Overview

Comprehensive Description

Biology

Epipelagic (Ref. 58426). There are two forms, the anadromous form known as the sockeye and the landlocked form (with a much smaller maximum size) known as the kokanee (Ref. 27547). Upon emergence from gravel, fry at first tends to avoid light, hiding during the day and emerging at night (Ref. 27547). In some populations, sockeye fry go to the sea during their first summer but most spend one or two (rarely three or four) years in a lake before migrating (Ref. 30333). In a few streams of the Copper River drainage in Alaska, young sockeye stay in the stream (Ref. 27547). Once in the lake, the young spend a few weeks inshore, feeding largely on ostracods, cladocerans and insect larvae. The fish then become pelagic and move offshore, where they feed on plankton in the upper 20 m or so (Ref. 27547). Seaward migration follows with the young individuals first staying fairly close to shore, feeding mainly on zooplankton, but also on small fishes and insects (Ref. 30343, 30346). With growth, they head out to sea and fish become important in the diet (Ref. 27547). Kokanee are confined to lake-stream systems, and most of its life is spent in the lake (Ref. 27547). They feed mainly on plankton, but also take insects and bottom organisms (Ref. 1998). Kokanee, wherever they are native, have been derived from anadromous populations, and each kokanee population apparently has evolved independently from a particular sockeye run (Ref. 30338, 30339). Offspring of kokanee occasionally become anadromous, and sockeye offspring occasionally remain in freshwater (Ref. 27547). Lifespan of the kokanee varies from two to seven years in different stocks (Ref. 27547). The sockeye is one of the most commercially important Pacific salmons; the kokanee is primarily a sport fish but also makes excellent food and in some areas well regarded as food for large trout (Ref. 27547). Marketed fresh, dried or salted, smoked, canned, and frozen; eaten steamed, fried, broiled, microwaved, and baked (Ref. 9988). The Alaska Salmon fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_485.htm).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The Sockeye or Red Salmon (Oncorhynchus nerka) is native to northeastern Asia and, in North America, Arctic and Pacific drainages from Point Hope, Alaska, to the Sacramento River drainage in California. Landlocked populations are found in Alaska, Yukon Territory, British Columbia, Washington, and Oregon. This species is relatively common in the northern part of its North American range, but rarer south of the Columbia River drainage. Although it has been widely stocked, most transplant attempts have failed to establish populations. (Page and Burr 1991)

At different periods in the life cycle, Sockeye Salmon are found in the open ocean and, typically, in lakes, which they reach by migrating up coastal streams. Landlocked Sockeye Salmon are known as Kokanee. At sea, these fish are metallic blue and silver, but spawning (breeding) adults are very distinctively colored, turning bright red with a green head. Adults reach a size of around 84 cm in length. (Page and Burr 1991).

Approximately the first half of a Sockeye Salmon's four to six year lifespan is spent in freshwater, while the second half is spent foraging in estuarine and marine waters of the Pacific Ocean. Sockeye Salmon migrate upstream to breed just once, then die. For detailed information on the biology and status of this species, including conservation issues, see this resource from the NOAA Fisheries Office of Protected Resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Sockeye salmon, Oncorhynchus nerka, are native to the western coast of North America in the Pacific Ocean. They can be located as far north as northern Alaska and as far south as northern California. During the mating season, Sockeye salmon travel inland as far as mid-west Idaho. Populations of this species have also been introduced in some areas of Asia and Russia.

Biogeographic Regions: nearctic (Native ); palearctic (Introduced ); pacific ocean (Native )

Other Geographic Terms: holarctic

  • Bickham, J., C. Wood, J. Patton. 1995. Biogeographic Implications of Cytochrome b Sequences and Allozymes in Sockeye (Oncorhynchus nerka). Journal of Heredity, 86/2: 140-144.
  • Hasegawa, K., T. Yamamoto, M. Murakami, K. Maekawa. 2004. Comparison of competitive ability between native and introduced salmonids: evidence from pairwise contests. Ichthyological Research, 51/3: 191-194.
  • Quinn, T. 2005. The Bahavior and Ecology of Pacific Salmon and Trout. Canada: University of Washington Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The current distribution of Oncorhynchus nerka extends from approximately 45–70°N to 140°E–125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.

See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 98 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: During oceanic feeding and maturation, this salmon ranges throughout the North Pacific Ocean, Bering Sea, and eastern Sea of Okhotsk north of 40 degrees north latitude; there is considerable intermingling of Asian and North American populations, and of North American populations from Bering Sea and Gulf of Alaska streams; the range shifts southward for winter, northward during warmer months. Natural lake populations occur in Japan, former USSR, Alaska, Washington, Idaho, Oregon, Yukon, and British Columbia. Anadromous forms occur in Asia from Hokkaido, Japan, to the Anadyr River (spawning mainly on the Kamchatka Peninsula); in North America, anadromous populations range from the Sacramento River, California, north to Point Hope, Alaska (common in north, rare south of Columbia River drainage). Major Alaskan spawning areas are in tributaries and lakes of the Kenai, Chignik, Naknet, Kuichak, Wood, and Kodiak Island river systems. South of Alaska in the Pacific Northwest, the major spawning river is the Fraser River system in British Columbia, with smaller runs in the Baker, Columbia, Cedar, Quinalt, and Ozette rivers in Washington. The Fraser River includes a number of important nursery lakes (Cultus, Adams, Harrison, Horsefly, Shuswap, and Quesnel) and many tributaries that support the major portion of the Pacific Northwest population. In eastern Washington, major nursery lakes for Columbia River are Lake Wenathchee and Osoyoos Lake. In western Washington, major nursery lakes are Quinalt Lake, Ozette Lake, Baker Lake, and Lake Washington. In a 1996 survey of populations in the contiguous U.S., one healthy native stock was identified (Wenatchee River, Washington). The kokanee (lake-stream form) has been introduced in many western states and elsewhere, but most transplants have been unsuccessful in establishing self-sustaining populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
North Pacific Basin from U.S.A. (CA) to Russia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: northern Japan to Bering Sea and to Los Angeles, California, USA (Ref. 2850). Landlocked populations in Alaska, Yukon Territory and British Columbia in Canada, and Washington and Oregon in USA.
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

When sockeye salmon hatch, they lack pigment and thus color. As they grow into fry, they become green and can have black spots. Sockeye salmon are typically blue in color until they reach reproductive age, when they brighten in color; their bodies turn read and their heads green. Additional distinctive markings appear on the head of males and sides of females during the spawning period. When ready to reproduce, sockeye salmon weigh 1 to 4 kg and measure on average 63 cm in length. Sockeye salmon are commonly misidentified. The otolith, or inner ear, of this species is distinct in size and shape from other members of the genus g. Oncorhynchus. This, however, is not always exact as there can be overlap among species in addition to intraspecific differences.

Range mass: 1 to 4 kg.

Average length: 63 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful

  • Casteel, R. 1974. Identification of the Species of Pacific Salmon (Genus Oncorhynchus) Native to North America Based upon Otoliths. Copeia, 1974/2: 305-311.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 16; Analspines: 0; Analsoft rays: 13 - 18; Vertebrae: 56 - 67
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 71 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 840 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

84.0 cm TL (male/unsexed; (Ref. 5723)); 71 cm (female); max. published weight: 7,710 g (Ref. 40637); max. reported age: 8 years (Ref. 72462)
  • IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Both the sockeye and the kokanee are distinguished by the long, fine, serrated, closely spaced gill rakers on the first arch that number between 30 and 40, and by its lack of definite spot on the back and tail (Ref. 27547). Body fusiform, streamlined, laterally compressed, body depth moderate, slightly deeper in breeding males (Ref. 6885). Head bluntly pointed, conical, eye rather small, position variable with sex and condition; snout rather pointed (Ref. 6885). Lateral line straight (Ref. 27547). Pelvic fins with axillary process; caudal emarginate (Ref. 27547). Pre-spawning fish are dark steel blue to greenish blue on the head and back, silvery on the sides and white to silvery on the belly; no definite spots on the back, although some individuals may have dark speckling and irregular marks on the dorsal fin (Ref. 27547). At spawning, the head of the males becomes bright to olive green, with black on the snout and upper jaw; the adipose and anal fins turn red and the paired fins and tail generally become grayish to green or dark; females are generally less brilliantly colored than males (Ref. 27547). Various populations may show less brilliant colors, and a few turn dull green to yellowish, with little if any red (Ref. 27547).
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sockeye salmon are born in lakes, rivers, or streams, which are calmer than the Pacific Ocean. After fry, or young salmon, develop, they migrate to the Pacific Ocean where they spend most of their life. They are generally found at depths of 15 to 33 m.

Range depth: 15 to 33 m.

Habitat Regions: temperate ; polar ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

  • Busch, R. 2000. Salmon Country: A History of the Pacific Salmon. Toronto, Ontario: Key Porter Books.
  • Groot, C. 1966. On the Orientation of Young Sockeye Salmon (Oncorhynchus nerka) During Their Seaward Migration Out of Lakes. Behaviour Supplement, 13: 8-13.
  • Quinn, T., B. Terhart, C. Groot. 1989. Animal Behaviour. Migratory orientation and vertical movements of homing adult sockeye salmon, Oncorhynchus nerka, in coastal waters, 37/4: 587-599.
  • Wood, C., C. Foote. 1996. Evidence for Sympatric Genetic Divergence of Anadromous and Nonanadromous Morphs of Sockeye Salmon (Oncorhynchus nerka). Evolution, 50/3: 1265-1267.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The species exhibits a great variety of life history patterns. It has a life history form called “Kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “Sockeye” or “Red Salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some Sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include Salmon Sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type Sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000–5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Nonbreeding adult sockeye salmon are oceanic, with many occurring in nutrient-rich waters of Alaska and the arctic. Kokanee do best in large, cold, mountain lakes (Sigler and Sigler 1987), where the presence of well-oxygenated water is essential (Sublette et al. 1990).. Water temperatures above 60 degrees F (about 15.5 C) lead to significant mortality, especially among the young (see Sublette et al. 1990). Young are not often found in estuarine or inshore waters after reaching the marine environment (Pauley et al. 1989).

Kokanee usually spawn in tributary stream of lake, often in riffle over gravel substrate; sometimes along gravelly shore of lake where seepage outflows, springs, or wind-induced waves occur. Sockeye move up coastal rivers and spawn in streams. Female constructs a redd (several nesting pockets) in gravel (usually) or sand bottom.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 250 m (Ref. 50550)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 122

Graphical representation

Depth range (m): 0 - 122
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Anadromous forms migrate from ocean waters up coastal streams and rivers to spawn in natal waters; spend 1-4 years (usually 2 years) in ocean, 2 years in freshwater; ascend river, spend 1-8 months in lake, then move to natal spawning area. Many non-anadromous populations move from lakes into tributary streams to spawn, some remain in lakes. Enters spawning rivers from late spring to midsummer, depending on the population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

While in the ocean, sockeye salmon primarily consume zooplankton. In freshwater environments, they are known to eat insects, and, when upstream, occasionally snails.

Animal Foods: insects; mollusks; zooplankton

Primary Diet: planktivore

  • Graynoth, E., L. Bennett, J. Pollard. 1986. Diet of landlocked sockeye salmon (Oncorhynchus nerka) and trout in the Waitaki lakes, New Zealand. New Zealand Journal of Marine and Freshwater Research, 20: 537-547.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epipelagic (Ref. 58426). There are two forms, the anadromous form known as the sockeye and the landlocked form (with a much smaller maximum size) known as the kokanee (Ref. 27547). Upon emergence from gravel, fry at first tends to avoid light, hiding during the day and emerging at night (Ref. 27547). In some populations, sockeye fry go to the sea during their first summer but most spend one or two (rarely three or four) years in a lake before migrating (Ref. 30333). In a few streams of the Copper River drainage in Alaska, young sockeye stay in the stream (Ref. 27547). Once in the lake, the young spend a few weeks inshore, feeding largely on ostracods, cladocerans and insect larvae. The fish then become pelagic and move offshore, where they feed on plankton in the upper 20 m or so (Ref. 27547). Seaward migration follows with the young individuals first staying fairly close to shore, feeding mainly on zooplankton, but also on small fishes and insects (Ref. 30343, 30346). With growth, they head out to sea and fish become important in the diet (Ref. 27547). Kokanee are confined to lake-stream systems, and most of its life is spent in the lake (Ref. 27547). They feed mainly on plankton, but also take insects and bottom organisms (Ref. 1998). Kokanee, wherever they are native, have been derived from anadromous populations, and each kokanee population apparently has evolved independently from a particular sockeye run (Ref. 30338, 30339). Offspring of kokanee occasionally become anadromous, and sockeye offspring occasionally remain in freshwater (Ref. 27547). Lifespan of the kokanee varies from two to seven years in different stocks (Ref. 27547).
  • Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Kokanee feed on zooplankton. Young sockeye eat primarily planktonic crustaceans. At sea, young sockeye feed on zooplankton, small fishes and insects; as they grow they eat more fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Sockeye salmon are host to a variety of parasites, which are generally found within the kidney. Most of these parasites release spores when in freshwater where excretion of water by sockeye salmon is high. These parasites include Myxidium salvelini and Parvicapsula minibicornis, both myxosporeans. Sockeye salmon also contribute to the diet of black bears and brown bears.

Commensal/Parasitic Species:

  • Higgins, M., L. Margolis, M. Kent. 1993. Arrested Development in a Freshwater Myxosporean, Myxidium salvelini, Following Transfer of Its Host, the Sockeye Salmon (Oncorhynchus nerka), to Sea Water. The Journal of Parasitology, 79/3: 403-406.
  • Jones, S., G. Prosperi-Porta, S. Dawe, K. Taylor, B. Goh. 2004. Parvicapsula minibicornis in Anadromous Sockeye (Oncorhynchus nerka) and Coho (Oncorhynchus kisutch) Salmon from Tributaries of the Columbia River. The Journal of Parasitology, 90/4: 882-885.
  • Kent, M., D. Whitaker, S. Dawe. 1997. Parvicapsula minibicornis n. sp. (Myxozoa, Myxosporea) from the Kidney of Sockeye Salmon (Oncorhynchus nerka) from British Columbia, Canada. The Journal of Parasitology, 83/6: 1153-1156.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult sockeye salmon are easily spotted and caught because of their size, and they are eaten by bears, including brown bears and black bears, and birds, such as the mew gull. Predators of frys (young sockeye salmon) include lake trout, squawfish, and mountain whitefish. Most predation occurs in streams and rivers. As frys, sockeye salmon can often escape predators because of their smaller size. Humans also consume a considerable about of sockeye salmon.

Known Predators:

  • Groot, C., L. Margolis. 1991. Pacific Salmon: Life Histories. Vancouver: UBC Press.
  • Olson, T., R. Squibb, B. Gilbert. 1998. Brown Bear Diurnal Activity and Human Use: A Comparison of Two Salmon Streams. Ursus, 10: 547-548.
  • Quinn, T., M. Kinnison. 1999. Size-Selective and Sex-Selective Predation by Brown Bears on Sockeye Salmon. Oecologia, 121/2: 273-274.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
  • Boustead, N.C. 1993 Detection and New Zealand distribution of Myxobolus cerebralis, the cause of whirling disease of salmonids. N.Z. J. Mar. Freshwat. Res. 27(4):431-436. (Ref. 45510)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
  • Horne, M.T. and A.C. Barnes 1999 Enteric redmouth disease (Yersinia ruckeri). p.455-477. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48849)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Life cycle of sockeye similar to kokanee except sockeye matures in the ocean rather than lakes. Kokanee often travels in large schools. (Sigler and Sigler 1987). Two studies each reported survival rate of 4-20% for marine portion of life cycle (see Pauley et al. 1989). Northern squawfish and rainbow trout may be important predators on young in some lakes. Schools of young in lakes disperse as dusk approaches, reform after dawn (Pauley et al. 1989). In Montana, the introduction of opossum shrimp (MYSIS RELICTA) was followed by an abrupt decline in the kokanee population, apparently due to zooplankton decline caused by shrimp predation (Spencer et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The eyes of sockeye salmon are located on opposite sides of their head, and they thus have a greater field of vision than animals with two eyes facing forward. The spectrum of visibility of sockeye salmon includes color, from indigo to red, as well as ultraviolet light. Members of this species have nostrils and an enhanced sense of smell. This also adds to their sense of taste. Additionally, sockeye salmon have lateral lines, which detect vibrations, allowing them to hear.

Perception Channels: visual ; ultraviolet; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Kokanee: feeding generally heaviest from sundown to dark (Sigler and Sigler 1987). Young sockeye feeding heaviest in afternoon, lightest at night and early morning (Pauley et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Sockeye salmon follow the developmental patterns of many pacific salmon. Eggs are externally fertilized by the male. Embryos begin as a single cell with a yolk. After this cell divides, the resulting cells differentiate into specific body type cells until the fetus is developed and ready to hatch, at which time it is called an alevin. Alevins carry the yolk on the anterior end of their body and appear to be clear because they have no pigment. As alevins develop into adults, the yolk shrinks and coloration occurs. Sex of sockeye salmon is initially difficult to determine, but is easily determined later in life by their body shape and coloration.

Development - Life Cycle: metamorphosis ; indeterminate growth

  • Williams, R. 2006. Return to the River: Restoring Salmon to the Columbia River. China: Elsevier Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adult sockeyes return to natal streams to spawn. This occurs during summer and fall and as late as December in the southern part of the range. The female selects a site, usually with gravel bottom, and digs a nest. During nest building, the female is attended by a dominant male and a few subordinate males. At this stage, females tend to be aggressive toward other females and subordinate males; males are aggressive toward other males. Between digging acts, the female will rest over the pit while the dominant male courts her. Once the nest is completed, the female enters the nest, followed immediately by the dominant male who comes close beside her. Their mouths gape, and the pair vibrates to release eggs and sperm. One or more subordinate males may come to the other side of the female and join in the spawning. The female then moves to the upstream edge of the nest and digs again, covering the old nest, at the same time creating a new one just upstream from the previous one. A female normally needs 3 to 5 days to deposit all her eggs and utilizes 3 to 5 nests for this purpose. She may spawn with several dominant males. A male may breed with several females. All adult sockeye die after spawning (Ref. 27547).Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The average lifespan for sockeye salmon in the wild is 4 to 5 years. The oldest salmon caught was 8 years of age. Typically, sockeye salmon die after mating.

Range lifespan

Status: wild:
8 (high) years.

Typical lifespan

Status: wild:
4 to 5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sockeye salmon mate seasonally. Females lay their eggs and are then to select a mate. Males are chosen after they have come along her side and presented themselves multiple times. They are judged on their color and size. During this process, males can be attacked by females and other males. Larger dominant males reproduce more often than other males and, because sockeye salmon are polygynous, the dominant male can mate with many females. Some subordinate males may not have the opportunity to mate at all.

Mating System: polygynous

Sockeye salmon breed from July to October, although some members of this speices located in the southern-most point of their geographic range have been known to breed into December. When females arrive, they create a nest in the gravel in which they lay their eggs. After fertilization, eggs stay in the gravel nest for 32 to 42 days. Females produce 47 to as many as 206 offspring. Sockeye salmon are independent when hatched and are able to reproduce at 4 to 5 years of age.

Breeding interval: Sockeye salmon breed once a year.

Breeding season: Sockeye salmon generally breed from July to October.

Range number of offspring: 47 to 206.

Range gestation period: 32 to 42 days.

Average time to independence: 0 years.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Average age at sexual or reproductive maturity (female): 4 to years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Mothers invest time creating gravel nests, in which eggs incubate. After fertilization, however, the newly hatched alevin have no parental investment.

Parental Investment: no parental involvement; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female)

  • Busch, R. 2000. Salmon Country: A History of the Pacific Salmon. Toronto, Ontario: Key Porter Books.
  • Foote, C. 1990. An Experimental Comparison of Male and Female Spawning Territoriality in a Pacific Salmon. Behaviour, 115/3-4: 283-314.
  • Lichatowich, J. 1999. Salmon Without Rivers. Washington, DC: Island Press.
  • Moore, J., D. Schindler, J. Carter, J. Fox, J. Griffiths, G. Holtgrieve. 2007. Biotic Control of Stream Fluxes: Spawning Salmon Drive Nutrient and Matter Export. Ecology, 88/5: 1278-1291.
  • Quinn, T. 2005. The Bahavior and Ecology of Pacific Salmon and Trout. Canada: University of Washington Press.
  • Quinn, T., A. Hendry, L. Wetzel. 1995. The Influence of Life History Trade-Offs and the Size of Incubation Gravels on Egg Size Variation in Sockeye Salmon (Oncorhynchus nerka). Oikos, 74/3: 425-427.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous forms migrate from ocean waters up coastal streams and rivers to spawn in natal waters. They spend 1-4 years (usually 2 years) in the ocean before ascending streams (mainly in summer but some stocks as early as winter). Many stocks spawn in fall (peak often in October or November), but spawning extends into winter in some areas. Spawning sites often are in gravel riffles, sometimes along gravelly shores of lakes where seepage outflows, springs, or wind-induced waves occur. Eggs hatch in 6-9 weeks, depending on temperature, and larvae emerge 2-3 weeks later. Sockeye fry move upstream or downstream to nursery lakes, where the young spend 1-2 years (up to 3 or rarely 4 years in some areas of Alaska; usually 1 year in British Columbia) before going to sea, usually in spring; some populations use stream areas for rearing and may migrate to the sea soon after emergence.

Many non-anadromous (kokanee) populations move from lakes into tributary streams to spawn, though some remain in lakes. They enter spawning streams from late spring to midsummer, depending on the population. Kokanee spawn in different areas from August to February, at temperatures of 40-55 F.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus nerka

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 76 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTCTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTCGGCACCGCCCTAAGCCTACTGATTCGGGCAGAACTAAGCCAGCCAGGCGCTCTTCTAGGAGAT---GACCAGATCTATAACGTAATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATACCAATTATAATCGGAGGATTTGGAAACTGATTAATCCCTCTAATAATCGGAGCCCCCGATATGGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTCCCCCCCTCGTTTCTCCTCCTCCTATCTTCATCTGGAGTTGAAGCCGGCGCTGGTACCGGATGAACAGTTTATCCCCCTCTGGCCGGAAACCTTGCCCACGCGGGAGCCTCTGTTGACTTAACCATCTTCTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCCATTAATTTTATCACAACCATTATTAATATGAAGCCCCCAGCCATCTCTCAGTACCAGACCCCACTTTTTGTTTGAGCTGTGCTAATCACTGCTGTACTTCTACTACTTTCCCTACCCGTCCTAGCAGCAGGCATTACTATGTTACTTACTGACCGAAATTTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCGATTTTATACCAACACCTCTTTTGGTTCTTCGGACACCCAGAGGTATATATTCTTATCCTCCCAGGCTTCGGTATAATTTCACATATCGTTGCATACTACTCCGGCAAAAAAGAACCATTCGGGTATATAGGAATAGTTTGAGCTATAATAGCCATCGGGTTACTAGGGTTTATCGTTTGAGCCCACCACATGTTCACTGTCGGAATAGACGTGGACACTCGTGCCTACTTTACATCTGCCACCATGATTATCGCCATCCCCACAGGAGTAAAAGTATTTAGCTGACTAGCTACATTACACGGAGGC---TCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus nerka

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 76
Specimens with Barcodes: 143
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Although listed as a species of least concern by the IUCN Red List, the U.S. Fish and Wildlife Service Species Report listed O. nerka as endangered in 1992. In some areas, sockeye salmon are only listed as threatened, as populations have stabilized. Many programs have been implemented to prevent over-fishing and to rejuvenate sockeye populations in areas where over-fishing has occurred.

US Federal List: endangered; threatened

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Rand, P.S.

Reviewer/s
Ruggerone, G. & English, K.

Contributor/s
Goslin, M.

Justification
At the global population level, Sockeye Salmon are assigned a Red List status of Least Concern (LC). The median and mean rate of change across the 62 assessed populations indicate an expanding global population (9.0 and 72.4 % increase, respectively, over the past three generations), thus there is no evidence of risk to the species under Red List A2 criterion. With an estimated geographic range of 11.5 million km², there is no evidence of threat to the global population under criterion B1 (Table 1). Similarly, at 1.9 million km² of current occupancy (freshwater basin area), there is no evidence of threat under criterion B2 (Table 1). Approximately 7% of the historical range of Sockeye Salmon has been lost due to localized extinction events, but we conclude the species is not threatened globally.

For all Figures, Tables and more details about the methods used for this assessment, see the additional supporting documentation. Follow the link below for a PDF of the additional documentation.

History
  • 2008
    Least Concern
    (IUCN 2008)
  • 2008
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 01/03/1992
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: U.S.A. (Snake River, ID stock wherever found.)

Status: Threatened
Date Listed: 03/25/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: U.S.A. (Ozette Lake, WA)


Population detail:

Population location: U.S.A. (Snake River, ID stock wherever found.)
Listing status: E

Population location: U.S.A. (WA) all naturally spawned population in Ozette Lake and its tributary streams
Listing status: T

For most current information and documents related to the conservation status and management of Oncorhynchus nerka, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
At the species level, the population is believed to be stable; however, some subpopulations are declining. For more details on subpopulation size estimates and trends, see the additional supporting documentation (particularly Appendix 2). Follow the link below for a PDF of the additional supporting documentation.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The key threats to the species identified by the IUCN SSC Salmon Specialist Group were:
  1. Mixed stock fishing leading to over fishing small, less productive populations
  2. Changing river and ocean conditions that are likely linked to global climate change, expressed in poor marine survival rates and increased incidence of disease in adult spawners
  3. Negative effects of hatcheries and construction of artificial spawning habitat
It is important to note that in many cases, the causes for declines in some specific Sockeye Salmon subpopulations remain unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Decline is due to dams that blocked migration, mainstem passage mortality at Columbia and Snake river dams, overutilization in commercial fisheries, and habitat modification (see Nehlsen et al. 1991). Sockeye in the Deschutes River (Oregon) were largely eradicated by dam construction (small anadromous run is maintained by incidental passage of smolts from a resident kokanee population) (Nehlsen et al. 1991). In the Puget Sound area, decline of the Baker River sockeye population has been attributed to upstream and downstream passage problems as a result of dam construction (Nehlsen et al. 1991). Lake Ozette sockeye run on the Washington coast declined because of logging and overfishing in the 1940s and 1950s (Nehlsen et al. 1991).

The decline and persistent low abundance of the Rivers Inlet population in British Columbia apparently was due to poor marine survival, and not due to a decline in juvenile abundance (McKinnell et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
1. Many subpopulations of Sockeye in British Columbia were found to be threatened based on this assessment. Fisheries and Oceans Canada (DFO) is responsible for salmon management and is currently formulating conservation units (Holtby and Ciruna, unpublished manuscript) and initiating new policy (e.g,. Wild Salmon Policy) and procedures to stem the loss in diversity (DFO 2005, Irvine and Fraser 2008). Two locations of Sockeye Salmon, Sakinaw Lake and Cultus Lake, have been assessed and listed as Endangered by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC). However, the federal government has declined protection under the Species at Risk Act (SARA) due to the social and economic costs of closures to the fishery (Irvine et al. 2005). We encourage COSEWIC and DFO to focus attention on those subpopulations that we identified as threatened in this IUCN assessment.

2. We considered Ozette Lake, Lake Pleasant and Quinault Lake Sockeye Salmon as individual spawning sites in a larger subpopulation (SEASONAL UPWELLING). These lake systems are recognized individually as Evolutionarily Significant Units (ESUs) by National Oceanic and Atmospheric Administration (NOAA). The latter two sites were not included in the genetic baseline applied in this assessment, thus we assumed all sites are members of a larger, parent subpopulation. Further, we did not include Ozette Lake in our assessment given the recent escapement data available for the native beach-spawning population at that location is obscured by repeated attempts at establishing a tributary spawning population originating from broodstock taken from outside the basin. We encourage efforts at expanding the range-wide microsatellite-DNA baseline to include Lake Pleasant and Quinault Lake, and to investigate the status of the native beach-spawning Sockeye in Ozette Lake.

3. Most of the data used in our assessment, particularly in Alaska, were from large aggregate stocks that may contain many (sometimes 100s) of individual spawning sites, and hence may mask important dynamics occurring at small scales. While a number of recent studies have shown that there is a significant degree of coherence among populations within a given region, it is important to acknowledge that a majority of the variability in vital rates are not explained by regional, environmental drivers, and may result from localized threats, for example road or other infrastructural development, or by different life history characteristics which affect productivity. Where possible and feasible, we recommend a more comprehensive monitoring approach that addresses dynamics at the scale of individual spawning sites. An excellent example of this approach is the Wood River system in Alaska’s Bristol Bay region, where a combination of sampling approaches provides a more integrated monitoring system that translates into a robust assessment of the status of the species in that basin.

4. Mixed-stock fishing is likely to be a key factor in the decline observed at many sites and subpopulations in our assessment. We feel a key priority is filling a gap in knowledge about composition of mixed-stock harvest in coastal Sockeye Salmon fisheries. While a great deal of resources has been invested in developing weak-stock management for Fraser River Sockeye Salmon through the Pacific Salmon Commission and DFO, there has been much less attention placed in other regions along the west coast of North America, particularly in the regions where we found the greatest diversity of subpopulations. We encourage continued investment in developing methods and protocols to account for subpopulation composition of coastal fisheries targeting Sockeye salmon to help track harvest pressure at a biologically and ecologically meaningful scale. Further, we encourage fisheries management agencies to explore restructuring fisheries in a way that would result in shifting fishing pressure from coastal regions to more terminal locations, thus providing a more effective means of controlling fishing pressure at the scale of individual subpopulations.

5. Another leading factor threatening Sockeye Salmon are poor marine survival rates. This has been documented in cases where smolt-to-adult survival rates are estimated through intensive monitoring programs. This appears to be a significant factor explaining declines in adult abundance across many locations in the southern range of the species in North America. While marine conditions have been shown to cycle based on climate forcing and may, in fact, improve in future years, we feel it is important for those managing salmon in this region to acknowledge that poor marine survival may persist, particularly given projections based on global climate change. Reversing declining trends in those subpopulations affected may require increased attention to agents of mortality that are occurring at other life history stages over which we have more local control.

6. Many previous attempts at re-introductions of Sockeye Salmon have been unsuccessful, and we feel any effort at captive breeding or inter-basin transfers for reintroduction purposes should proceed with great caution. These efforts, to the extent that they exist, are at best stop-gap measures and are in no way a substitute for conserving the species in the wild. The lack of success from the captive breeding of endangered Sakinaw Sockeye Salmon by DFO, and endangered Redfish Lake Sockeye by NMFS, are examples of the limitations to these expensive measures. Recent evidence of re-establishment of anadromous runs of Sockeye from remnant, isolated Kokanee populations following dam removal or modification (e.g., Allouette Lake in British Columbia) may offer hope in re-establishing anadromous life histories in cases where dams have prevented passage.

7. Enhancement activities (particularly hatchery releases and spawning channel construction) is likely to be a key factor in reducing abundance in neighbouring, small wild populations. In our assessment, we were unable to functionally track both wild and enhanced Sockeye Salmon where they intermingle. We strongly recommend adoption of integrated monitoring programs that includes a robust marking program and monitoring efforts targeted toward wild Sockeye Salmon populations that would provide the data necessary to address the degree to which enhancement practices threaten wild Sockeye Salmon. It is important to note that two large basins in our assessment (Fraser and Skeena) are all strongly. influenced by enhancement activities, and these activities likely represent a key factor threatening many neighbouring subpopulations.

8. While not addressed in the present assessment due to lack of data, we feel there should be more focused research attention on sea-and river-type Sockeye that may serve as colonizers in the future. This line of research is particularly important given expected habitat alterations from climate change.

9. Very few data were available to assess population viability of Sockeye Salmon in the Russian Far East, and we document a significant reduction in escapement in recent years at a site within the Kamchatka River basin that warranted an endangered listing for this subpopulation. The leading threat recognized for this subpopulation is overfishing. The situation has been exacerbated by an increase in illegal fishing practices. We encourage the leading agencies in this region to provide more open access to data, and supporting meta-data, for assessment purposes. We also encourage development of new monitoring efforts throughout the region and increased enforcement to reduce poaching. Many populations of river-type Sockeye exist, particularly in western Kamchatka, and focused research on these populations will provide important insight into the status of the species there.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Requirements: Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: See Nehlsen et al. (1991) for general protection and management recommendations for anadromous salmonids. See Thomas et al. (1993) for information on habitat management for this and other at-risk fish species in the Pacific Northwest. Waples and Teel (1990) emphasized the importance of monitoring the genetic consequences of the large-scale artificial propagation programs involving Pacific salmon (see also Waples 1990). Meffe (1992) gave reasons why the hatchery approach to recovery ultimately will fail, and he emphasized that overharvest and habitat destruction need to be addressed in a major landscape-level effort.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Salmon, including sockeye salmon, are caught in and destroyed by hydroelectric dams when they attempt to swim through to spawn. This decreases salmon populations and thus availability for fishing.

  • Pringle, C. 2001. Hydrologic Connectivity and the Management of Biological Reserves: A Global Perspective. Ecological Applications, 11/4: 981-998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sockeye salmon are commonly fished and are the most common species of salmon caught around British Columbia and Alaska.

Positive Impacts: food

  • Iudicello, S., M. Weber, R. Wieland. 1999. Fish, Markets, and Fishermen: The Economics of Overfishing. Washington, DC: Island Press.
  • Walters, C., S. Martell. 2004. Fisheries Ecology and Management. Princeton, New Jersey: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Important commercial and sport fish; commercially important from Columbia River to Bristol Bay, Alaska; most valuable commercial fishery in both Alaska and British Columbia; important as subsistence and ceremonial fish to indigenous peoples of Alaska, British Columbia, and Washington. See Pauley et al. 1989 for many details on commercial fishery. Has been used in carcinogen testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • Garibaldi, L. 1996 List of animal species used in aquaculture. FAO Fish. Circ. 914. 38 p. (Ref. 12108)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Newman, L. 1995 Census of fish at the Vancouver aquarium, 1994. Unpublished manuscript. (Ref. 9183)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sockeye salmon

For other uses, see Sockeye (disambiguation).

Sockeye salmon (Oncorhynchus nerka) — also called red salmon or blueback salmon in the United States — is an anadromous species of salmon found in the Northern Pacific Ocean and rivers discharging into it. This species is a Pacific salmon that is primarily red in hue during spawning. They can be up to 84 cm in length and weigh anywhere from 2.3 to 7 kg. Juveniles remain in freshwater until they are ready to migrate to the ocean, over distances of up to 1,600 km. Their diet consists primarily of zooplankton. Sockeye salmon are semelparous, dying after they spawn. Some populations, referred to as kokanee, do not migrate to the ocean and live their entire lives in freshwater.

Classification and name origin[edit]

Sockeye salmon is the third most common Pacific salmon species, after pink and chum salmon.[2] Oncorhynchus comes from the Greek '-ychos' meaning nail, and 'rhyngchos' meaning snout. nerka is the Russian name for the anadromous form.[3] The name "sockeye" is an anglicization of suk-kegh (sθə́qəy̓), its name in Halkomelem, the language of the indigenous people along the lower reaches of the Fraser River (one of British Columbia's many native Coast Salish languages). Suk-kegh means "red fish".[4][5]

Description[edit]

The sockeye salmon is sometimes called red or blueback salmon, due to its color.[5] Sockeye are blue tinged with silver in color while living in the ocean.[3] When they return to spawning grounds, their bodies become red and their heads turn green. Sockeye can be anywhere from 60 to 84 centimeters in length and weigh from 2.3 to 7 kg.[5] Two distinguishing features are their long, serrated gill rakers that range from 30 to 40 in number, and their lack of a spot on their tail or back.[3]

Range and habitat[edit]

Sockeye salmon range as far south as the Columbia River in the eastern Pacific (although individuals have been spotted as far south as the 10 Mile River on the Mendocino Coast of California), and in northern Hokkaidō Island in Japan in the western Pacific. They range as far north as the Bathurst Inlet in the Canadian Arctic in the east and the Anadyr River in Siberia in the west. The farthest inland sockeye salmon travel is to Redfish Lake Idaho over 900 miles from the ocean and 6,500 feet in elevation.[6]

Landlocked populations[edit]

Male spawning phase sockeye.

Completely landlocked populations of the same species also are known. Some sockeye live and reproduce in lakes and are commonly called kokanee, their name in the Okanagan language[7] or "silver trout".[8] They are much smaller than the anadromous variety and are rarely over 350 mm (14 in) long. In the Okanagan Lake and many others, there are two kinds of kokanee populations - one spawns in streams and the other near lake shores. Landlocked populations occur in the Yukon Territory and British Columbia in Canada, as well as, in Alaska, Washington, Oregon, California, New York, Utah, Idaho, Montana, Nevada, Colorado, New Mexico, and Wyoming in the United States. Nantahala Lake is the only place in North Carolina where kokanee salmon are found.[3] The fish, which is native to western North America, was stocked in Nantahala Lake in the mid-1960s by the NC Wildlife Resources Commission in an attempt to establish the species as a forage fish for other predator fishes in the lake. This stock has remained and become a favorite target for anglers.[9]

In Japan, a landlocked variety termed black kokanee, or "kunimasu" in Japanese, was deemed to be extinct after 1940, when a hydroelectric project made its native lake in northern Akita Prefecture more acidic. The species seems to have been saved by transferring eggs to Saiko Lake, 500 kilometers to the south, however.[10] This fish has been treated as a subspecies of sockeye Oncorhynchus nerka kawamurae, or even an independent species Oncorhynchus kawamurae.[11]

Diet[edit]

Sockeye salmon use patterns of limnetic feeding behavior, which encompasses vertical movement, schooling, diel feeding chronology, and zooplankton prey selectivity. They can change their position in the water column, timing and length of feeding,school formation, and choice of prey to minimize the likelihood of predation. This also ensures they still get the minimum amount of food necessary to survive. All of these behaviors contribute to the survivability, and therefore fitness of the salmon. Depending on location and threat of predation, the levels of aggressive feeding behavior can vary.[12][13]

Sockeye salmon, unlike other species of Pacific salmon, feed extensively on zooplankton during both freshwater and saltwater life stages.[14] They also tend to feed on small aquatic organisms such as shrimp. Insects are part their diets at the juvenile stage.[3]

Life cycle[edit]

See also: Salmon run

Sockeye salmon exhibit many different life histories with the majority being anadromous where the juvenile salmon migrate from freshwater lakes and streams to the ocean before returning as adults to their natal freshwater to spawn. Similar to most Pacific salmon,sockeye salmon are semelparous, meaning they die after spawning once. Some sockeye, called kokanee, do not migrate to the ocean and live their entire lives in freshwater lakes. The majority of sockeye spawn in rivers near lakes and juveniles will spend one to two years in the lake before migrating to the ocean, although some populations will migrate to saltwater in their first year. Adult sockeye will spend two to three years in the ocean before returning freshwater. Females will spawn in 3-5 redds over a period of a several days. The eggs usually hatch within six to nine weeks and the fry typically rear in lakes before migrating to the ocean. [15]

Reproduction[edit]

Spawning sockeye salmon

Males partake in competitive and sneaking tactics, formation of hierarchies, and non-hierarchical groupings around females who are ready to mate.[16] Reproductive success varies more in males than females. The greater variability in male reproduction is associated with the greater average size and exaggerated shape of males. Reproductive success in females is determined by the number of eggs she lays, her body size, and the survival of the eggs, which is due in part to the quality of the nest environment.[17] Male spatial distribution depends on shifts in reproductive opportunities, physical traits of breeding sites, as well as the operational sex ratio (OSR) of the environment.[16]

Non-dominant males adopt a subordinate behavior, acting as a satellite to mated pairs. During spawning, a subordinate male will move quickly into the redd and release their sperm. Nearby dominant males from other redds will also do this.[18] Male social status is positively correlated to length and dorsal hump size. Larger females tend to spawn in shallower water, which is preferred over deeper water.[17]

There is a dramatic sexual dimorphism at maturity.[17] Males go through numerous morphological changes at maturation including, an increase in body depth, hump height, and snout length. Snout size also increases in females, but hump height and adipose fin length do not increase. This could mean that longer snout sizes are sexually selected, but hump height and adipose fin length are not. Females develop large gonads that are about 25% of the body mass.[19]

Females are responsible for parental care. They select, prepare, and defend a nest site until they die or are displaced. Males do not participate in parental care at all, and they move between females after egg deposition.[20]

Sexual selection and natural selection[edit]

Sexual selection favors large males and females.[21] Males choose females based on their readiness to spawn and their size in order to maximize their breeding opportunities. Females vary their breeding rate depending on the size of the courting male, mating more quickly with larger males. This increases the likelihood that larger males will displace attending, smaller males. Males preferentially spawn with females who are red, which is the usual color of females. Even small changes in wavelength, saturation, and brightness can affect preference. Both sexually naïve males and experienced males showed the same preferences, which illustrates that preference for a red hue may be innate.[20]

Some traits that lead to reproductive success, such as body size and sexual dimorphism can affect one’s survival. This leads to opposing pressures of natural selection and sexual selection. Larger males are favored, unless the risk of predation is very high. Sockeye salmon that die prematurely from predation are typically the larger ones in a population. This shows natural selection against large bodies. Populations with higher levels of predation tend to evolve smaller body size. Without the threat of predation, salmon that breed early in the season live longer than those that breed late in the season.[21]

Energy cost[edit]

Reproduction is marked by depletion in energy stores. Fat, protein, and somatic energy stores decrease from the final moments in marine migration through freshwater entry, spawning, and death.[19] Sockeye salmon do not feed during reproduction.[18] Feeding ends once they enter into freshwater, which can be several months before spawning.[19] Embryos are maintained with only endogenous food supplies for about 3–8 months.[22] Reproduction in the sockeye salmon has to be accomplished with the energy stores brought to the spawning grounds. How the salmon use their energy during migration and spawning affects how successful they will be reproductively; energy used for migration cannot also be used for courtship. If they waste too much energy, they might not be able to spawn. Males must also make the decision whether to invest energy in fighting for a female or for longevity on the spawning grounds.[18]

Competition[edit]

Aggressive behavior displayed by dominant males is predominantly directed towards intruding dominant males. Sometimes sockeye salmon males behave aggressively towards subordinate males. These encounters are short, with the intruding male leaving after one or two aggressive interactions.[18] Spawning females direct their aggression primarily towards intruding females or other spawning females that are close by. However, they may also direct aggression towards intruding or subordinate males.[18] Aggressive interactions between females only last one or two charges and/or chases. The intruder retreats and the spawning female settles back in her redd.[18] These acts of aggression are important in terms of reproductive success, because they determine the quality of the nest site the female obtains and the access to females by males.[18]

Competition for food or space while the salmon are in their lake residence period can exist. This happens when there is a more populous class of young sockeye or when there are multiple classes present. It can also happen when resources are in short supply. Interspecific competition can also occur and can lead to interactive segregation, which is when species emphasize their differences in diet and habitat to avoid competition. Interspecific competition can affect the growth rates of the salmon if their access to resources is limited.[23]

Commerce[edit]

Smoked sockeye salmon ready for consumption
See also: Salmon (food)

Commercial fishermen net this species using seines and gillnets for fresh or frozen fillet sales and canning. Annual catch can reach 30 million fish in Bristol Bay, Alaska, which is the site of the world's largest sockeye harvest.[24]

The largest spawning grounds in Asia are located on the Kamchatka Peninsula of the Russian Far East, especially on the Ozernaya River of the Kurile Lake, which accounts for nearly 90% of all Asian sockeye salmon production,[25] and is recognized as the largest spawning ground outside of Alaska.[26] Illegal fishing in Kamchatka is subject to environmental concern.[27]

Conservation status[edit]

United States[edit]

Spawning Kokanee salmon in the Sawtooth Range of Idaho

United States sockeye salmon populations are currently listed under the US Endangered Species Act[28] by the National Marine Fisheries Service as an endangered species in the Snake River (Idaho, Oregon and Washington area) and as a threatened species in Lake Ozette, Washington. Other sockeye populations in the upper Columbia River and in Puget Sound (Washington) are not listed under the Act.

Sockeye is an exception to 2010's forecast resurgence of Oregonian fish stocks. Spring Chinook, summer steelhead, and Coho are forecast to increase by up to 100% over 2008 populations. The sockeye population peaked at over 200,000 in 2008 and were forecast to decline to just over 100,000 in 2010. As an early indication of the unexpectedly high sockeye run in 2010, on July 2, 2010, the United States Army Corps of Engineers reported over 300,000 sockeye had passed over Bonneville Dam on the Columbia River. Lower temperatures in 2008 North Pacific waters brought in fatter plankton, which, along with greater outflows of Columbia River water, fed the resurgent populations.[29]

Proposed legislative efforts, such as the Northern Rockies Ecosystem Protection Act, are attempting to protect the headwaters of the sockeye salmon by preventing industrial development in roadless areas.

Record numbers of a once-waning population of sockeye salmon have been returning to the Northwest's Columbia Basin (as of June 2012), with thousands more crossing the river's dams in a single day than the total numbers seen in some previous years.[30]

Canada[edit]

Sockeye salmon jumping over a beaver dam, Aleknagik Lake, AK

The conservation status of sockeye populations in Canada is under review by Fisheries and Oceans Canada as part of its Wild Salmon Policy strategy to standardize monitoring of wild salmon status.[31] Salmon runs of particular note are the Skeena and Nass river runs, and the most famous is the Fraser River sockeye run.

The Fraser River salmon run has experienced declines in productivity since the 1990s, mirroring a similar decline in the 1960s.[32]

The return abundance (population) of Fraser River sockeye in 2009 was estimated at a very low 1,370,000,[33] 13% of the pre-season forecast of 10,488,000.[34] That represented a decline from the recent (1993) historical cycle peak of 23,631,000 [35] and the return abundance was the lowest in over 50 years. The reasons for this (former) decline remain speculative. According to a consortium of scientists assembled to review the problem, the decline highlights the uncertainty in forecasting salmon returns. [36] After the low returns, the Government of Canada launched a formal inquiry into the decline, the Commission of Inquiry into the Decline of Sockeye Salmon in the Fraser River.[37] [38]

The Commission has been tasked with investigating all the factors which may affect Fraser River sockeye salmon throughout their life cycle. According to the terms of reference,[37] [38] the subjects of investigation are "the impact of environmental changes along the Fraser River, marine environmental conditions, aquaculture, predators, diseases, water temperature and other factors that may have affected the ability of sockeye salmon to reach traditional spawning grounds or reach the ocean."

During the commission, hundreds of thousands of documents and scientific research papers were reviewed. Twelve technical reports were published using that information, looking at the possible impacts of diseases and parasites, hatchery diseases, contaminants, marine ecology, salmon farms, fisheries, predators, climate change and government management on the productivity of Fraser River sockeye runs.[39]

The commission will submit its final report by October 29, 2012.[40]

While the commission was holding public hearings, in the late summer of 2010, the largest run of sockeye since 1913 returned to the Fraser River system.[41] Final counts show that approximately 30 million salmon returned to the Fraser River and its tributaries in 2010. In total, approximately 11,591,000 Fraser sockeye were caught by Canadian fishers and 1,974,000 Fraser sockeye were caught by American fishers. The final projected escapement (fish which were not caught) was 15,852,990 fish.[42]

Recent unpredictable fluctuations in runs are speculated to be due to changing water temperatures.[43]

References[edit]

  1. ^ "iucnredlist.org". iucnredlist.org. Retrieved 2013-01-17. 
  2. ^ "Sockeye Salmon". NOAA Fisheries Office of Protected Resources. Retrieved 2006-11-19. 
  3. ^ a b c d e "Oncorhynchus nerka". Fishbase. Retrieved 15 November 2013. 
  4. ^ Bright, William (2004). Native American placenames of the United States. University of Oklahoma Press. p. 455. ISBN 978-0-8061-3598-4. Retrieved 11 April 2011. 
  5. ^ a b c USA. "nationalgeographic.com". Animals.nationalgeographic.com. Retrieved 2013-01-17. 
  6. ^ "Sockeye Salmon". Alaska Department of Fish and Game. Retrieved 2006-11-17. 
  7. ^ "Kokanee Lake". BC Geographical Names. http://apps.gov.bc.ca/pub/bcgnws/names/6222.html.
  8. ^ "Fish Resources - Salmon/Steelhead". USDA Forest Service. Retrieved 9 September 2011. 
  9. ^ "Fish for Kokanee Salmon at Lake Nantahala". Reflection Lake Nantahala. Retrieved 21 November 2013. 
  10. ^ Scientist says he found Japan fish thought extinct Bay Ledger, December 14, 2010
  11. ^ "Oncorhynchus kawamurae". Fishbase. Retrieved 21 November 2013. 
  12. ^ Eggers, Douglas M. (3 April 1978). "Limnetic feeding behavior of juvenile sockeye salmon in Lake Washington and predator avoidance". ASLO 23 (6): 1114–1125. doi:10.4319/lo.1978.23.6.1114. 
  13. ^ Clark, Colin W.; David A. Levy (February 1988). "Diel Vertical Migrations by Juvenile Sockeye Salmon and the Antipredation Window". The American Naturalist 131 (2): 271–290. doi:10.1086/284789. 
  14. ^ Alaska Department of Fish and Game. "Sockeye salmon". adfg.state.ak.us. Retrieved 2013-01-17. 
  15. ^ http://www.nmfs.noaa.gov/pr/species/fish/sockeyesalmon.htm
  16. ^ a b Quinn, Thomas P.; Adkison, Milo D.; Ward, Michael B. (26 April 2010). "Behavioral Tactics of Male Sockeye Salmon (Oncorhynchus nerka) under Varying Operational Sex Ratios". Ethology 102 (2): 304–322. doi:10.1111/j.1439-0310.1996.tb01127.x. 
  17. ^ a b c Quinn, Thomas P.; Chris J. Foote (1 October 1994). "The effects of body size and sexual dimorphism on the reproductive behaviour of sockeye salmon, Oncorhynchus nerka". Animal Behaviour 48 (4): 751–761. doi:10.1006/anbe.1994.1300. 
  18. ^ a b c d e f g Healey, M.C.; R. Lake, S.G. Hinch (1 February 2003). "Energy expenditures during reproduction by sockeye salmon (Oncorhynchus nerka)". Behaviour 140 (2): 161–182. doi:10.1163/156853903321671488. 
  19. ^ a b c Hendry, Andrew P.; Ole K. Berg (1999). "Secondary sexual characters, energy use, senescence, and the cost of reproduction in sockeye salmon". Canadian Journal of Zoology 77: 1663–1675. doi:10.1139/cjz-77-11-1663. 
  20. ^ a b Foote, Chris J; Brown, Gayle S; Hawryshyn, Craig W (1 January 2004). "Female colour and male choice in sockeye salmon: implications for the phenotypic convergence of anadromous and nonanadromous morphs". Animal Behaviour 67 (1): 69–83. doi:10.1016/j.anbehav.2003.02.004. 
  21. ^ a b Quinn, Thomas P.; Andrew P. Hendry; Gregory B. Buck (2001). "Balancing natural and sexual selection in sockeye salmon: interactions between body size, reproductive opportunity and vulnerability to predation by bears". Evolutionary Ecology Research 3: 917–937. 
  22. ^ Quinn, Thomas P.; Andrew P. Hendry; Lisa A. Wetzel (December 1995). "The Influence of Life History Trade-Offs and the Size of Incubation Gravels on Egg Size Variation in Sockeye Salmon (Oncorhynchus nerka)". Oikos 74: 425–438. doi:10.2307/3545987. 
  23. ^ Groot, C.; Margolis, L. (1991). Pacific salmon life histories. Vancouver: UBC Press. ISBN 0-7748-0359-2. 
  24. ^ "Species profile: Sockeye Salmon (Oncorhynchus nerka)". ADF&G Home. Alaska Department of Fish and Game. Retrieved 14 August 2012. 
  25. ^ Gustafson, R.G., T.C. Wainwright, G.A. Winans, F.W. Waknitz, L.T. Parker, and R.S. Waples. 1997. Status review of sockeye salmon from Washington and Oregon. U.S. Dept. Commer., NOAA Tech. Memo. NMFS-NWFSC-33, 282 p. Life History of Oncorhynchus nerka
  26. ^ "Discovering Kamchatka: Terrestrial and aquatic fauna". The Royal Geographical Society. 2008. Retrieved 2012-08-14. 
  27. ^ Dronova, Natalia; Spiridonov, Vassily (2008). "Illegal, Unreported, and Unregulated Pacific Salmon Fishing in Kamchatka". WWF Russia, IUCN. Retrieved 14 August 2012. 
  28. ^ nmfs.noaa.gov, U.S. Endangered Species Act
  29. ^ "Fish Boom Makes Splash in Oregon". Wall Street Journal. January 21, 2010. Retrieved January 21, 2010. [dead link]
  30. ^ "Sockeye Salmon rebounding in Oregon's Columbia Basin". Retrieved 2012-11-21. 
  31. ^ "Wild Salmon Policy 1". 
  32. ^ "Speaking for the Salmon proceedings: Summit of Fraser River Sockeye Salmon: Understanding Stock Declines and Prospects for the Future March 30-31, 2010". 
  33. ^ "NewsRelease10". Pacific Salmon Commission News Releases. Sep 11, 2009. Retrieved Sep 2009. 
  34. ^ "NewsRelease01". Pacific Salmon Commission News Releases. July 10, 2009. Retrieved Jul 2009. 
  35. ^ "Fraser River Annual Report to the Pacific Salmon Commission on the 2005 Fraser River sockeye and pink salmon fishing season.". Fraser River Panel reports to the Pacific Salmon Commission: 26. October 2009. Retrieved Oct 2009. 
  36. ^ "Managing Fraser sockeye in the face of declining productivity and increasing uncertainty: Statement from Think Tank of Scientists.". December 2009. Retrieved Dec 2009. 
  37. ^ a b "Terms of Reference for the Commission of Inquiry into Decline of Sockeye Salmon in the Fraser River.". November 2009. Retrieved Nov 2009. 
  38. ^ a b "Commission of Inquiry into the Decline of Sockeye Salmon in the Fraser River". Retrieved July 22, 2012. 
  39. ^ "Cohen Commission technical reports". 
  40. ^ "Cohen Commission to submit final report by October 29, 2012". 
  41. ^ "Consumers catch a deal in record sockeye run". August 27, 2010. Retrieved Sep 7, 2010. 
  42. ^ "Surveillance Report British Columbia Commercial Sockeye Salmon Fisheries. November 2011". 
  43. ^ "Record number of sockeye salmon return in B.C.". August 25, 2010. Retrieved Sep 7, 2010. 

Technical reports[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Non-anadromous (kokanee) and anadromous (sockeye) forms formerly were considered different subspecies; subsequent studies indicate that the two subspecies (nerka = sockeye; kennerlyi = kokanee) cannot be adequately separated. Sockeye and kokanee salmon in Redfish Lake, Idaho, likely are reproductively isolated (Williams et al. 1992).

Taylor et al. (1996) examined genetic variation among 24 populations ranging from Kamchatka to the Columbia River and identified two major genetic groups: a "northwestern" group (Kamchatka, western Alaska, northwestern British Columbia) and a "southern" group (sockeye and kokanee populations from the Fraser and Columbia river systems). "The populations did not cluster by migratory form, but genetic affinities were organized more strongly by geographic proximity." "Patterns of genetic affinity and allele sharing suggested that kokanee have arisen from sea-run sockeye salmon several times independently in the North Pacific." The authors concluded that "sockeye salmon and kokanee and para- and polyphyletic, respectively, and that the present distribution of the ecotypes results from parallel evolutionary origins of kokanee from sockeye throughout the North Pacific."

Hendry et al. (2000) presented evidence suggesting that reproductive isolation between introduced populations of common origin can evolve after fewer than 13 generations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!