay in the gravel until the yolksac is used up. The fry then emerge from the gravel in the spring and feed and grow for a few months to two years, depending on the stream system. They then migrate downstream as smolts, following the natural current. The smolts undergo huge physiological changes in their transition from freshwater to salt water. They then spend the next 1-7 years growing and maturing at sea. Growth rates in the ocean are much faster, and perhaps as much as 99% of the somatic growth occurs as sea. Mature adults will then return to their natal streams to spawn. Once the adults have re-entered freshwater, they no longer feed, and they complete sexual maturation during the freshwater migration (Pacific States Marine Fisheries Commission, 1996; National Wildlife Federation, 2002; NOAA, 2001; Delaney and ADFG, 1994; University of California at Berkeley; Government of Canada, 2002; Ewing and Ewing, 2002; Satterfield and Finney, 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Adults migrate up to 4,827 km upstream to spawn (Ref. 6850). Migration from the sea begins in December so that the the first fish are near river mouths by spring (Ref. 27547). Once a female selects a spot, she begins to dig a nest, driving away other females during the period of nest building. The female is attended by a larger, dominant male and several smaller males who drive away other males. While the female digs the nest, the male courts her by coming to rest beside her and quivering; by swimming about over her, touching her dorsal fin with his body and fins; and occasionally nudging her side gently with his snout (Ref. 28978). Upon completion of the nest, the female drops into it and is immediately joined by the dominant male. The fish open their mouths, vibrate, and eggs and sperm are released. At this point smaller males may dart into the nest and release sperm. The female then quickly moves to the upstrem edge of the nest and begins to dig. The eggs are covered and a new nest is made. The whole process is repeated until the female releases all her eggs, which may take several days. The male then leaves the female and may mate with another female. The female guards the nest for as long as she can. Spent adults usually die a few days after spawning. (Ref. 1998, 27547).Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average age of spawning adults is 4-6 years, however, they can spend up to 8 years in the ocean or return after less than one year. The average age is slightly younger in the south with 2/3/4 year-olds most common; 5/6/7 year-olds are most common in the north. Often, females are older than males at sexual maturity. There is high mortality early because of high natural predation, and those smolts that do not reach a certain size before their first winter at sea will not survive colder temperatures. Human modification of the environment has led to even higher mortality, mainly due to siltation and decreased water flow which have reduced the availability of oxygen to the eggs and fry (Pacific States Marine Fisheries Commission, 1996; Delaney and ADFG, 1994; Government of Canada, 2002).

Range lifespan

Status: wild:
8 (high) years.

Average lifespan

Status: wild:
3-4 years.

Average lifespan

Status: wild:
9.0 years.

Average lifespan

Status: wild:
2.5 years.

Average lifespan

Status: wild:
5.0 years.

Average lifespan

Status: wild:
7.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild) Observations: As in other species of salmon, these animals normally age and die shortly after spawning. It is not considered ageing but rather sudden death. Although normally semelparous, the chinook salmon has alternative iteroparous life histories. Male jacks and parr mature early and parr can survive reproduction and mate again (Unwin et al. 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The Chinook Salmon have seasonal runs in which all adults return to their natal streams and spawn at approximately the same time of year. Sexual maturity can be anywhere from 2-7 years, so within any given run, size will vary considerably. Salmon are semalparous, and shortly after spawning they die.

After migrating back to the exact place of birth, with very little straying, the adults span in the course gravel of the river. The female first digs a redd in the gravel with an undulating motion of her tail, while the male stands guard. The female then deposits her eggs (3000-14000) in the nest, sometimes in 4-5 different packets within a single redd. The male then deposits his sperm, and both parents guard the redd until they die, sometime within the next 25 days. Spawning is timed so that the fry will emerge in the spring, the time where the stream has the highest productivity.

Many streams have more than one run, with each run going to a slightly different location in the stream. In each location, different environmental factors will affect the timing of the run, all timed so the fry emerge in the spring. For example, in a stream with spring and summer runs, often the spring run will go to higher elevation and with the colder temperature, the eggs will take longer to hatch (Pacific States Marine Fisheries Commission, 1996; National Wildlife Federation, 2002; Matthews and Waples, 1991; NOAA, 2001; Delaney and ADFG, 1994; Government of Canada, 2002).

Breeding season: Spawning season varies, but the most common runs are in the summer and fall with some streams having runs in the spring and winter as well.

Range number of offspring: 3000 to 14000.

Range time to hatching: 90 to 150 days.

Range age at sexual or reproductive maturity (female): 1 to 8 years.

Average age at sexual or reproductive maturity (female): 0.75 years.

Range age at sexual or reproductive maturity (male): 1 to 8 years.

Average age at sexual or reproductive maturity (male): 0.75 years.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

There is no parental care in Chinook Salmon, as both parents die before the young emerge. However, the decomposing adult carcasses provide necessary nutrients to the eggs and fry.

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Overall, chinook salmon generally spawn at 2-7 years of age (typically 3-5) in fall, depending on the population. A small proportion of males (called jacks) mature after only spending about 6 months or 18 months at sea, and still others mature without having migrated to sea at all. Eggs hatch in about 2-3 months and alevins complete development in another 1-2 months (depending on temperature, hence related to latitude and elevation). Juveniles stay in fresh water for a few days or 1 year (rarely more). Adults die soon after spawning. Several distinct spawning populations may occur in one stream; these may differ in duration of juvenile rearing, size and date of ocean entrance, timing of adult return and spawning, age composition of spawners, fecundity, and egg size (see Nehlsen et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus tshawytscha

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 233 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0207-06|AF392054|Oncorhynchus tshawytscha| ACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTT---AGTCTACTGATTCGGGCAGAACTAAGCCAGCCGGGCGCTCTTCTAGGGGAT---GACCAGATCTATAACGTGATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTTATGCCGATTATGATCGGAGGCTTTGGAAACTGATTAATTCCCCTAATG---ATCGGGGCCCCTGATATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCACCATCCTTTCTCCTCCTCCTATCTTCCTCTGGAGTTGAAGCCGGAGCTGGCACCGGGTGAACAGTCTACCCCCCTCTGGCCGGCAACCTAGCCCACGCAGGAGCCTCAGTTGATCTG---ACGATCTTCTCCCTTCATTTAGCCGGGATCTCCTCAATTTTAGGAGCCATTAATTTTATTACTACCATTATTAACATAAAACCCCCGGCTATCTCTCAGTACCAAACCCCACTTTTTGTTTGAGCTGTACTAGTTACTGCTGTCCTTCTACTACTCTCCCTCCCCGTTCTGGCAGCA---GGCATTACTATGTTACTCACGGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCAATTTTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATTCTTATCCTCCCAGGCTTTGGTATAATTTCACATATCGTTGCATACTACTCCGGTAAAAAA---GAACCATTTGGGTACATGGGAATAGTCTGAGCTATGATAGCCATCGGATTGTTAGGATTTATCGTATGAGCCCACCATATGTTCACTGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus tshawytscha

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 231
Species: 245
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

The Chinook Salmon has 17 distinct Evolutionarily Significant Units, (ESU) in the US only, two of which are endangered and seven of which are threatened.

ENDANGERED:

Sacramento River Winter Run,

Upper Columbia River Spring Run

THREATENED:

Snake River Fall Run,

Snake River Spring/Summer Run,

Central Valley Spring Run,

California Coastal,

Puget Sound,

Lower Columbia,

Upper Willamette,

CANDIDATE:

Central Valley Fall Run

NOT WARRANTED:

S. Oregon/N. California Coastal,

Upper Klamath Trinity,

Oregon Coastal,

Washington Coastal,

Mid Columbia Spring Run,

Upper Columbia Summer/Fall Run,

Deschules Summer/Fall Run

Many agencies have been set up to protect this species, including the Pacific Fisheries Management Council, the North Pacific Fisheries Management Council, and the National Marine Fisheries Service. The federal Magnuson-Stevens Act was made to protect the Essential Fish Habitat, the waters and substrates necessary to fish for spawning, breeding, feeding and growing to maturity. The Sustainable Fisheries Act has amended the Magnuson-Stevens Act.

The main causes for the declining fish populations are overfishing, damming and diverting water, habitat destruction, and introducing hatchery populations. Overfishing has decreased population sizes enough that all other causes, along with natural predation, can have extreme effects, and population sizes decrease rapidly. Damming causes decline because it blocks adults from returning to their birthplace and because smolts often get sucked into the turbines of hydroelectric dams and are killed. Diverting water away from salmon streams causes water temperature to rise, reducing the oxygen carrying capacity of the water. Temperatures could also become fatally high in the summer. Reduced water levels could expose eggs in the winter, or flows could be too low to carry smolts out to sea. Habitat destruction, including logging, clearing rivers, pollution, and wetlands destruction, take away shade and necessary protection for juveniles. After logging has changed runoff patterns, streams may contain too much silt and become uninhabitable. Pollution can cause many physiological problems, including increased susceptibiity to pathogens. Introducing hatchery populations adds to the decline because the introduced populations interbreed with the native populations and can reduce resistence to disease (Pacific States Marine Fisheries Commission, 1996; National Wildlife Federation, 2002; NOAA, 2001; University of Wisconsin Sea Grant Institute, 2002; Arkoosh and Collier, 2002).

US Federal List: endangered

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Still widespread and locally numerous in large range in the North Pacific Ocean and associated streams; many stocks have been extirpated and many others have declined; habitat has been degraded by logging and other activities, and dams have impeded movements; releases of hatchery stock probably have masked declines/extirpations of some native stocks; see separate files for various chinook salmon populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 04/06/1990
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Sacramento River winter-run ESU

Status: Endangered
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Upper Columbia spring-run ESU

Status: Threatened
Date Listed: 12/29/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: CA coastal

Status: Threatened
Date Listed: 04/22/1992
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Snake River fall-run ESU

Status: Threatened
Date Listed: 12/29/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Central Valley spring-run ESU

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Upper Willamette River ESU

Status: Threatened
Date Listed: 04/22/1992
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Snake River spring/summer-run ESU

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Puget Sound ESU

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Lower Columbia River ESU


Population detail:

Population location: Sacramento River winter-run ESUU.S.A. (CA), including all naturally spawned populations of winter-run Chinook salmon in the Sacramento River and its tributaries in California, as well as two artificial propagation programs: See 224.101(a)
Listing status: E

Population location: U.S.A.(CA) from Redwood Creek south to Russian R., inclusive, all naturally spawned populations in mainstems and tributaries
Listing status: T

Population location: Snake River fall-run ESUU.S.A. (ID, OR, WA), including all naturally spawned populations of fallrun Chinook salmon in the mainstem Snake River below Hells Canyon Dam, and in the Tucannon River, Grande Ronde River, Imnaha River, Salmon River, and Clearwater River, as well as four artificial propagation programs: See 223.102.
Listing status: T

Population location: Lower Columbia River ESUU.S.A. (OR, WA), including all naturally spawned populations of Chinook salmon from the Columbia River and its tributaries from its mouth at the Pacific Ocean upstream to a transitional point between Washington and Oregon east of the Hood River and the White Salmon River, and includes the Willamette River to Willamette Falls, Oregon, exclusive of spring-run Chinook salmon in the Clackamas River, as well as 17 artificial propagation programs: See 223.102
Listing status: T

Population location: Upper Willamette River ESUU.S.A. (OR), including all naturally spawned populations of spring-run Chinook salmon in the Clackamas River and in the Willamette River, and its tributaries, above Willamette Falls, Oregon, as well as seven artificial propagation programs: See 223.102.
Listing status: T

Population location: Puget Sound ESUU.S.A. (WA), including all naturally spawned populations of Chinook salmon from rivers and streams flowing into Puget Sound including the Straits of Juan De Fuca from the Elwha River, eastward, including rivers and streams flowing into Hood Canal, South Sound, North Sound and the Strait of Georgia in Washington, as well as 26 artificial propagation programs: See 223.102
Listing status: T

Population location: Upper Columbia spring-run ESU U.S.A. (WA), including all naturally spawned populations of Chinook salmon in all river reaches accessible to Chinook salmon in Columbia River tributaries upstream of the Rock Island Dam and downstream of Chief Joseph Dam in Washington (excluding the Okanogan River), the Columbia River from a straight line connecting the west end of the Clatsop jetty (south jetty, Oregon side) and the west end of the Peacock jetty (north jetty, Washington side) upstream to Chief Joseph Dam in Washington, as well as six artificial propagation programs: See 224.101(a).
Listing status: E

Population location: Snake River spring/summer-run ESUU.S.A. (ID, OR, WA), including all naturally spawned populations of spring/summer-run Chinook salmon in the mainstem Snake River and the Tucannon River, Grande Ronde River, Imnaha River, and Salmon River subbasins, as well as 15 artificial propagation programs: See 223.102.
Listing status: T

Population location: Central Valley spring-run ESUU.S.A. (CA), including all naturally spawned populations of spring-run Chinook salmon in the Sacramento River and its tributaries in California, including the Feather River, as well as the Feather River Hatchery springrun Chinook program
Listing status: T

For most current information and documents related to the conservation status and management of Oncorhynchus tshawytscha, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: At least 50 stocks have been extipated; see Nehlsen et al. (1991) for a review of the status of various at-risk/special concern populations from California, the Oregon coast, the Columbia River basin, and Puget Sound. Of 866 stocks in British Columbia and Yukon, Slaney et al. (1996) categorized 17 as extirpated, 47 as high risk, 6 as moderate risk, 7 as special concern, 330 as unthreatened, and 459 as unknown status. Regarding spring runs outside the Sacramento-San Joaquin population: the run in Salmon River drainage (North and South forks, and Wooley Creek, California) apparently was stable at 1000-1500 adults in the 1980s; the flood of 1964 reduced available habitat for population in the South Fork of the Trinity River, and the population there now is much smaller than previously; most individuals in the Klamath-Trinity drainage are derived from hatchery stock. Ratner et al. (1997) conducted a population viability analysis of spring chinook salmon in the South Umpqua River, Oregon (this is part of the Oregon Coast ESU) and found a 95% probability of persistence of 200 years with no further habitat destruction; with continued habitat destruction, the population was projected to be almost certainly extirpated within 100 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Initial cause of decline was adverse effects of logging, mining, irrigation withdrawals, and overfishing, then construction of hydroelectric dams blocked migrations and resulted in high mortality of smolts in turbines (Nehlsen et al. 1991, Williams et al. 1992). Spawning runs continue to be threatened by construction of dams and degradation of natural environment. (Two dams on the Elwha River (Olympic Peninsula, Washington), which have blocked salmon runs for many decades, soon may be removed [Williams et al. 1992].) Extinctions or large declines of some local native populations in recent decades may have been masked by releases of non-native hatchery stock (Williams et al. 1992).

Juveniles incur high mortality as they migrate through today's river systems and out to sea. Sources of mortality include hydroelectric turbines, mechanical bypass facilities (including transporation by barge or truck), and predation by non-native fishes. Gas bubble trauma (GBT)associated with total dissolved gas supersaturation (TDGS) at spillways also causes mortality and detrimental sublethal effects, but passage of juveniles through spillways may be the least damaging of the routes for juvenile passage at dams (Backman et al. 2002). In the Columbia River basin, adults were rarely observed with GBT, despite high TDGS levels (Backman and Evans 2002).

Concurrent with the construction of fish hatcheries, bacterial kidney disease became prevalent and may now play a significant role in mortality.

A change in climate, beginning around 1977, led to poor ocean survival.

See also threats comments for individual populations (ESUs).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: See Nehlsen et al. (1991) for general management recommendations for anadromous salmonids.

Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

See Thomas et al. (1993) for information on habitat management for this and other at-risk fish species in the Pacific Northwest. Utter et al. (1989) recommended a conservative policy for stock transfers, based on distinct genetic differences among populations in different areas. See recovery plan for Sacramento-San Joaquin Delta native fishes (USFWS 1995).

Limiting flow fluctuations at all discharges below Priest Rapids Dam (Columbia River) would further protect subyearling fall chinook salmon (Tiffan et al. 2002). This would enhance production of invertebrate prey and reduce the stranding salmon on dewatered substrate or in disconnected pools.

Yearlings migrating downstream experience higher survival when spill is used specifically to pass fishes through nonturbine routes past hydroelectric dams (Muir et al. 2001).

Management Programs: The economically valuable Klamath River fall chinook population is managed by the Pacific Fishery Management Council under advice given by the Klamath Fishery Management Council.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Meffe (1992) gave reasons why the hatchery approach to recovery ultimately will fail, and he emphasized that overharvest and habitat destruction need to be addressed in a major landscape-level effort. See Nehlsen et al. (1991) for general protection recommendations for anadromous salmonids. See recovery plan for Sacramento-San Joaquin Delta native fishes (USFWS 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The Chinook Salmon is very important to commercial, recreational, and subsistence fishermen. It has always been central to the Native American lifestyle on the Pacific coast, and now much of the economy of the Pacific Northwest is based on it. Despite being relatively rare (compared to other Pacific Salmon species) it is the most commercially valuable. It is also now an important big game fish in the Great Lakes and is a big tourist draw in both the Pacific and Great Lakes regions

(Pacific States Marine Fisheries Commission, 1996; National Wildlife Federation, 2002; Delaney and ADFG, 1994; University of Wisconsin Sea Grant Institute, 2002).

Positive Impacts: food ; ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Important both as a commercial and sport fish (Healey 1991). This species made up the majority of the Columbia River harvest in the late 1800s. The largest commercial catches have been along the coast of British Columbia, with sizable catches also south to California and north to Alaska. The fall run in the California portion of the Klamath River supports important ocean and river fisheries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chinook salmon

The Chinook salmon, Oncorhynchus tshawytscha, is the largest species in the pacific (Oncorhynchus) salmon family. Other commonly used names for the species include king salmon, Quinnat salmon, spring salmon and Tyee salmon. Chinook are an anadromous fish native to the north Pacific Ocean and the river systems of western North America ranging from California to Alaska. They are also native to Asian rivers ranging from northern Japan to the Palyavaam River in the Siberian far east, although only the Kamchatka Peninsula supports relatively persistent native populations. They have been introduced to other parts of the world, including New Zealand and the Great Lakes. A large Chinook is a prized and sought-after catch for a sporting angler. The flesh of the salmon is also highly valued for its dietary nutritional content, which includes high levels of important omega-3 fatty acids.

Contents

Physical description

The Chinook is blue-green,red or purple on the back and top of the head with silvery sides and white ventral surfaces. It has black spots on its tail and the upper half of its body. Its mouth is often dark purple. Adult fish range in size from 33 to 36 in (840 to 910 mm) but may be up to 58 inches (1,500 mm) in length; they average 10 to 50 pounds (4.5 to 23 kg), but may reach 130 pounds (59 kg). The current sport-caught world record, 97.25 pounds (44.11 kg), was caught on May 17, 1985 in the Kenai River (Kenai Peninsula, Alaska). Some were found dead at well over 100 lb. The commercial catch world record is 126 pounds (57 kg) caught near Rivers Inlet British Columbia in the late 1970s.[1]x

Life cycle

Chinook salmon may spend one to eight years in the ocean (averaging from three to four years)[2] before returning to their home rivers to spawn. Chinook spawn in larger and deeper waters than other salmon species and can be found on the spawning redds (nests) from September through to December. After laying eggs, females guard the redd from four to 25 days before dying, while males seek additional mates. Chinook salmon eggs hatch, depending upon water temperature, 90 to 150 days after deposition. Egg deposits are timed to ensure the young salmon fry emerge during an appropriate season for survival and growth. Fry and parr (young fish) usually stay in freshwater 12 to 18 months before traveling downstream to estuaries, where they remain as smolts for several months. Some chinooks return to the fresh water one or two years earlier than their counterparts, and are referred to as "jack" salmon. "Jack" salmon can be half the size of an adult chinook salmon, and are usually released by sportsmen but kept by commercial fishermen.[2]

The Yukon River has the longest freshwater migration route of any salmon, over 3,000 kilometres (1,900 mi) from its mouth in the Bering Sea to spawning grounds upstream of Whitehorse, Yukon. Since Chinook rely on fat reserves for energy upon entering fresh water, commercial fish caught here are highly prized for their unusually high levels of heart-healthy omega-3 fatty acids. However, the high cost of harvest and transport from this exceptionally rural area limits its affordability.

First, salmon need to be able to have these kinds of foods: planktonic diatoms, copepods, kelps, seaweeds, jellyfish, and starfish. As with all salmonid species, they feed on insects, amphipods, and other crustaceans while young, and primarily on other fish when older. Young salmon feed in streambeds for a short period until they are strong enough to journey out into the ocean and acquire more food. Chinook juveniles divide into two types: ocean type and stream type. Ocean-type chinook migrate to saltwater in their first year. Stream-type salmon spend one full year in fresh water before migrating to the ocean. After a few years in the ocean, adult salmon, then large enough to escape most predators, return to their original streambeds to mate. Chinook salmon can have extended lifespans, where some fish spend one to five years in the ocean, reaching age eight. More northerly populations tend to have longer lives.

Second, salmon need adequate spawning habitat. Clean, cool, oxygenated, sediment-free fresh water is essential for egg development. Chinook prefer larger sediment sizes for spawning than other Pacific salmon. Riparian vegetation and woody debris help juvenile salmon by providing cover and maintaining low water temperatures.

Third, chinook need healthy ocean habitats. Juvenile salmon grow in clean, productive estuarine environments and gain the energy for migration. Later, they change physiologically to live in saltwater. They rely on eelgrass and other seaweeds for camouflage (protection from predators), shelter, and foraging habitat as they make their way to the open ocean. Adult fish need a rich, open ocean habitat to acquire the strength needed to travel back upstream, escape predators, and reproduce before dying. In his book King of Fish, David Montgomery writes, "The reserves of fish at sea are important to restocking rivers disturbed by natural catastrophes." Thus, it is vitally important that fish are able to reach the oceans (without manmade obstructions such as dams), so they can grow into healthy adult fish that sustain the species.

Fourth, it is important that the bodies of water are clean and oxygenated. One sign of high productivity/growth rate in the oceans are the levels of algae. Increased algal levels lead to higher levels of carbon dioxide in the water which transfers into living organisms, fostering underwater plants and small organisms, which salmon eat.[3] Algae can filter high levels of toxins and pollutants. Thus, it is essential for algae and other water-filtering agents to not be destroyed in the oceans because they contribute to the well-being of the food chain.

Finally, salmon need other salmon to survive so they can reproduce and pass on their genes in the wild. With some populations endangered, precautions are necessary to prevent overfishing and habitat destruction, including appropriate management of hydroelectric and irrigation projects. If too few fish remain because of fishing and land management practices, salmon have more difficulty reproducing.

When one of these five factors is compromised, affected stock can decline. One Seattle Times article states, "Pacific salmon have disappeared from 40 percent of their historic range outside Alaska," and concludes it is imperative for people to realize the needs of salmon and to try not to contribute to destructive practices that harm salmon runs.[4]

In the Pacific Northwest, the especially large summer runs of Chinook that were once common (before dams and overfishing lead to declines) were known as June hogs.

Distribution

Historically, the native distribution of Chinook salmon ranged from as far south as the Ventura River in California and north to Alaska, as far as Kotzebue Sound. In Asia and the western Pacific, they are consistently present only in Kamchatka. Elsewhere distribution is patchy, but occurs from northern Japan in the south and north into the Arctic Ocean as far as the East Siberian Sea and Palyavaam River.[5] Their populations have disappeared from large areas where they used to flourish,[6] shrinking by as much as 40 percent.[4] In North America their inland range has been cut off, mainly by dams and habitat alterations, from Southern California, some areas east of the Coast Ranges of California and Oregon, and large areas in the Snake River and upper Columbia River drainage basins.[5] Their distribution and presence in Russia is not fully known outside Kamchatka. They have a patchy presence in the Anadyr River basin and parts of the Chukchi Peninsula. In parts of northern Magadan Oblast near the Shelikhov Gulf and Penzhina Bay there might be persistent populations, but stocks there are poorly studied.[5]

In 1967, the Michigan Department of Natural Resources planted chinook in Lake Michigan and Lake Huron to control the alewife, an invasive species of nuisance fish from the Atlantic Ocean. Alewives then constituted 90% of the biota in these lakes. Coho salmon had been planted the year before and the program was a success. Chinook and Coho salmon thrived on the alewives and spawned in the lakes' tributaries. After this success, chinook were planted in the other Great Lakes,[7] where sport fishermen prize them for their aggressive behavior on the hook.

The species has also established itself in Patagonian waters in South America, where escaped hatchery fish have colonized rivers and established stable spawning runs. Chinook salmon have been found spawning in headwater reaches of the Rio Santa Cruz, apparently having migrated over 1,000 kilometres (620 mi) from the ocean. The population is thought to be derived from a single stocking of juvenile chinooks in the lower river around 1930.[8]

Sporadic efforts to introduce the fish to New Zealand waters in the late 1800s were largely failures and lead to no evident establishments. Early ova were imported from the Baird hatchery of the McCloud River in California.[9] Further efforts in the early 1900s were more successful and subsequently lead to the establishment of spawning runs in the rivers of Cantebury and North Otago; Rangitata River, the Opihi River, the Ashburton River, the Rakaia River, the Waimakariri River, the Hurunui River, and the Waiau River.[10] The success of the latter introductions is thought to be partly attributable to the use of ova from Autumn run populations as opposed to ova from Spring run populations used in the first attempts.[9] Whilst other salmon have also been introduced into New Zealand, only Chinook (or Quinnat as it is known locally in NZ) has established sizeable pelagic runs.

Aquaculture

The worlds' largest producer and market supplier of the Chinook salmon is New Zealand. Marketed as King Salmon, in 2009, New Zealand exported 5,088 tonnes of salmon equating to a value of NZ$61 million in export earnings. For the year ended March 2011 this amount had increased to NZ$85 million.,[11][12] New Zealand accounts for approximately half of the global production of Chinook Salmon and approximately half of New Zealand's production is exported. Japan is New Zealand's largest export market with stock also being supplied to other countries of the Pacific rim including Australia.[13]

Farming of the species in New Zealand began in the 1970s where hatcheries were initially set up to enhance and support wild fish stocks with the first commercial operations initiating in 1976.[9] After some opposition against their establishment by societal groups including anglers, the first sea cage farm was established in 1983 at Big Glory Bay in Stewart Island by British Petroleum NZ Ltd.[9][13] Today the salmon are born in land based hatcheries (of which there are several) and transferred to sea cages or fresh water farms where they are grown out to harvestable size of 3 – 4 kg. The broodstock for the farms are usually selected from existing farm stock or sometimes sourced from wild populations. Eggs and milt are stripped manually from sexually mature salmon and incubated under conditions (of approximately 10 – 12˚C) replicating the streams and rivers where the salmon would spawn naturally. After hatching the baby salmon are typically grown to smolt stage (approximately 6 months of age) before they are transferred to the sea cages or ponds.[12] Most sea cage farming occurs in the Marlborough Sounds, Stewart Island and Akaroa Harbour, while fresh water operations in Canterbury, [[|Otago Region|Otago]] and Tasman utilise ponds, raceways and hydro canals for grow out operations.[11] Low stocking densities, ranging between less than 1 kg/m3 up to around 25 kg/m3 (depending on the life stage of the salmon) and the absence of disease in the fish means that New Zealand farmers do not need to use antibiotics or vaccines to maintain the health of their salmon stocks. The salmon are fed food pellets of fish meal specially formulated for Chinook salmon (typical proportions of the feed are: 45% protein, 22% fat, 14% carbohydrate plus ash and water) and contain no steroids or other growth enhancers.[11][12]

Regulations and monitoring programmes ensure salmon are farmed in a sustainable manner. Planning and approval process for new salmon farms in New Zealand considers the farm’s potential environmental effects, its effects on fishing activities (if it is a marine farm), and any possible cultural and social effects. In the interest of fish welfare a number of New Zealand salmon farming operations anaesthetise salmon before slaughter using Aqui-S™. This is an organically based anaesthetic developed in New Zealand that is safe for use in food and which has been favourably reported on by the British Humane Slaughter Association. In recognition of the sustainable, environmentally conscious practices, the New Zealand salmon farming industry has been acknowledged as the world's greenest by the Global Aquaculture Performance Index.[14]

Globally, Chile is the only country other than New Zealand to produce any significant quantities of farmed Chinook salmon.[citation needed] New Zealand will likely remain the major producer of the species as other countries' (predominantly Norway, Canada and the United Kingdom) salmon productions are focused typically on other species such as Atlantic Salmon and Coho Salmon.[citation needed]

Management

Nine populations of chinook salmon are listed under the U.S. Endangered Species Act as either threatened or endangered.[15] Fisheries in the U.S. and Canada are limited by impacts to weak and endangered salmon runs. The fall and late-fall runs in the Central Valley population in California is a U.S. National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act.

In April 2008 commercial fisheries in both Oregon and California were closed due to the extremely low population of chinook salmon present. The low population is being blamed on the collapse the Sacramento River run, one of the biggest south of the Columbia.[16] In April 2009 California again canceled the season.[17] The Pacific Fishery Management Council’s goal for the Sacramento River run is an escapement total (fish that return to freshwater spawn areas and hatcheries) of 122,000–180,000 fish. The 2007 escapement was estimated at 88,000 and the 2008 estimate was 66,000 fish.[18] Scientists from Universities and Federal, State, and Tribal Agencies concluded that the 2004 and 2005 broods were harmed by poor ocean conditions in 2005 and 2006, in addition to “a long-term, steady degradation of the freshwater and estuarine environment.” Such conditions included weak upwelling, warm sea surface temperatures, and low densities of food.[18]

In Oregon, the 2010 Spring Chinook run is forecast to increase by up to 150% over 2009 populations, growing from 200,000 to over 500,000, making this the largest run in recorded history. Lower temperatures in 2008 North Pacific waters brought in fatter plankton which, along with greater outflows of Columbia River water, feeding the resurgent populations. The Oregon Department of Fish and Wildlife estimates that 80% of them are hatchery-born. Chinook runs in other habitats have not recovered proportionately.[19]

Cultural aspects

The chinook salmon is spiritually and culturally prized among certain Native American tribes. Many celebrate the first spring chinook caught each year with "First Salmon Ceremonies". While salmon fishing is still important economically for many tribal communities, the chinook harvest is typically the most valuable.

Chinook salmon were described and enthusiastically eaten by the Lewis and Clark Expedition. Lewis wrote that, when fresh, they tasted better than any other fish he had ever eaten. They did not particularly like dried or "pounded" salmon.[20] Lewis and Clark knew about Pacific salmon but had never seen one. The Western world had known about Pacific salmon since the late 18th century. Maritime fur traders and explorers like George Vancouver frequently acquired salmon by trade with the indigenous people of the Northwest coast.[21] Lewis and Clark first encountered Chinook salmon as a gift from Chief Cameahwait, on August 13, 1805, near Lemhi Pass. Tasting it convinced Lewis that they had crossed the continental divide.[22]

Known as the "king salmon" in Alaska for its large size and flavorful flesh, the chinook is the state fish.

See also

References

  1. ^ Scott and Crossman. 1985. Freshwater Fishes of Canada. Fisheries Research Board of Canada. page 175. ISBN 0-660-10239-0
  2. ^ a b "CHINOOK SALMON FACTS". Pacific States Marine Fisheries Commission. 2010-03-05. http://www.psmfc.org/habitat/edu_chinook_facts.html. Retrieved 2010-03-05. "1996-12-16" 
  3. ^ Klinger, Terrie. Lecture. 15 April 2005. What Defines the Pacific Northwest Marine Realm Ecologically and Geographically? University of Washington; Seattle, WA.
  4. ^ a b Cameron, Mindy (2002-08-18). "Salmon Return; A Public Conversation About the Future of a Northwest Icon". The Seattle Times (Seattle, Washington: The Seattle Times). 
  5. ^ a b c Augerot, Xanthippe; Foley, Dana Nadel (2005). Atlas of Pacific salmon: the first map-based status assessment of salmon in the North Pacific. University of California Press. pp. 80–83. ISBN 978-0-520-24504-4. 
  6. ^ "Salmon: Background". Pacific Fishery Management Council. http://www.pcouncil.org/salmon/background/. Retrieved 2010-03-05. 
  7. ^ Spring, Barbara. The Dynamic Great Lakes,(p. 48) ISBN 1-58851-731-4, Independence Books, 2001
  8. ^ Williams, Richard Nicholas (2006). Return to the river: restoring salmon to the Columbia River. Academic Press. p. 187. ISBN 978-0-12-088414-8. http://books.google.com/books?id=7sYDrB4qH0QC&pg=PA187. Retrieved 19 October 2011. 
  9. ^ a b c d McDowell, R.M. (1994) Gamekeepers for the Nation. Chapter 18. Canterbuty University Press: Christchurch.
  10. ^ McDowall, R. M. (1994). The origins of New Zealand's chinook salmon, Oncorhynchus tshawytscha. Marine Fisheries Review, 1/1/1994.
  11. ^ a b c "Aquaculture New Zealand Industry Overview". http://aquaculture.org.nz/industry/overview/. Retrieved September 20, 2011. 
  12. ^ a b c "AQUACULTURE.GOVT.NZ/Industry development". http://www.aquaculture.govt.nz/industry_development.php. Retrieved September 26, 2011. 
  13. ^ a b "The NZ Salmon Farmer's Association Inc.". The association of the New Zealand Salmon farming industry. http://www.salmon.org.nz/aboutsalmon.shtml. Retrieved September 20, 2011. 
  14. ^ "Global Aquaculture Performance Index". Seafood Ecology Research, University of Victoria, Canada. http://web.uvic.ca/~gapi/results/browse/newZealand.html. Retrieved September 20, 2011. 
  15. ^ "Fish Species Protected Under the Endangered Species Act (ESA)". Office of Protected Resources - NOAA Fisheries. 2010-03-05. http://www.nmfs.noaa.gov/pr/species/esa/fish.htm. Retrieved 2010-03-05. 
  16. ^ Blankship, Donna. Salmon Fishing Banned Along U.S. West Coast. National Geographic. http://news.nationalgeographic.com/news/2008/04/080411-AP-disappearin_2.html. April, 2008.
  17. ^ David Gorn. "What's Killing California's Salmon?". NPR. http://www.npr.org/templates/story/story.php?storyId=102997037. 
  18. ^ a b Lindley, S. T.; Grimes, C. B.; Mohr, M. S.; Peterson, W.; Stein, J.; Anderson, J. T.; Botsford, L. W.; Bottom, D. L. et al. (2009), What caused the Sacramento River fall Chinook stock collapse?, Pacific Fisheries Management Council, http://www.pcouncil.org/bb/2009/0409/H2b_WGR_0409.pdf 
  19. ^ Millman, Joel (January 21, 2010). "Fish Boom Makes Splash in Oregon". Wall Street Journal. http://online.wsj.com/article/SB10001424052748703657604575005562712284770.html. Retrieved January 21, 2010. 
  20. ^ Isserman, Maurice (2005). Across America: the Lewis and Clark expedition. Infobase Publishing. pp. 115, 133, 135. ISBN 978-0-8160-5256-1. http://books.google.com/books?id=op0WdlviEecC&pg=PA135. Retrieved 19 October 2011. 
  21. ^ Bruce Alden Cox (1987). Native people, native lands: Canadian Indians, Inuit and Métis. McGill-Queen's Press - MQUP. p. 174. ISBN 978-0-88629-062-7. http://books.google.com/books?id=8ZTBawkiwBgC&pg=PA174. Retrieved 19 October 2011. 
  22. ^ Elin Woodger; Brandon Toropov (2004). Encyclopedia of the Lewis and Clark Expedition. Infobase Publishing. p. 138. ISBN 978-0-8160-4781-9. http://books.google.com/books?id=8vYA0zDFy_IC&pg=PA138. Retrieved 19 October 2011. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Utter et al. (1989) for information on genetic differences among populations in the Pacific Northwest. In the Nanaimo River, British Columbia, within-stock variation in age of seaward migration of juveniles is a genetic adaptation to local rearing environments; fishes with different life histories had biochemical and morphological differences that were linked to increased fitness in different rearing habitats (see Nehlsen et al. 1991). Waples and Teel (1990) found substantial allele frequency changes over 2-4 years in hatchery, but not wild, populations along the Pacific coast of Oregon.

Has hybridized with pink salmon in the St. Marys River, Michigan (Rosenfield 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!