Table of Contents
Overview
Comprehensive Description
Biology
Epipelagic (Ref. 58426). There are two forms, the anadromous form known as the sockeye and the landlocked form (with a much smaller maximum size) known as the kokanee (Ref. 27547). Upon emergence from gravel, fry at first tends to avoid light, hiding during the day and emerging at night (Ref. 27547). In some populations, sockeye fry go to the sea during their first summer but most spend one or two (rarely three or four) years in a lake before migrating (Ref. 30333). In a few streams of the Copper River drainage in Alaska, young sockeye stay in the stream (Ref. 27547). Once in the lake, the young spend a few weeks inshore, feeding largely on ostracods, cladocerans and insect larvae. The fish then become pelagic and move offshore, where they feed on plankton in the upper 20 m or so (Ref. 27547). Seaward migration follows with the young individuals first staying fairly close to shore, feeding mainly on zooplankton, but also on small fishes and insects (Ref. 30343, 30346). With growth, they head out to sea and fish become important in the diet (Ref. 27547). Kokanee are confined to lake-stream systems, and most of its life is spent in the lake (Ref. 27547). They feed mainly on plankton, but also take insects and bottom organisms (Ref. 1998). Kokanee, wherever they are native, have been derived from anadromous populations, and each kokanee population apparently has evolved independently from a particular sockeye run (Ref. 30338, 30339). Offspring of kokanee occasionally become anadromous, and sockeye offspring occasionally remain in freshwater (Ref. 27547). Lifespan of the kokanee varies from two to seven years in different stocks (Ref. 27547). The sockeye is one of the most commercially important Pacific salmons; the kokanee is primarily a sport fish but also makes excellent food and in some areas well regarded as food for large trout (Ref. 27547). Marketed fresh, dried or salted, smoked, canned, and frozen; eaten steamed, fried, broiled, microwaved, and baked (Ref. 9988). The Alaska Salmon fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_485.htm).
-
Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
http://www.fishbase.org/references/FBRefSummary.php?id=5723&speccode=2590
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Distribution
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45–70°N to 140°E–125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Range Description
The current distribution of Oncorhynchus nerka extends from approximately 45-70°N to 140°E-125°W longitude. The species has been recorded from Russia, United States, Canada, and Japan, although the Japanese populations are likely to have resulted from introductions; Japan is therefore not considered to be part of this species' natural range.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
See the additional supporting documentation (particularly Figures 1 & 2, and Appendices 1 & 2) for details on the range of this species and of each of the 80 subpopulations identified. Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
National Distribution
Canada
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
© NatureServe
Source:
NatureServe
Trusted
Global Range: During oceanic feeding and maturation, this salmon ranges throughout the North Pacific Ocean, Bering Sea, and eastern Sea of Okhotsk north of 40 degrees north latitude; there is considerable intermingling of Asian and North American populations, and of North American populations from Bering Sea and Gulf of Alaska streams; the range shifts southward for winter, northward during warmer months. Natural lake populations occur in Japan, former USSR, Alaska, Washington, Idaho, Oregon, Yukon, and British Columbia. Anadromous forms occur in Asia from Hokkaido, Japan, to the Anadyr River (spawning mainly on the Kamchatka Peninsula); in North America, anadromous populations range from the Sacramento River, California, north to Point Hope, Alaska (common in north, rare south of Columbia River drainage). Major Alaskan spawning areas are in tributaries and lakes of the Kenai, Chignik, Naknet, Kuichak, Wood, and Kodiak Island river systems. South of Alaska in the Pacific Northwest, the major spawning river is the Fraser River system in British Columbia, with smaller runs in the Baker, Columbia, Cedar, Quinalt, and Ozette rivers in Washington. The Fraser River includes a number of important nursery lakes (Cultus, Adams, Harrison, Horsefly, Shuswap, and Quesnel) and many tributaries that support the major portion of the Pacific Northwest population. In eastern Washington, major nursery lakes for Columbia River are Lake Wenathchee and Osoyoos Lake. In western Washington, major nursery lakes are Quinalt Lake, Ozette Lake, Baker Lake, and Lake Washington. In a 1996 survey of populations in the contiguous U.S., one healthy native stock was identified (Wenatchee River, Washington). The kokanee (lake-stream form) has been introduced in many western states and elsewhere, but most transplants have been unsuccessful in establishing self-sustaining populations.
© NatureServe
Source:
NatureServe
Trusted
Historic Range:
North Pacific Basin from U.S.A. (CA) to Russia
North Pacific Basin from U.S.A. (CA) to Russia
Trusted
North Pacific: northern Japan to Bering Sea and to Los Angeles, California, USA (Ref. 2850). Landlocked populations in Alaska, Yukon Territory and British Columbia in Canada, and Washington and Oregon in USA.
-
Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
http://www.fishbase.org/references/FBRefSummary.php?id=5723&speccode=2590
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 16; Analspines: 0; Analsoft rays: 13 - 18; Vertebrae: 56 - 67
-
Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
http://www.fishbase.org/references/FBRefSummary.php?id=6885&speccode=2594
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Size
Max. size
84.0 cm TL (male/unsexed; (Ref. 5723)); 71 cm (female); max. published weight: 7,710 g (Ref. 40637); max. reported age: 8 years (Ref. 72462)
-
IGFA 2001 Database of IGFA angling records until 2001. IGFA, Fort Lauderdale, USA. (Ref. 40637)
http://www.fishbase.org/references/FBRefSummary.php?id=40637&speccode=943
-
Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
http://www.fishbase.org/references/FBRefSummary.php?id=5723&speccode=2590
-
Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
http://www.fishbase.org/references/FBRefSummary.php?id=72462&speccode=2600
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Diagnostic Description
Both the sockeye and the kokanee are distinguished by the long, fine, serrated, closely spaced gill rakers on the first arch that number between 30 and 40, and by its lack of definite spot on the back and tail (Ref. 27547). Body fusiform, streamlined, laterally compressed, body depth moderate, slightly deeper in breeding males (Ref. 6885). Head bluntly pointed, conical, eye rather small, position variable with sex and condition; snout rather pointed (Ref. 6885). Lateral line straight (Ref. 27547). Pelvic fins with axillary process; caudal emarginate (Ref. 27547). Pre-spawning fish are dark steel blue to greenish blue on the head and back, silvery on the sides and white to silvery on the belly; no definite spots on the back, although some individuals may have dark speckling and irregular marks on the dorsal fin (Ref. 27547). At spawning, the head of the males becomes bright to olive green, with black on the snout and upper jaw; the adipose and anal fins turn red and the paired fins and tail generally become grayish to green or dark; females are generally less brilliantly colored than males (Ref. 27547). Various populations may show less brilliant colors, and a few turn dull green to yellowish, with little if any red (Ref. 27547).
-
Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
http://www.fishbase.org/references/FBRefSummary.php?id=6885&speccode=2594
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Ecology
Habitat
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a life history form called “Kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “Sockeye” or “Red Salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some Sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include Salmon Sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type Sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000–5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Habitat and Ecology
Habitat and Ecology
Systems
The species exhibits a great variety of life history patterns. It has a genetically diverged life history form called “kokanee” that lives its entire life within freshwater, but this assessment includes only anadromous populations commonly referred to as “sockeye” or “red salmon”. Sockeye are born in gravel nests in rivers or lakes and the majority of life history forms rear as juveniles for one to three years in freshwater before migrating to the ocean. Some sockeye assume a river-type life history and rear in a river channel, while others are lake-type and rear in a lake environment. Primary prey during this life history stage include zooplankton and stream invertebrates. Some sea-type populations migrate within one to three months following emergence, and these make extensive use of estuaries. Most populations spend one to three years in offshore feeding areas where they grow to maturity (ca. 50-60 cm total length, 2.5-3.0 kg weight). Diet in the ocean consists primarily of zooplankton (copepods and euphausiids), but their diet also includes squids and fishes. Natural predators during this period in their life history include salmon sharks (Lamna ditropis) and Daggertooth (Anotopterus nikparini). Foraging individuals mix among populations both within and between Asia and North America, but at maturity they all migrate back toward their natal freshwater habitat where they spawn and die. The return to natal habitat and the isolation of spawning populations results in considerable genetic differentiation and adaptation to local conditions. Many fish are intercepted by fishers during the homeward, spawning migration, and natural predators include seals, sea lions and bears. Spawning occurs in late summer and autumn, in lake outlet or lake tributary streams or along lake beaches in finer sediments where subterranean upwelling occurs or among boulders on wave-aerated shores. River-type sockeye spawn in river channels not associated with lakes. Adults display bright red bodies and green heads. Males compete with each other for access to females. Females compete with each other for gravel sites where they build nests, deposit eggs (fecundity typically ranges from 2,000-5,000 eggs), and briefly guard the redd. Median population size for the species is ca. 6,000 individuals. Reviews of life history and ecology of the species appear in Smith et al. (1987), Burgner (1991), Wood (1995) and Quinn (2005).
Systems
- Freshwater
- Marine
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
Depth range based on 4 specimens in 1 taxon.
Environmental ranges
Depth range (m): 0 - 122
Graphical representation
Depth range (m): 0 - 122
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 0 - 122
Graphical representation
Depth range (m): 0 - 122
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Habitat Type: Freshwater
Comments: Nonbreeding adult sockeye salmon are oceanic, with many occurring in nutrient-rich waters of Alaska and the arctic. Kokanee do best in large, cold, mountain lakes (Sigler and Sigler 1987), where the presence of well-oxygenated water is essential (Sublette et al. 1990).. Water temperatures above 60 degrees F (about 15.5 C) lead to significant mortality, especially among the young (see Sublette et al. 1990). Young are not often found in estuarine or inshore waters after reaching the marine environment (Pauley et al. 1989).
Kokanee usually spawn in tributary stream of lake, often in riffle over gravel substrate; sometimes along gravelly shore of lake where seepage outflows, springs, or wind-induced waves occur. Sockeye move up coastal rivers and spawns in streams. Female constructs a redd (several nesting pockets) in gravel (usually) or sand bottom.
© NatureServe
Source:
NatureServe
Trusted
Depth: 0 - 250m.
Recorded at 250 meters.
Habitat: pelagic.
Recorded at 250 meters.
Habitat: pelagic.
© FishWise Professional
Source:
FishWise Professional
Trusted
Environment
pelagic-oceanic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 250 m (Ref. 50550)
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
-
Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
http://www.fishbase.org/references/FBRefSummary.php?id=50550&speccode=4633
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Migration
Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.
Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).
Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.
Anadromous forms migrate from ocean waters up coastal streams and rivers to spawn in natal waters; spend 1-4 years (usually 2 years) in ocean, 2 years in freshwater; ascend river, spend 1-8 months in lake, then move to natal spawning area. Many non-anadromous populations move from lakes into tributary streams to spawn, some remain in lakes. Enters spawning rivers from late spring to midsummer, depending on the population.
© NatureServe
Source:
NatureServe
Trusted
Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Trophic Strategy
Epipelagic (Ref. 58426). There are two forms, the anadromous form known as the sockeye and the landlocked form (with a much smaller maximum size) known as the kokanee (Ref. 27547). Upon emergence from gravel, fry at first tends to avoid light, hiding during the day and emerging at night (Ref. 27547). In some populations, sockeye fry go to the sea during their first summer but most spend one or two (rarely three or four) years in a lake before migrating (Ref. 30333). In a few streams of the Copper River drainage in Alaska, young sockeye stay in the stream (Ref. 27547). Once in the lake, the young spend a few weeks inshore, feeding largely on ostracods, cladocerans and insect larvae. The fish then become pelagic and move offshore, where they feed on plankton in the upper 20 m or so (Ref. 27547). Seaward migration follows with the young individuals first staying fairly close to shore, feeding mainly on zooplankton, but also on small fishes and insects (Ref. 30343, 30346). With growth, they head out to sea and fish become important in the diet (Ref. 27547). Kokanee are confined to lake-stream systems, and most of its life is spent in the lake (Ref. 27547). They feed mainly on plankton, but also take insects and bottom organisms (Ref. 1998). Kokanee, wherever they are native, have been derived from anadromous populations, and each kokanee population apparently has evolved independently from a particular sockeye run (Ref. 30338, 30339). Offspring of kokanee occasionally become anadromous, and sockeye offspring occasionally remain in freshwater (Ref. 27547). Lifespan of the kokanee varies from two to seven years in different stocks (Ref. 27547).
-
Scott, W.B. and E.J. Crossman 1973 Freshwater fishes of Canada. Bull. Fish. Res. Board Can. 184:1-966. (Ref. 1998)
http://www.fishbase.org/references/FBRefSummary.php?id=1998&speccode=2594
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Comments: Kokanee feed on zooplankton. Young sockeye eat primarily planktonic crustaceans. At sea, young sockeye feed on zooplankton, small fishes and insects; as they grow they eat more fish.
© NatureServe
Source:
NatureServe
Trusted
Diseases and Parasites
Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
-
Boustead, N.C. 1993 Detection and New Zealand distribution of Myxobolus cerebralis, the cause of whirling disease of salmonids. N.Z. J. Mar. Freshwat. Res. 27(4):431-436. (Ref. 45510)
http://www.fishbase.org/references/FBRefSummary.php?id=45510&speccode=239
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Enteric Redmouth Disease. Bacterial diseases
-
Horne, M.T. and A.C. Barnes 1999 Enteric redmouth disease (Yersinia ruckeri). p.455-477. In P.T.K. Woo and D.W. Bruno (eds.) Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections. CAB Int'l. (Ref. 48849)
http://www.fishbase.org/references/FBRefSummary.php?id=48849&speccode=35
© WorldFish Center - FishBase
Source:
FishBase
Trusted
General Ecology
Life cycle of sockeye similar to kokanee except sockeye matures in the ocean rather than lakes. Kokanee often travels in large schools. (Sigler and Sigler 1987). Two studies each reported survival rate of 4-20% for marine portion of life cycle (see Pauley et al. 1989). Northern squawfish and rainbow trout may be important predators on young in some lakes. Schools of young in lakes disperse as dusk approaches, reform after dawn (Pauley et al. 1989). In Montana, the introduction of opossum shrimp (Mysis relicta) was followed by an abrupt decline in the kokanee population, apparently due to zooplankton decline caused by shrimp predation (Spencer et al. 1991).
© NatureServe
Source:
NatureServe
Trusted
Life History and Behavior
Cyclicity
Comments: Kokanee: feeding generally heaviest from sundown to dark (Sigler and Sigler 1987). Young sockeye feeding heaviest in afternoon, lightest at night and early morning (Pauley et al. 1989).
© NatureServe
Source:
NatureServe
Trusted
Life Cycle
Adult sockeyes return to natal streams to spawn. This occurs during summer and fall and as late as December in the southern part of the range. The female selects a site, usually with gravel bottom, and digs a nest. During nest building, the female is attended by a dominant male and a few subordinate males. At this stage, females tend to be aggressive toward other females and subordinate males; males are aggressive toward other males. Between digging acts, the female will rest over the pit while the dominant male courts her. Once the nest is completed, the female enters the nest, followed immediately by the dominant male who comes close beside her. Their mouths gape, and the pair vibrates to release eggs and sperm. One or more subordinate males may come to the other side of the female and join in the spawning. The female then moves to the upstream edge of the nest and digs again, covering the old nest, at the same time creating a new one just upstream from the previous one. A female normally needs 3 to 5 days to deposit all her eggs and utilizes 3 to 5 nests for this purpose. She may spawn with several dominant males. A male may breed with several females. All adult sockeye die after spawning (Ref. 27547).Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
-
Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
http://www.fishbase.org/references/FBRefSummary.php?id=27547&speccode=2592
© WorldFish Center - FishBase
Source:
FishBase
Trusted
Reproduction
Anadromous forms migrate from ocean waters up coastal streams and rivers to spawn in natal waters. They spend 1-4 years (usually 2 years) in the ocean before ascending streams (mainly in summer but some stocks as early as winter). Many stocks spawn in fall (peak often in October or November), but spawning extends into winter in some areas. Spawning sites often are in gravel riffles, sometimes along gravelly shores of lakes where seepage outflows, springs, or wind-induced waves occur. Eggs hatch in 6-9 weeks, depending on temperature, and larvae emerge 2-3 weeks later. Sockeye fry move upstream or downstream to nursery lakes, where the young spend 1-2 years (up to 3 or rarely 4 years in some areas of Alaska; usually 1 year in British Columbia) before going to sea, usually in spring; some populations use stream areas for rearing and may migrate to the sea soon after emergence.
Many non-anadromous (kokanee) populations move from lakes into tributary streams to spawn, though some remain in lakes. They enter spawning streams from late spring to midsummer, depending on the population. Kokanee spawn in different areas from August to February, at temperatures of 40-55 F.
© NatureServe
Source:
NatureServe
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Oncorhynchus nerka
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 76 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 76 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC3912-07|NC_008615|Oncorhynchus nerka| ACACGATGATTCTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTCGGCACCGCCCTA---AGCCTACTGATTCGGGCAGAACTAAGCCAGCCAGGCGCTCTTCTAGGAGAT---GACCAGATCTATAACGTAATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATACCAATTATAATCGGAGGATTTGGAAACTGATTAATCCCTCTAATA---ATCGGAGCCCCCGATATGGCATTCCCACGAATAAATAACATAAGCTTCTGACTCCTCCCCCCCTCGTTTCTCCTCCTCCTATCTTCATCTGGAGTTGAAGCCGGCGCTGGTACCGGATGAACAGTTTATCCCCCTCTGGCCGGAAACCTTGCCCACGCGGGAGCCTCTGTTGACTTA---ACCATCTTCTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCCATTAATTTTATCACAACCATTATTAATATGAAGCCCCCAGCCATCTCTCAGTACCAGACCCCACTTTTTGTTTGAGCTGTGCTAATCACTGCTGTACTTCTACTACTTTCCCTACCCGTCCTAGCAGCA---GGCATTACTATGTTACTTACTGACCGAAATTTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCGATTTTATACCAACACCTCTTTTGGTTCTTCGGACACCCAGAGGTATATATTCTTATCCTCCCAGGCTTCGGTATAATTTCACATATCGTTGCATACTACTCCGGCAAAAAA---GAACCATTCGGGTATATAGGAATAGTTTGAGCTATAATAGCCATCGGGTTACTAGGGTTTATCGTTTGAGCCCACCACATGTTCACTGTCGGAATAG
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Oncorhynchus nerka
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 76
Species: 78
Species With Barcodes: 1
Public Records: 76
Species: 78
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Conservation
Conservation Status
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2011
Assessor/s
Rand, P.S.
Reviewer/s
Ruggerone, G. & English, K.
Contributor/s
Goslin, M.
Justification
This subpopulation was evaluated against relevant A, B and D criteria. Recent escapement trends at individual monitoring sites were analyzed and results were scaled upwards to characterize the Red List status of the subpopulation against A2 criterion (i.e., based on the rate of change in adult abundance over three generations, or 12 years for this species). The rate of change applied to this subpopulation, assessed over 8 site(s), was 0%. It therefore qualifies as Least Concern against criterion A2. For evaluation against B2 criterion, we determined that the subpopulation does not quality for listing given stable or increasing adult abundance.The current abundance of mature adults in the subpopulation qualifies it as Least Concern against the D1 criterion. See additional supporting document for data sources, trend model parameters, complete description of methods and assumptions, key threats specific to each threatened and near threatened subpopulation and general conservation measures.
Follow the link below for a PDF of the additional supporting documentation.
Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2011
Assessor/s
Rand, P.S.
Reviewer/s
Ruggerone, G. & English, K.
Contributor/s
Goslin, M.
Justification
This subpopulation was evaluated against relevant A, B and D criteria. Recent escapement trends at individual monitoring sites were analyzed and results were scaled upwards to characterize the Red List status of the subpopulation against A2 criterion (i.e., based on the rate of change in adult abundance over three generations, or 12 years for this species). The rate of change applied to this subpopulation, assessed over 1 site(s), was 1513%. It therefore qualifies as Least Concern against criterion A2. For evaluation against B2 criterion, we determined that the subpopulation does not quality for listing given stable or increasing adult abundance.The current abundance of mature adults in the subpopulation qualifies it as Least Concern against the D1 criterion. See additional supporting document for data sources, trend model parameters, complete description of methods and assumptions, key threats specific to each threatened and near threatened subpopulation and general conservation measures.
Follow the link below for a PDF of the additional supporting documentation.
Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2011
Assessor/s
Rand, P.S.
Reviewer/s
Ruggerone, G. & English, K.
Contributor/s
Goslin, M.
Justification
This subpopulation was evaluated against relevant A, B and D criteria. Recent escapement trends at individual monitoring sites were analyzed and results were scaled upwards to characterize the Red List status of the subpopulation against A2 criterion (i.e., based on the rate of change in adult abundance over three generations, or 12 years for this species). The rate of change applied to this subpopulation, assessed over 1 site(s), was -22%. It therefore qualifies as Least Concern against criterion A2. For evaluation against B2 criterion, we determined that the subpopulation does not quality for listing given stable or increasing adult abundance.The current abundance of mature adults in the subpopulation qualifies it as Least Concern against the D1 criterion. See additional supporting document for data sources, trend model parameters, complete description of methods and assumptions, key threats specific to each threatened and near threatened subpopulation and general conservation measures.
Follow the link below for a PDF of the additional supporting documentation.
Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2011
Assessor/s
Rand, P.S.
Reviewer/s
Ruggerone, G. & English, K.
Contributor/s
Goslin, M.
Justification
This subpopulation was evaluated against relevant A, B and D criteria. Recent escapement trends at individual monitoring sites were analyzed and results were scaled upwards to characterize the Red List status of the subpopulation against A2 criterion (i.e., based on the rate of change in adult abundance over three generations, or 12 years for this species). The rate of change applied to this subpopulation, assessed over 1 site(s), was 998%. It therefore qualifies as Least Concern against criterion A2. For evaluation against B2 criterion, we determined that the subpopulation does not quality for listing given stable or increasing adult abundance.The current abundance of mature adults in the subpopulation qualifies it as Least Concern against the D1 criterion. See additional supporting document for data sources, trend model parameters, complete description of methods and assumptions, key threats specific to each threatened and near threatened subpopulation and general conservation measures.
Follow the link below for a PDF of the additional supporting documentation.
Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
IUCN Red List Assessment
Red List Category
EN
Endangered
Red List Criteria
A2a;B2ab(v)
Version
3.1
Year Assessed
2011
Assessor/s
Rand, P.S.
Reviewer/s
Ruggerone, G. & English, K.
Contributor/s
Goslin, M.
Justification
This subpopulation was evaluated against relevant A, B and D criteria. Recent escapement trends at individual monitoring sites were analyzed and results were scaled upwards to characterize the Red List status of the subpopulation against A2 criterion (i.e., based on the rate of change in adult abundance over three generations, or 12 years for this species). The rate of change applied to this subpopulation, assessed over 1 site(s), was -67%. It therefore qualifies as Endangered against criterion A2. For evaluation against B2 criterion, we estimated the area of occupancy and the number of extant locations for the subpopulation. Area of occupancy was estimated on a one kilometer square grid overlaid on the nursery lake(s) and freshwater river habitat. This surface area estimate is meant to capture habitat occupied for spawning and rearing by both lake- and river-type life histories. The number of extant locations was the sum of the total number of known nursery lakes and distinct spawning regions supporting the subpopulation. The surface area of freshwater habitat supporting this subpopulation (55 km2), the number of extant locations (1 lakes and/or distinct spawning areas), and its observed rate of change in adult abundance described above qualifies this subpopulation as Endangered against the B2ab(v) criteria. The current abundance of mature adults in the subpopulation qualifies it as Least Concern against the D1 criterion. See additional supporting document for data sources, trend model parameters, complete description of methods and assumptions, key threats specific to each threatened and near threatened subpopulation and general conservation measures.
Follow the link below for a PDF of the additional supporting documentation.
Follow the link below for a PDF of the additional supporting documentation.
History
- 2008Critically Endangered(IUCN 2008)
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
IUCN Red List Assessment
Red List Category
LC
Least Concern
Red List Criteria
Version
3.1
Year Assessed
2011
Assessor/s
Rand, P.S.
Reviewer/s
Ruggerone, G. & English, K.
Contributor/s
Goslin, M.
Justification
This subpopulation was evaluated against relevant A, B and D criteria. Recent escapement trends at individual monitoring sites were analyzed and results were scaled upwards to characterize the Red List status of the subpopulation against A2 criterion (i.e., based on the rate of change in adult abundance over three generations, or 12 years for this species). The rate of change applied to this subpopulation, assessed over 13 site(s), was -16%. It therefore qualifies as Least Concern against criterion A2. For evaluation against B2 criterion, we determined that the subpopulation does not quality for listing given stable or increasing adult abundance.The current abundance of mature adults in the subpopulation qualifies it as Least Concern against the D1 criterion. See additional supporting document for data sources, trend model parameters, complete description of methods and assumptions, key threats specific to each threatened and near threatened subpopulation and general conservation measures.
Follow the link below for a PDF of the additional supporting documentation.
Follow the link below for a PDF of the additional supporting documentation.
© International Union for Conservation of Nature and Natural Resources
Source:
IUCN
Trusted
