Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Oncorhynchus mykiss is among the most important game fishes in North America. These common fish are found in cold headwaters, creeks, and small to large rivers, as well as lakes. They are anadromous in coastal streams, moving upstream from the ocean to spawn (unlike salmon, adults usually survive spawning and may breed again). (Page and Burr 1991)

The different forms of Oncorhynchus mykiss are known by different common names. The sea-run Rainbow Trout are known as Steelhead; interior populations are sometimes known as Redband Trout. These fish are highly variable in color, but have small, irregular black spots on the back and most fins. There are radiating rows of black spots on the caudal (tail) fin and a pink to red stripe on the side. Stream and spawning fish have intense dark colors whereas lake fish are light and silvery. The upper jaw reaches barely behind the eye in young and female individuals, but well behind the eye in large males. Sea-run individuals (Steelhead) are silvery and largely lack the pink stripe on the side; they typically develop a more pointed head and grow much larger than Rainbow Trout. (Page and Burr 1991)

Rainbow Trout are native to the Pacific Slope of North America from Alaska and northwestern Canada to Baja California. They have been widely introduced in cold waters elsewhere in North America and the rest of the world. (Page and Burr 1991)

In contrast to the Rainbow Trout, the Golden Trout (O. aguabonita) has a red belly and cheek, a gold lower side, and large black spots on the dorsal and caudal fins (but in some areas where they co-occur, these two species hybridize). The Cutthroat Trout (O. clarki) has an orange or red "cutthroat" mark on the underside of the lower jaw and small teeth on the floor of the mouth between the gill arches (no such teeth are present in Rainbow Trout). Salvelinus species have light spots on a dark background. Salmon have 13 or more anal rays (8 to 12 in Rainbow Trout). (Page and Burr 1991)

For detailed information on the biology and status of this species, including conservation issues, see this resource from the NOAA Fisheries Office of Protected Resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Oncorhynchus mykiss (Walbaum, 1792)

Inland water: 26300-844 (1 spc.), 29.05.1995 , fish farm, Kiyikoey , Kirklareli , Adem Çolak ; 26300-845 (1 spa), 29.05.1995 , fish farm, Kiyikoey , Kirklareli , Adem Çolak .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 37-37, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Inhabits cold headwaters, creeks, small to large rivers, and lakes. Anadromous in coastal streams (Ref. 5723). Stocked in almost all water bodies as lakes, rivers and streams, usually not stocked in water reaching summer temperatures above 25°C or ponds with very low oxygen concentrations. Feeds on a variety of aquatic and terrestrial invertebrates and small fishes. At the sea, preys on fish and cephalopods. Undertakes short spawning migrations. Anadromous and lake forms may migrate long distances to spawning streams (Ref. 59043). Utilized fresh, smoked, canned, and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988). Cultured in many countries and is often hatched and stocked into rivers and lakes especially to attract recreational fishers (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Native to the Pacific coastal inland waters. Introduced into the Atlantic drainages.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to streams along the Pacific coast of North America from the Kuskokwim River, Alaska, south to northern Baja California; also the upper Mackenzie River drainage (Arctic basin), Alberta and British Columbia, and endorheic (i.e. having no outflow of water) basins of southern Oregon (Page and Burr 1991). The species has been widely introduced and established in suitable habitats all over the world (Lee et al. 1980). At sea, O. mykiss occurs throughout the North Pacific above 40° N from the North American coast to the Sea of Okhotsk (Burgner et al. 1992); it is most abundant in the Gulf of Alaska and eastern part of the North Pacific, conforming to the 5°C isotherm in the north and 15°C isotherm in the south. Seasonal shifts in distribution are correlated with changes in water temperature (Sutherland 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
North Pacific Ocean from the Kamchatka Peninsula in Asia to the northern Baja Peninsula

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Oncorhynchus_mykiss are only native to the Pacific Coast of North America, extending from Alaska down to the border between California and Mexico. However, they have been introduced throughout the United States. and in every continent except for Antarctica for game fishing purposes. There are two forms: freshwater resident and anadromous. The resident form is commonly called rainbow trout while the anadromous form is called steelhead.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Native to Pacific Slope from Kuskokwim River, Alaska to (at least) Rio Santa Domingo, Baja California, Mexico; upper Mackenzie River drainage (Arctic basin), Alberta and British Columbia in Canada; endorheic basins of southern Oregon, USA. Widely introduced in cold waters elsewhere in North America and rest of the world (Ref. 5723). Eastern Pacific: Kamchatkan Peninsula and have been recorded from the Commander Islands east of Kamchatka and sporadically in the Sea of Okhotsk as far south as the mouth of the Amur River along the mainland. The records outside Kamchatka probably represent migrating or straying Kamchatkan steelhead (penshinensis) rather than the established native population (Reg. 50080). Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Oncorhynchus mykiss are only native to the Pacific Coast of North America, extending from Alaska down to the border between California and Mexico. However, they have been introduced throughout the United States. and in every continent except for Antarctica for game fishing purposes. There are two forms: freshwater resident and anadromous. The resident form is commonly called rainbow trout while the anadromous form is called steelhead.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific and adjacent basins, introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Physical description varies widely with sex, age, and habitat. In general, they are streamlined, with 8 to 12 spines in the anal fin and lack teeth at the base of the tongue (unlike their close relatives, Oncorhynchus_clarkii). The undersides tend to be silvery with a pinkish red stripe along the upper-middle part of the body, though this stripe can vary from dark to light. Resident rainbows and spawning steelhead tend to be lighter with more pronounced pink stripes, while ocean-going steelhead are darker and silvery to blend into their ocean environment. Most have black spots above the lateral line, and resident rainbows tend to have more intense spotting, well below the lateral line. Juvenile fish have 8 to 13 parr marks on their sides and become silvery as they mature.

Range mass: 25.4 (high) kg.

Average mass: 4 kg.

Range length: 120 (high) cm.

Range basal metabolic rate: 0.6 to 75 cm^3 oxygen/hour.

Average basal metabolic rate: 55 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 12; Analspines: 0; Analsoft rays: 8 - 12; Vertebrae: 60 - 66
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Physical description varies widely with sex, age, and habitat. In general, they are streamlined, with 8 to 12 spines in the anal fin and lack teeth at the base of the tongue (unlike their close relatives, Oncorhynchus clarkii). The undersides tend to be silvery with a pinkish red stripe along the upper-middle part of the body, though this stripe can vary from dark to light. Resident rainbows and spawning steelhead tend to be lighter with more pronounced pink stripes, while ocean-going steelhead are darker and silvery to blend into their ocean environment. Most have black spots above the lateral line, and resident rainbows tend to have more intense spotting, well below the lateral line. Juvenile fish have 8 to 13 parr marks on their sides and become silvery as they mature.

Range mass: 25.4 (high) kg.

Average mass: 4 kg.

Range length: 120 (high) cm.

Range basal metabolic rate: 0.6 to 75 cm^3 oxygen/hour.

Average basal metabolic rate: 55 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 5504)); max. published weight: 25.4 kg (Ref. 7251); max. reported age: 11 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

The natural habitat of the species is freshwater with about 12°C in summer. It is unclear whether its anadromy is a truly genetic adaptation or simply an opportunistic behavior. It seems that any stock of rainbow trout is capable of migrating, or at least adapting to seawater, if the need or opportunity arises. Adults feed upon fish eggs, minnow and other small fish (including other trout); young feed on small insects and crustaceans. Utilized fresh, smoked, canned and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988). Rainbow trout is cultured in many countries and is often hatched and stocked into rivers and lake especially to attract recreational fishermen (Ref. 9988).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Montana: both pure and moderately hybridized populations of westslope cutthroat trout have a high incidence of basibranchial teeth, whereas pure rainbow trout lack these teeth; presence of basibranchial teeth in some individuals of a rainbow trout population indicates hybridization with westslope cutthroat trout (Leary et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Body elongate, somewhat compressed especially in larger fish. No nuptial tubercles but minor changes to head, mouth and color occur especially in spawning males. Coloration varies with habitat, size, and sexual condition. Stream residents and spawners darker, colors more intense. Lake residents lighter, brighter, and more silvery. Caudal fin with 19 rays (Ref. 2196). Differs from Oncorhynchus gorbuscha by having the following unique characters: by having the following unique characters: anal fin with 6-9½ (usually 8½ ) branched rays; 115-130 scales in midlateral row; 16-17 gill rakers; breeding males lacking hump; juveniles lacking parr marks; wide pink to red stripe from head to caudal base, except in sea-run form; and juveniles with 5-10 parr marks (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The natural habitat of the species is fresh water with about 12°C in summer.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Capable of surviving in a wide range of temperature conditions. Does best where dissolved oxygen concentration is at least 7 ppm. Anadromous populations occur in coastal rivers. Resident populations now inhabit small headwater streams, large rivers, lakes, or reservoirs; often in cool clear lakes and cool swift streams with silt-free substrate. In streams, deep low velocity pools are important wintering habitats (Sublette et al. 1990).

Usually requires a gravel stream riffle for successful spawning. Lake populations move to tributaries to spawn. Eggs are laid in gravel in a depression made by the female. Salinity of 8 ppt is the upper limit for normal development of eggs and alevins (Morgan et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Freshwater, brackish, or marine waters of temperate zones. The anadromous form, called steelhead, spawn and complete their early development in freshwater mountain streams, then migrate to spend their adult life in the ocean. In freshwater, they prefer cool water but have been known to tolerate water temperatures up to 24°C (native climates have water temperatures around 12°C in the summer). Productive streams have a good mixture of riffles and pools and overhanging vegetation for shade. Most importantly, they require gravel beds to lay their eggs, and therefore, are sensitive to sedimentation and channel scouring. Juvenile trout prefer protective cover and low velocity water and have been known to be swept away and killed in water that is too fast. Since they are native to the western U.S., then tend to be found in coastal streams and rivers which naturally have reduced flow in summer months.

Range elevation: 0 to 3000 m.

Range depth: 10 to 200 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 200 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Freshwater, brackish, or marine waters of temperate zones. The anadromous form, called steelhead, spawn and complete their early development in freshwater mountain streams, then migrate to spend their adult life in the ocean. In freshwater, they prefer cool water but have been known to tolerate water temperatures up to 24°C (native climates have water temperatures around 12°C in the summer). Productive streams have a good mixture of riffles and pools and overhanging vegetation for shade. Most importantly, they require gravel beds to lay their eggs, and therefore, are sensitive to sedimentation and channel scouring. Juvenile trout prefer protective cover and low velocity water and have been known to be swept away and killed in water that is too fast. Since they are native to the western U.S., then tend to be found in coastal streams and rivers which naturally have reduced flow in summer months.

Range elevation: 0 to 3000 m.

Range depth: 10 to 200 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 29 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.142 - 33

Graphical representation

Depth range (m): 0.142 - 33
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Anadromous forms migrate up to at least hundreds of miles between spawning streams and nonspawning marine waters. Stream-dwelling trout may spend an entire life in few hundred meters of stream (Moyle 1976). Lake-dwelling trout typically migrate to tributaries to spawn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: In lakes, feeds mostly on bottom-dwelling invertebrates (e.g., aquatic insects, amphipods, worms, fish eggs, sometimes small fish) and plankton. In streams, feeds primarily on drift organisms. May ingest aquatic vegetation (probably for attached invertebrates). Diet changes seasonally. In the ocean, the diet consists of fishes and crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Rainbow trout and steelhead are insectivorous and piscivorous. Resident rainbow trout tend to eat more fish than steelhead. Both species primarily feed on invertebrate larvae drifting in mid-water to conserve energy that would be expended if they were foraging for food in the substrate. Young rainbow trout and steelhead eat insect larvae, crustaceans, other aquatic invertebrates, and algae.

Animal Foods: fish; insects; aquatic or marine worms; aquatic crustaceans

Plant Foods: algae

  • Smith, R. 1991. Rainbow Trout (Oncorhynchus mykiss). Pp. 304-323 in J Stoltz, J Schnell, eds. Trout: The Wildlife Series. Harrisburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous (Ref. 5951). Young rainbow trout feed predominantly on zooplankton (Ref. 26523). Rainbow trout of all sizes fed mainly on midge (adults, larvae and pupae). As the fish grew larger, terrestrial prey became the most important food item (Ref. 55755). Possible cohabitation with G. olidus (Ref. 26860). Rainbow trout also have sea dwelling populations known as 'steelhead' (Ref. 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Rainbow trout and steelhead are insectivorous and piscivorous. Resident rainbow trout tend to eat more fish than steelhead. Both species primarily feed on invertebrate larvae drifting in mid-water to conserve energy that would be expended if they were foraging for food in the substrate. Young rainbow trout and steelhead eat insect larvae, crustaceans, other aquatic invertebrates, and algae.

Animal Foods: fish; insects; aquatic or marine worms; aquatic crustaceans

Plant Foods: algae

Primary Diet: carnivore (Insectivore )

  • Smith, R. 1991. Rainbow Trout (Oncorhynchus mykiss). Pp. 304-323 in J Stoltz, J Schnell, eds. Trout: The Wildlife Series. Harrisburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Rainbow trout and steelhead are important predators in their native habitats, they also serve as important sources of food for larger predators.

Commensal/Parasitic Species:

  • sea lamprey (Petromyzon_marinus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

In the Great Lakes, sea lampreys are the most common predators of all Salmonidae species, including rainbow trout. Other predators in both native and introduced habitats include: larger Salmonidae, fish-eating birds like great blue herons (Ardea_herodias), mergansers (Mergus), and kingfishers (Ceryle), and mammals including mink (Mustela_vison and Mustela_lutreola), raccoons (Procyon_lotor), river otters (Lontra), grizzly bears (Ursus_arctos), American black bears (Ursus_americanus), humans, and larger marine mammals who feed on migrating steelhead. Rainbow trout tend to stick to the sides of streams and rivers where shading is prevalent, the water is less swift, and protection is greatest. Trout species are vigilant and capable of rapid swimming to escape predation.

Known Predators:

  • kingfishers (Ceryle)
  • grizzly bears (Ursus_arctos)
  • American black bears (Ursus_americanus)
  • river otters (Lontra_canadensis)
  • mink (Mustela_vison and Mustela_lutreola)
  • raccoons (Procyon_lotor)
  • sea lampreys (Petromyzon_marinus)
  • mergansers (Mergus_merganser)
  • great blue herons (Ardea_herodias)
  • other trout species (Salmonidae)
  • humans (Homo_sapien)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Salmo gairdneri

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Rainbow trout and steelhead are important predators in their native habitats, they also serve as important sources of food for larger predators.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

In the Great Lakes, sea lampreys are the most common predators of all salmonid species, including rainbow trout. Other predators in both native and introduced habitats include: larger trout, fish-eating birds like great blue herons (Ardea herodias), mergansers (Mergus), and kingfishers (Ceryle), and mammals including mink (Neovison vison and Mustela lutreola), raccoons (Procyon lotor), river otters (Lontra), grizzly bears (Ursus arctos), American black bears (Ursus americanus), humans, and larger marine mammals who feed on migrating steelhead. Rainbow trout tend to stick to the sides of streams and rivers where shading is prevalent, the water is less swift, and protection is greatest. Trout species are vigilant and capable of rapid swimming to escape predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Proliferative Kidney Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hysterothylacium Infection (Hysterothylacium sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Camallanus Infection 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aeromonosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

In a survey of populations in the contiguous U.S., Huntington et al. (1996) identified 28 healthy native stocks of winter steelhead (20 in Washington, 7 in Oregon, 1 in California) and 6 healthy native stocks of summer steelhead, all in Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size for all subspecies and stocks greatly exceeds 1 million.

Total annual abundance for all North American steelhead stocks was estimated at 1.6 million fish (Burgner et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Normal life span 5-6 years (Simpson and Wallace 1982). Predation by Caspian terns and double-crested cormorants causes significant mortality of juvenile steelhead in the Columbia River estuary (Ryan et al. 2003). Aggressively defends feeding territories in streams. Has caused contraction of range of native brook trout in southern Appalachian Mountains region (Larson and Moore 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Adults feed on aquatic and terrestial insects, molluscs, crustaceans, fish eggs, minnows, and other small fishes (including other trout); young feed predominantly on zooplankton
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

There is little communication between rainbow trout and steelhead. Once the fry emerge from the gravel, they become hostile to each other and compete for habitat. Larger fish usually win out the best habitat and food sources, and there is a size hierarchy within aquatic systems among all trout species. Potential mates communicate before spawning with visual cues. Oncorhynchus_mykiss individuals are visual predators, relying on a keen sense of vision to detect prey. Salmonidae species use both chemical cues and detection of the earth's magnetic fields to navigate to and from natal streams and on ocean journeys.

Communication Channels: visual ; tactile

Perception Channels: visual ; magnetic

  • Grubb, T. 2003. The Mind of the Trout: A Cognitive Ecology for Biologists and Anglers. Madison, WI: The University of Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

There is little communication between rainbow trout and steelhead. Once the fry emerge from the gravel, they become hostile to each other and compete for habitat. Larger fish usually win out the best habitat and food sources, and there is a size hierarchy within aquatic systems among all trout species. Potential mates communicate before spawning with visual cues. Oncorhynchus mykiss individuals are visual predators, relying on a keen sense of vision to detect prey. Trout species use both chemical cues and detection of the earth's magnetic fields to navigate to and from natal streams and on ocean journeys.

Communication Channels: visual ; tactile

Perception Channels: visual ; magnetic

  • Grubb, T. 2003. The Mind of the Trout: A Cognitive Ecology for Biologists and Anglers. Madison, WI: The University of Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: May feed at any time throughout a 24-hour period, but usually feeds most actively around dusk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Oncorhynchus_mykiss larvae go through a series of morphological changes to prepare for life in the sea, and spend their adult life there for 2 to 3 years before migrating upstream to spawn in their natal stream.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reported not to establish breeding populations if the peak emergence of fry corresponds to flood season and cold summer temperatures and if temperature does not fall below 13° C (Ref. 59043). Males mature generally at 2 years and females at 3. Spawning happens from November until May in the Northern hemisphere and from August to November on the Southern hemisphere. The size of the eggs depends on the size of the female. In captivity spawning is fostered by abdominal massage. Egg size 3-6 mm, fry length after hatching 12-20 mm. Hatchlings are well developed and equipped with a large yolk sac. The female finds a spot and digs a pit. While digging, an attendant male courts her or is busy driving away other males. As soon as the pit is completed, the female drops into it and is immediately followed by the male. The pair is side by side, they open their mouth, quiver and release egg and sperm. Females produce from 700 to 4,000 eggs per spawning event (Ref. 4706). At this point, a subordinate male moves in and releases sperm into the nest. The female quickly moves to the upstream edge of the nest and starts digging a new pit, covering the eggs. The whole process is repeated for several days until the female deposits all her eggs (Ref. 27547). Young fish move downstream at night, shortly after emergence (Ref. 4706). Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Oncorhynchus mykiss larvae go through a series of morphological changes to prepare for life in the sea, and spend their adult life there for 2 to 3 years before migrating upstream to spawn in their natal stream.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Oncorhynchus_mykiss individuals live for 6 to 8 years in the wild, possibly up to 11 years.

Range lifespan

Status: wild:
11 (high) years.

Typical lifespan

Status: wild:
6 to 8 years.

  • Michigan Department of Natural Resources. 2005. "Steelhead: Oncorhynchus Mykiss" (On-line). Accessed October 07, 2005 at http://www.michigan.gov/dnr/0,1607,7-153-10364_18958-45692--,00.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Oncorhynchus mykiss individuals live for 6 to 8 years in the wild, possibly up to 11 years.

Range lifespan

Status: wild:
11 (high) years.

Typical lifespan

Status: wild:
6 to 8 years.

  • Michigan Department of Natural Resources. 2005. "Steelhead: Oncorhynchus Mykiss" (On-line). Accessed October 07, 2005 at http://www.michigan.gov/dnr/0,1607,7-153-10364_18958-45692--,00.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns usually in spring (February-June), or later depending on water temperature and location. Lays 200-9000 eggs (Wydoski and Whitney 1979), which hatch in 3-4 weeks at 10-15 C. Fry emerge from gravel 2-3 weeks after hatching. Many are sexually mature in 2-3 years. See Stearley (1992) for a discussion of the historical ecology and life history evolution of Pacific salmons and trouts (Oncorhynchus).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female fish find suitable nest sites while their male mate guards the site from other interested males and predators. The female digs the nest (called a redd) with her anal fin and then descends upon it to position her vent and anal fin into the deepest part of the redd. The male joins her in a parallel position so that their vents are opposite each other. The male and female open their mouths, arch their backs, and deposit the eggs and milt (fish sperm) at the same time. The eggs are enveloped in a cloud of milt and are fertilized. Only a few seconds elapse from the time the female drops into the redd and fertilization occurs. The female then covers the nest with gravel and repeats the process again a few times until she has deposited all of her eggs.

Mating System: polygynous

Adult rainbow trout and steelhead lay their eggs in a series of nests in gravel. Collectively, the nests are called a redd. When they hatch, the hatchlings are still attached to, and survive on their yok sac. They remain in the protective gravel for about 2 to 3 weeks when they have shed their yolk sacs and are fit enough to survive in the open water. Juvenile fish tend to stick to shallow and side areas of the streams where there is protective cover and slow-moving currents. The remain in their native streams for 1 to 3 years while they grow fit enough to spawn or migrate to the ocean, in the case of steelheads.

Breeding interval: Rainbow trout breed every three to five years. Though steelhead are one of the only salmonids able to spawn twice in a lifetime, the return rate is very low, about 10-20%

Breeding season: Spawning occurs from March to July, depending on temperature and other climatic variables. Winter steelhead in California start spawning as early as January.

Range number of offspring: 200 to 8000.

Range time to hatching: 3 to 16 weeks.

Range time to independence: one to three years.

Range age at sexual or reproductive maturity (female): 3 to 11 years.

Range age at sexual or reproductive maturity (male): 3 to 11 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Average number of offspring: 3500.

Female rainbow trout and steelehead simply lay their eggs in a gravel bed and leave the young hatchlings to mature on their own. Male steelhead frequently breed with multiple female partners, possibly because more females than males die during the breeding period.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); inherits maternal/paternal territory

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female fish find suitable nest sites while their male mate guards the site from other interested males and predators. The female digs the nest (called a redd) with her anal fin and then descends upon it to position her vent and anal fin into the deepest part of the redd. The male joins her in a parallel position so that their vents are opposite each other. The male and female open their mouths, arch their backs, and deposit the eggs and milt (fish sperm) at the same time. The eggs are enveloped in a cloud of milt and are fertilized. Only a few seconds elapse from the time the female drops into the redd and fertilization occurs. The female then covers the nest with gravel and repeats the process again a few times until she has deposited all of her eggs.

Mating System: polygynous

Adult rainbow trout and steelhead lay their eggs in a series of nests in gravel. Collectively, the nests are called a redd. When they hatch, the hatchlings are still attached to, and survive on their yok sac. They remain in the protective gravel for about 2 to 3 weeks when they have shed their yolk sacs and are fit enough to survive in the open water. Juvenile fish tend to stick to shallow and side areas of the streams where there is protective cover and slow-moving currents. The remain in their native streams for 1 to 3 years while they grow fit enough to spawn or migrate to the ocean, in the case of steelheads.

Breeding interval: Rainbow trout breed every three to five years. Though steelhead are one of the only salmonids able to spawn twice in a lifetime, the return rate is very low, about 10-20%

Breeding season: Spawning occurs from March to July, depending on temperature and other climatic variables. Winter steelhead in California start spawning as early as January.

Range number of offspring: 200 to 8000.

Range time to hatching: 3 to 16 weeks.

Range time to independence: one to three years.

Range age at sexual or reproductive maturity (female): 3 to 11 years.

Range age at sexual or reproductive maturity (male): 3 to 11 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Average number of offspring: 3500.

Female rainbow trout and steelehead simply lay their eggs in a gravel bed and leave the young hatchlings to mature on their own. Male steelhead frequently breed with multiple female partners, possibly because more females than males die during the breeding period.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); inherits maternal/paternal territory

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fish respond to magnetic fields: rainbow trout
 

The trigeminal cranial nerve of rainbow trout helps them detect magnetic fields by containing magnetosensitive nerve fibers.

   
  "In 1997, the first known magnetoreceptors -- directly linking magnetite to neural connections and activity -- were found in vertebrates. A team of zoologists from Auckland University, led by Dr. Michael Walker, had been studying this mysterious sense in trout, and knew that a region of its skull contained magnetite.

"Recording neural activity from that region, they discovered that a specific subgroup of nerve fibers within a branch of the trigeminal cranial nerve called the ros V nerve fired in response to changes in the surrounding magnetic field. They also found magnetite in a tissue layer directly beneath the trout's olfactory (smell) organs. When they injected a colored dye into the ros V nerve's newly exposed magnetosensitive fibers, the dye revealed that the fibers terminated and ramified all around the magnetite-containing cells within the trout's olfactory tissue." (Shuker 2001:46)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
  • Bohannon, J. 2007. MICHAEL WALKER: Seeking Nature's Inner Compass. Science. 5852(318): 904-907.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Crystals create iridescent sheen: rainbow trout
 

The scales of a rainbow trout have a silvery shine due to guanine crystals.

   
  "The scales of a rainbow trout, reflective yet translucent. The silvery lustre is due to crystals of guanine, produced in the body as a waste product. The tiny black speckles are pigment cells, and at intervals there are large clusters of these where the pigment is distributed right across each cell, instead of only in the centre; here we get the large black patches which produce colour changes in response to hormones released during the breeding season - hence the name rainbow trout. The overlapping scales form a waterproof armour which is flexible enough to allow for the flexing of the body during swimming." (Foy and Oxford Scientific Films 1982:87)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus mykiss

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 263 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTGAGTCTACTGATTCGGGCGGAACTAAGCCAGCCGGGCGCTCTTCTGGGGGAT---GACCAAATCTATAACGTGATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATGCCAATTATAATCGGGGGCTTTGGAAACTGATTAATTCCCCTAATAATCGGAGCCCCTGATATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCTCCATCCTTTCTCCTCCTCCTGTCTTCATCAGGAGTTGAAGCCGGCGCGGGTACTGGATGAACAGTATACCCCCCTCTAGCCGGCAACCTCGCCCACGCAGGAGCCTCTGTTGATTTAACTATCTTCTCCCTTCATTTAGCTGGAATCTCCTCAATTTTAGGAGCCATTAATTTTATTACGACCATTATTAACATAAAACCTCCAGCCATCTCTCAGTACCAAACCCCCCTATTCGTTTGAGCCGTGCTAGTTACTGCTGTCCTTCTGTTACTTTCCCTCCCCGTCCTGGCAGCAGGCATTACTATGTTACTTACAGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCAATTTTATACCAACACCTCTTTTGATTCTTCAGCCACCCAGAGGTCTATATTCTCATCCTCCCAGGCTTTGGTATAATTTCACACATCGTTGCGTACTACTCCGGCAAAAAGGAACCCTTCGGGTATATAGGAATGGTCTGAGCTATAATAGCCATCGGGTTGTTAGGATTTATCGTTTGAGCCCACCATATGTTCACTGTAGGGATAGACGTGGACACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus mykiss

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 263
Specimens with Barcodes: 336
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Very large range; abundant; secure on a range-wide scale. See also information for the many subspecies and stocks (e.g., steelhead, redband trout, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: southern CA coast

Status: Threatened
Date Listed: 09/07/2000
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: northern CA

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: upper Willamette R.

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Central Valley CA

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: central CA coast

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: south central CA coast

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Snake R. Basin

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: middle Columbia R.

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: lower Columbia R.

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: upper Columbia R. Basin

Status: Under Review
Date Listed:
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Klamath Mountains Province


Population detail:

Population location: All naturally spawned populations and their progeny in river basins from Redwood Creek in Humboldt County, CA to the Gualala River in Mendocino County, CA (inclusive)
Listing status: T

Population location: All naturally spawned populations (and their progeny) in rivers from the Santa Maria R., San Luis Obispo County, CA (inclusive) to Malibu Cr., Los Angeles County, CA (inclusive)
Listing status: E

Population location: All naturally spawned populations (and their progeny) in streams and tributaries to the Columbia R. between the Cowlitz and Wind Rivers, WA, inclusive, and the Willamette and Hood Rivers, OR, inclusive, excluding the Upper Willamette River Basin above Willamette Falls and excluding the Little and Big White Salmon Rivers in WA
Listing status: T

Population location: All naturally spawned populations (and their progeny) in streams from the Pajaro R. (inclusive) located in Santa Cruz County, CA, to (but not including) the Santa Maria R
Listing status: T

Population location: All naturally spawned populations (and their progeny) in streams from the Russian R. to Aptos Cr., Santa Cruz County, CA (inclusive), and the drainages of San Francisco and San Pablo Bays eastward to the Napa R. (inclusive), Napa County, CA, excluding the Sacramento-San Joaquin R. Basin of the Central Valley of CA
Listing status: T

Population location: All naturally spawned populations (and their progeny) in streams in the Snake R. Basin of southeast WA, northeast OR, and ID
Listing status: T

Population location: All naturally spawned populations (and their progeny) in the Sacramento and San Joaquin Rivers and their tributaries, excluding San Francisco and San Pablo Bays and their tributaries
Listing status: T

Population location: All naturally spawned populations (and their progeny) in the Upper Columbia R. Basin upstream from the Yakima R., WA, to the U.S./Canada border, and also including the Wells Hatchery stock
Listing status: T

Population location: U.S.A. (OR) All naturally spawned winter-run populations in the Willamette R. and its tributaries from Willamette Falls to the Calapooia R., inclusive
Listing status: T

Population location: U.S.A. (OR, WA) All naturally spawned populations in streams above and excluding the Wind R. in Washington, and the Hood R. in Oregon, upstream to, and including, the Yakima R. Excluded are steelhead from the Snake R. Basin
Listing status: T

For most current information and documents related to the conservation status and management of Oncorhynchus mykiss, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Steelhead are endangered in Washington and California, and threatened in California, Oregon, Washington, and Idaho. Most of their decline has resulted from impacts to habitat and shrinking of spawning routes due to dams and other diversions. Siltation, caused by forestry practices, and erosion, caused by urban and agricultural development, has also impacted spawning beds.

IUCN Red List of Threatened Species: no special status

US Federal List: endangered

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Steelhead are endangered in Washington and California, and threatened in California, Oregon, Washington, and Idaho. Most of their decline has resulted from impacts to habitat and shrinking of spawning routes due to dams and other diversions. Siltation, caused by forestry practices, and erosion, caused by urban and agricultural development, has also impacted spawning beds.

US Federal List: endangered

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: On a range-wide scale, this species is not significantly threatened. However, many subspecies and populations face serious threats (see separate accounts).

Declines in winter steelhead stocks from the Siuslaw River north to Tillamook Bay, Oregon, may have resulted from deterioration of ocean feeding conditions, widespread use of hatchery stock, predation by marine mammals, and ocean drift-net fishing (Nehlsen et al. 1991). Declining winter catches on the Illinois River (tributary to the Rogue River), Oregon, since the mid-1970s have been attributed to water withdrawal for irrigation (Nehlsen et al. 1991). In the Columbia River basin, winter stocks are threatened by habitat degradation, main stem passage problems, and interactions with hatchery fish (Nehlson et al. 1991). Declines in several winter populations in the Puget Sound area of Washington have resulted from habitat degradation (e.g., water quality problems, siltation, and sedimentation); predation by sea lions has been reported as a problem for the Lake Washington population (Nehlsen et al. 1991). Whirling disease has caused population declines in some areas. The disease is caused by a protozoan pathogen (inadvertently introduced from Europe) and involves tubifex worms as an alternate host. Brown trout (Salmo trutta) are unaffected by the protozoan and serve as a reservoir.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: A management concern in the West: keeping rainbow trout out of waters inhabited by native salmonids such as cutthroat trout and Gila trout so that the native species maintain their genetic integrity.

Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Important game fish. Various populations have been cultured and introduced due to unique qualities (e.g., large lake form Kamloops; Eagle Lake rainbow, adapted to alkaline waters and usually piscivorous; Arlee strain, noted for fast growth, disease resistance, and high catchability (Sublette et al. 1990). Used in carcinogen testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Rainbow trout have been introduced throughout the world, negatively impacting species of native freshwater fishes and, therefore, native fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These fish are one of the most popular game fishes around the world, leading to nearly global introduction. They are introduced to stimulate local angling and associated recreational economies. However, where they are introduced, they can outcompete native trout species.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Rainbow trout have been introduced throughout the world, negatively impacting species of native freshwater fishes and, therefore, native fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These fish are one of the most popular game fishes around the world, leading to nearly global introduction. They are introduced to stimulate local angling and associated recreational economies. However, where they are introduced, they can outcompete native trout species.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Species Impact: Smolt-to-adult survival of spring/summer run chinook salmon is negatively associated with releases of hatchery-reared steelhead in the Snake River (Levin and Williams 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rainbow trout

"Steelhead" redirects here. For other uses, see Steelhead (disambiguation).

The rainbow trout (Oncorhynchus mykiss) is a species of salmonid native to cold-water tributaries of the Pacific Ocean in Asia and North America. The steelhead (sometimes "steelhead trout") is an anadromous (sea-run) form of the coastal rainbow trout (O. m. irideus) or Columbia River redband trout (O. m. gairdneri) that usually returns to fresh water to spawn after living two to three years in the ocean. Freshwater forms that have been introduced into the Great Lakes and migrate into tributaries to spawn are also called steelhead.

Adult freshwater stream rainbow trout average between 1 and 5 lb (0.5 and 2.3 kg), while lake-dwelling and anadromous forms may reach 20 lb (9.1 kg). Coloration varies widely based on subspecies, forms and habitat. Adult fish are distinguished by a broad reddish stripe along the lateral line, from gills to the tail, which is most vivid in breeding males.

Wild-caught and hatchery-reared forms of this species have been transplanted and introduced for food or sport in at least 45 countries and every continent except Antarctica. Introductions to locations outside their native range in the United States (U.S.), Southern Europe, Australia and South America have damaged native fish species. Introduced populations may impact native species by preying on them, out-competing them, transmitting contagious diseases (such as whirling disease), or hybridizing with closely related species and subspecies, thus reducing genetic purity. Other introductions into waters previously devoid of any fish species or with severely depleted stocks of native fish have created world-class sport fisheries such as the Great Lakes and Wyoming's Firehole River.

Some local populations of specific subspecies, or in the case of steelhead, distinct population segments, are listed as either threatened or endangered under the Endangered Species Act. The steelhead is the official state fish of Washington.[2]

Taxonomy[edit]

The scientific name of the rainbow trout is Oncorhynchus mykiss.[3] The species was originally named by German naturalist and taxonomist Johann Julius Walbaum in 1792 based on type specimens from the Kamchatka Peninsula in Siberia. Walbaum's original species name, mykiss, was derived from the local Kamchatkan name used for the fish, mykizha. The name of the genus is from the Greek onkos ("hook") and rynchos ("nose"), in reference to the hooked jaws of males in the mating season (the "kype").[4]

Sir John Richardson, a Scottish naturalist, named a specimen of this species Salmo gairdneri in 1836 to honor Meredith Gairdner, a Hudson's Bay Company surgeon at Fort Vancouver on the Columbia River who provided Richardson with specimens.[5] In 1855, William P. Gibbons, the curator of Geology and Mineralogy[6] at the California Academy of Sciences, found a population and named it Salmo iridia (Latin: rainbow), later corrected to Salmo irideus. These names faded once it was determined that Walbaum's description of type specimens was conspecific and therefore had precedence.[7] In 1989, morphological and genetic studies indicated that trout of the Pacific basin were genetically closer to Pacific salmon (Oncorhynchus species) than to the Salmosbrown trout (Salmo trutta) or Atlantic salmon (Salmo salar) of the Atlantic basin.[8] Thus, in 1989, taxonomic authorities moved the rainbow, cutthroat and other Pacific basin trout into the genus Oncorhynchus.[4] Walbaum's name had precedence, so the species name Oncorhynchus mykiss became the scientific name of the rainbow trout. The previous species names irideus and gairdneri were adopted as subspecies names for the coastal rainbow and Columbia River redband trout, respectively.[4] Anadromous forms of the coastal rainbow trout (O. m. irideus) or redband trout (O. m. gairdneri) are commonly known as steelhead.[3]

Subspecies[edit]

Subspecies of Oncorhynchus mykiss are listed below as described by fisheries biologist Robert J. Behnke (2002).[9]

Geographical groupCommon nameScientific nameRangeImage
Type subspeciesKamchatkan rainbow troutO. m. mykiss (Walbaum, 1792)Western Pacific: Kamchatka Peninsula, and has been recorded from the Commander Islands east of Kamchatka, and sporadically in the Sea of Okhotsk, as far south as the mouth of the Amur River
Coastal formsCoastal rainbow troutO. m. irideus (Gibbons, 1855)Pacific Ocean tributaries from Aleutian Islands in Alaska south to Southern California. Anadromous forms are known as steelhead, freshwater forms as rainbow trout.Lake Washington Ship Canal Fish Ladder pamphlet - ocean phase Steelhead.jpg
Lake Washington Ship Canal Fish Ladder pamphlet - male freshwater phase Steelhead.jpg
Ocean and fresh water forms of coastal rainbow trout; aka "steelhead"
O. m. irideus
Beardslee troutO. m. irideus var. beardsleei (not a true subspecies, but a genetically unique lake-dwelling variety of coastal rainbow trout) (Jordan, 1896)[10]Isolated in Lake Crescent, Washington
Redband formsColumbia River redband troutO. m. gairdneri (Richardson, 1836)Found in the Columbia River and its tributaries in Montana, Washington and Idaho. Anadromous forms are known as redband steelhead.Redbandfish.jpg
Columbia River redband trout
O. m. gairdneri
Athabasca rainbow troutO. m. spp., considered by Behnke as a form of O. m. gairdneri, but considered a separate subspecies by biologist L. M. Carl of the Ontario Ministry of Resources, Aquatic Ecosystems Research Section and associates from work published in 1994.[11]Distributed throughout the headwaters of the Athabasca River system in Alberta
McCloud River redband troutO. m. stonei (Jordan, 1894)Native to the McCloud River, upstream of Middle Falls, and its tributaries in Northern California, south of Mount Shasta.
Sheepheaven Creek redband troutO. m. spp.Native to Sheepheaven Creek, Siskiyou County, California. Sheepheaven Creek redband were transplanted into Swamp Creek in 1972 and 1974 and into Trout Creek in 1977.
Great Basin redband troutO. m. newberrii (Girard, 1859)Native in southeastern Oregon and parts of California and Nevada on the periphery of the Great Basin.
Eagle Lake troutO. m. aquilarum (Snyder, 1917)Endemic to Eagle Lake in Lassen County, California.
Kamloops rainbow troutO. m. kamloops strain (Jordan, 1892)Native to several large British Columbia lakes, particularly Kamloops lake and Kootenay Lake. Known for its very large size.
Kern River golden troutGolden troutO. m. aguabonita (Jordan, 1892)Native to Golden Trout Creek (tributary to the Kern River), Volcano Creek (tributary to Golden Trout Creek), and the South Fork Kern River.Goldentroutwiki.jpg
Kern River golden trout
O. m. aguabonita
Kern River rainbow troutO. m. gilberti (Jordan, 1894)Endemic to the Kern River and tributaries in Tulare County, California. Its current range is drastically reduced from its historic range. Remnant populations live in the Kern River above Durrwood Creek, in upper Ninemile, Rattlesnake and Osa creeks, and possibly in upper Peppermint Creek.
Little Kern golden troutO. m. whitei (Evermann, 1906)Endemic to about 100 miles (160 km) of the Little Kern River and tributaries. Their current range is restricted to five headwater streams in the Kern River basin (Wet Meadows, Deadman, Soda Spring, Willow, Sheep and Fish creeks) plus an introduced population in Coyote Creek, a tributary of the Kern River.[12]
Mexico formsMexican rainbow trout
Rio Yaqui, Rio Mayo and Guzman trout
Rio San Lorenzo and Arroyo la Sidra trout
Rio del Presidio trout
O. m. nelsoni (Evermann, 1908)Sometimes referred to as Nelson's trout, occurs in three distinct geographic groups. The taxonomy of these trout is subject to ongoing research and there may be significant diversity of forms in this group.[13]
Mutated formsGolden rainbow trout
Palomino trout
So-called golden rainbow trout or palomino trout are bred from a single mutated color variant of O. mykiss that originated in a West Virginia fish hatchery in 1955.[14][15] Golden rainbow trout are predominantly yellowish, lacking the typical green field and black spots but retaining the diffuse red stripe.[15] The palomino trout is a mix of golden and common rainbow trout, resulting in an intermediate color. The golden rainbow trout is not the same subspecies as the naturally occurring O. m. aguabonita, the Kern River golden trout of California.[15]Golden Rainbow Trout Cropped.jpg
Golden rainbow trout[16]

Description[edit]

Resident freshwater rainbow trout adults average between 1 and 5 lb (0.45 and 2.27 kg) in riverine environments, while lake-dwelling and anadromous forms may reach 20 lb (9.1 kg). Coloration varies widely between regions and subspecies. Adult freshwater forms are generally blue-green or olive green with heavy black spotting over the length of the body. Adult fish have a broad reddish stripe along the lateral line, from gills to the tail, which is most pronounced in breeding males.[9] The caudal fin is squarish and only mildly forked. Lake-dwelling and anadromous forms are usually more silvery in color with the reddish stripe almost completely gone. Juvenile rainbow trout display parr marks (dark vertical bars) typical of most salmonid juveniles. In some redband and golden trout forms parr marks are typically retained into adulthood.[17] Some coastal rainbow trout (O. m. irideus) and Columbia River redband trout (O. m. gairdneri) populations and cutbow hybrids may also display reddish or pink throat markings similar to cutthroat trout.[18] In many jurisdictions, hatchery-bred trout can be distinguished from native trout via fin clips,[19] typically placed on the adipose fin.[20]

Life cycle[edit]

Rainbow trout, including steelhead forms, generally spawn in early to late spring (January to June in the Northern Hemisphere and September to November in the Southern Hemisphere) when water temperatures reach at least 42 to 44 °F (6 to 7 °C).[21] The maximum recorded lifespan for a rainbow trout is 11 years.[22]

Freshwater life cycle[edit]

Photo of two pair of spawning steelhead in stream
Spawning steelhead
line drawing of alevin and eggs
eggs in gravel and rainbow trout alevin
photo of juvenile rainbow trout
Typical juvenile rainbow trout showing parr marks
Photo of adult rainbow trout
Typical adult rainbow trout

Freshwater resident rainbow trout usually inhabit and spawn in small to moderately large, well oxygenated, shallow rivers with gravel bottoms. They are native to the alluvial or freestone streams that are typical tributaries of the Pacific basin, but introduced rainbow trout have established wild, self-sustaining populations in other river types such as bedrock and spring creeks. Lake resident rainbow trout are usually found in moderately deep, cool lakes with adequate shallows and vegetation to support production of sufficient food sources. Lake populations generally require access to gravelly bottomed streams to be self-sustaining.[23]

Spawning sites are usually a bed of fine gravel in a riffle above a pool. A female trout clears a redd in the gravel by turning on her side and beating her tail up and down. Female rainbow trout usually produce 2000 to 3000 4-to-5-millimetre (0.16 to 0.20 in) eggs per kilogram of weight.[24] During spawning, the eggs fall into spaces between the gravel, and immediately the female begins digging at the upstream edge of the nest, covering the eggs with the displaced gravel. As eggs are released by the female, a male moves alongside and deposits milt (sperm) over the eggs to fertilize them. The eggs usually hatch in about four to seven weeks although the time of hatching varies greatly with region and habitat. Newly hatched trout are called sac-fry or alevin. In approximately two weeks, the yolk sac is completely consumed and fry commence feeding mainly on zooplankton. The growth rate of rainbow trout is variable with area, habitat, life history and quality and quantity of food.[25] As fry grow, they begin to develop "parr" marks or dark vertical bars on their sides. In this juvenile stage, immature trout are often called "parr" because of the marks. These small juvenile trout are sometimes called fingerlings because they are approximately the size of a human finger. In streams where rainbow trout are stocked for sport fishing but no natural reproduction occurs, some of the stocked trout may survive and grow or "carryover" for several seasons before they are caught or perish.[26]

Photo of Steelhead from Lake Erie
Steelhead from Lake Erie
Drawing of ocean phase of male steelhead
Male ocean-phase steelhead
Drawing of freshwater spawning phase of male steelhead
Male spawning-phase steelhead

Steelhead life cycle[edit]

See also: Salmon run

The oceangoing (anadromous) form, including those returning for spawning, are known as steelhead in Canada and the U.S.[27] In Tasmania they are commercially propagated in sea cages and are known as ocean trout, although they are the same species.[28]

Like salmon, steelhead return to their original hatching grounds to spawn. Similar to Atlantic salmon, but unlike their Pacific Oncorhynchus salmonid kin, steelhead are iteroparous (able to spawn several times, each time separated by months) and make several spawning trips between fresh and salt water, although fewer than 10 percent of native spawning adults survive from one spawning to another.[29] The survival rate for introduced populations in the Great Lakes is as high as 70 percent. As young steelhead transition from freshwater to saltwater, a process called "smoltification" occurs where the trout undergoes physiological changes to allow it to survive in sea water.[30] There are genetic differences between freshwater and steelhead populations that may account for the smoltification in steelheads.[31]

Juvenile steelhead may remain in the river for one to three years before smolting and migrating to sea. Individual steelhead populations leave the ocean and migrate into their freshwater spawning tributaries at different times of the year. Two general forms exist—"summer-run steelhead" and "winter-run steelhead". Summer-run fish leave the ocean between May and October, before their reproductive organs are fully mature. They mature in fresh water while en route to spawning grounds where they spawn in the spring. Summer-run fish generally spawn in longer, more inland rivers such as the Columbia River. Winter-run fish are ready to spawn when they leave the ocean, typically between November and April, and spawn shortly after returning to fresh water. Winter-run fish generally spawn in shorter, coastal rivers typically found along the Olympic Peninsula and British Columbia coastline,[21] and summer-run fish are found in some shorter, coastal streams.[32] Once steelhead enter riverine systems and reach suitable spawning grounds, they spawn just like resident freshwater rainbow trout.[21]

Feeding[edit]

Rainbow trout are predators with a varied diet and will eat nearly anything they can capture. They are not as piscivorous or aggressive as brown trout or chars. Rainbow trout, including juvenile steelhead in fresh water, routinely feed on larval, pupal and adult forms of aquatic insects (typically caddisflies, stoneflies, mayflies and aquatic diptera). They also eat fish eggs and adult forms of terrestrial insects (typically ants, beetles, grasshoppers and crickets) that fall into the water. Other prey include small fish up to one-third of their length, crayfish, shrimp, and other crustaceans. As rainbow trout grow, the proportion of fish consumed increases in most populations. Some lake-dwelling forms may become planktonic feeders. In rivers and streams populated with other salmonid species, rainbow trout eat varied fish eggs, including those of salmon, brown and cutthroat trout, mountain whitefish and the eggs of other rainbow trout. Rainbows also consume decomposing flesh from carcasses of other fish. Adult steelhead in the ocean feed primarily on other fish, squid and amphipods.[33]

Range[edit]

Map of native range of anadromous form-steelhead
Native range of steelhead, the anadromous form of O. mykiss

The native range of Oncorhynchus mykiss is in the coastal waters and tributary streams of the Pacific basin, from the Kamchatka Peninsula in Russia, east along the Aleutian Islands, throughout southwest Alaska, the Pacific coast of British Columbia and southeast Alaska, and south along the west coast of the U.S. to northern Mexico. Mexican forms of Oncorhynchus mykiss represent the southernmost native range of any trout or salmon (Salmonidae).[34] The range of coastal rainbow trout (O. m. irideus) extends north from the Pacific basin into tributaries of the Bering Sea in northwest Alaska, while forms of the Columbia River redband trout (O. m. gairdneri) extend east into the upper MacKenzie River and Peace River watersheds in British Columbia and Alberta, Canada, which eventually drain into the Beaufort Sea, part of the Arctic Ocean.[35] Since 1875, the rainbow trout has been widely introduced into suitable lacustrine and riverine environments throughout the United States and around the world. Many of these introductions have established wild, self-sustaining populations.[36]

Artificial propagation[edit]

Photo of raceways as at U.S. Fish and Wildlife Service fish hatchery
U.S. Fish and Wildlife Service fish hatchery

Since 1870, rainbow trout have been artificially propagated in fish hatcheries to restock streams and to introduce them into non-native waters. The first rainbow trout hatchery was established on San Leandro Creek, a tributary of San Francisco Bay, in 1870, and trout production began in 1871. The hatchery was stocked with the locally native rainbow trout, and likely steelhead of the coastal rainbow trout subspecies (O. m. irideus). The fish raised in this hatchery were shipped to hatcheries out of state for the first time in 1875, to Caledonia, New York, and then in 1876 to Northville, Michigan. In 1877, another California rainbow trout hatchery, the first federal fish hatchery in the National Fish Hatchery System, was established on Campbell Creek, a McCloud River tributary.[37] The McCloud River hatchery indiscriminately mixed coastal rainbow trout eggs with the eggs of local McCloud River redband trout (O. m. stonei). Eggs from the McCloud hatchery were also provided to the San Leandro hatchery, thus making the origin and genetic history of hatchery-bred rainbow trout somewhat diverse and complex.[38] In the U.S., there are hundreds of hatcheries operated by the U.S. Fish and Wildlife Service and various state agencies and tribal governments propagating rainbow trout for conservation and recreational sport fishing.[39][40][41][42] Six of ten Canadian provinces have rainbow trout farms, with Ontario leading production.[43]

Aquaculture[edit]

Photo of cleaned and iced rainbow trout in fish market
Rainbow trout, cleaned and iced, in a fish market in Western Australia

Rainbow trout are commercially farmed in many countries throughout the world. The practice began in the late 19th century,[44] and since the 1950s commercial production has grown dramatically.[45] Worldwide, in 2007, 604,695 tonnes (595,145 long tons; 666,562 short tons) of farmed rainbow trout were harvested with a value of about US $2.6 billion.[45] The largest producer is Chile. In Chile and Norway, sea cage production of steelhead has expanded to supply export markets. Inland production of rainbow trout to supply domestic markets has increased in countries such as Italy, France, Germany, Denmark and Spain. Other significant trout-producing countries include the U.S., Iran and the United Kingdom.[45] While the U.S. rainbow trout industry as a whole is viewed as ecologically responsible,[46] trout raised elsewhere are not necessarily farmed with the same methods.[44]

About three-quarters of U.S. production comes from Idaho, particularly the Snake River area,[44] due in part to the quality and temperature of the water available there.[47] California and Washington also produce significant amounts of farmed trout. In the east, Pennsylvania, North Carolina and West Virginia have farming operations.[44][48] Rainbow trout farming is one of the largest finfish aquaculture industries in the U.S.[44] They are raised inland in facilities where raceways or ponds have continuously flowing water with little pollution and a low risk of escape. The U.S. industry is noted for using best management practices.[46] Imports constitute only about 15 percent of farmed rainbows sold in the U.S., and nearly all domestic production is consumed within the country; very little is exported. The U.S. produces about 7 percent of the world's farmed trout.[44] Rainbow trout, especially those raised in farms and hatcheries, are susceptible to enteric redmouth disease. A considerable amount of research has been conducted on redmouth disease, given its serious implications for rainbow trout farming. The disease does not infect humans.[49]

Conservation[edit]

Map of U.S. range for rainbow trout
U.S. range map for O. mykiss[50]

Populations of many rainbow trout subspecies, including anadromous forms (steelhead) of O. m. irideus (coastal rainbow trout) and O. m. gairdneri (Columbia River redband trout) have declined in their native ranges due to over-harvest, habitat loss, disease, invasive species, pollution and hybridization with other subspecies, and some introduced populations, once healthy, have declined for the same reasons. As a consequence, some rainbow populations, particularly anadromous forms within their native range, have been classified as endangered, threatened or species of special concern by federal or state agencies.[51] Rainbow trout, and subspecies thereof, are currently a U.S. Environmental Protection Agency-approved indicator species for acute fresh water toxicity testing.[52]

Many non-profit organizations have formed to protect, conserve and restore native rainbow trout and steelhead populations. Generally, in partnership with various universities, state, federal and tribal agencies and private interests, these organizations sponsor projects to restore habitat, prevent habitat loss and promote awareness of threats to native trout populations. Trout Unlimited (TU) is a non-profit organization dedicated to the conservation of North American freshwater streams, rivers, and associated upland habitats for trout, salmon, other aquatic species and people.[53] A typical TU project is the Circle Creek Fish Passage Project, in which access to a spawning stream is being improved for steelhead and other salmonid species.[54] The Wild Salmon Center, an international coalition of Russian, Canadian and U.S. scientists, sponsors the Kamchatka Steelhead Project, a 20-year (1994–2014) scientific program to study and conserve the present condition of Kamchatkan steelhead ("mikizha"), a species listed in the Red Data Book of Russia.[55] Other high-profile organizations involved in rainbow trout conservation include California Trout, which protects wild trout and other salmonids in the waters of California.[56] The Steelhead Society of British Columbia promotes the wellbeing of wild salmonids in British Columbia.[57] In 1997, a group of approximately 40 ichthyologists, biologists and naturalists from several U.S. and Mexican institutions formed a collaborative group—Truchas Mexicanas—to study the diversity of Mexican native trout, most of which are considered subspecies of O. mykiss.[58]

Hybridization and habitat loss[edit]

Rainbow trout, primarily hatchery-raised fish of the coastal rainbow trout subspecies (O. m. irideus) introduced into waters inhabited with cutthroat trout, will breed with cutthroats and produce fertile hybrids called cutbows.[59] In the case of the westslope cutthroat trout (O. clarki lewisi), hybridization with introduced rainbow and Yellowstone cutthroat trout (O. clarki bouvieri) is threatening the westslope cutthroat trout with genomic extinction.[60] Such introductions into the ranges of redband trout (O. m. gairdneri, newberrii, and stonei) have severely reduced the range of pure stocks of these subspecies, making them "species of concern" in their respective ranges.[61]

Within the range of the Kern River golden trout of Southern California, hatchery-bred rainbows introduced into the Kern River have diluted the genetic purity of the Kern River rainbow trout (O. m. gilberti) and golden trout (O. m. aguabonita) through intraspecific breeding.[62][63][64] The Beardslee trout, (O. m. irideus var. beardsleei), a genetically unique lake-dwelling variety of the coastal rainbow trout that is isolated in Lake Crescent (Washington), is threatened by the loss of its only spawning grounds in the Lyre River to siltation and other types of habitat degradation.[10]

Invasive species and disease[edit]

Whirling disease

Myxobolus cerebralis is a myxosporean parasite of salmonids (salmon, trout, and their allies) that causes whirling disease in farmed salmon and trout and also in wild fish populations.[65] It was first described in rainbow trout in Germany a century ago, but its range has spread and it has appeared in most of Europe, northern Asia, the U.S., South Africa and other countries.[66] In the 1980s, M. cerebralis was found to require Tubifex tubifex (a kind of segmented worm) to complete its life cycle. The parasite infects its hosts with its cells after piercing them with polar filaments ejected from nematocyst-like capsules.[67]

Map of worldwide distribution of Whirling Disease
M. cerebralis has been reported in Germany (1893), Italy (1954), USSR (1955), including Sakhalin Island (1960), U.S. (1958), Bulgaria (1960), Yugoslavia (1960), Sweden (1966), South Africa (1966), Scotland (1968), New Zealand (1971), Ecuador (1971), Norway (1971), Colombia (1972), Lebanon (1973), Ireland (1974), Spain (1981) and England (1981).

This parasite was originally a mild pathogen of brown trout in central Europe and other salmonids in northeast Asia, and the spread of the rainbow trout has greatly increased its impact. Having no innate immunity to M. cerebralis, rainbow trout are particularly susceptible, and can release so many spores that even more resistant species in the same area, such as Salmo trutta, can become overloaded with parasites and incur mortalities of 80 to 90 percent. Where M. cerebralis has become well-established, it has caused decline or even elimination of whole cohorts of fish.[68][69]

The parasite M. cerebralis was first recorded in North America in 1956 in Pennsylvania,[67] but until the 1990s whirling disease was considered a manageable problem only affecting rainbow trout in hatcheries. It eventually became established in natural waters of the Rocky Mountain states (Colorado, Wyoming, Utah, Montana, Idaho, New Mexico), where it is damaging several sport fishing rivers. Some streams in the western U.S. lost 90 percent of their trout.[70] Whirling disease threatens recreational fishing, which is important for the tourism industry, a key component of the economies of some U.S. western states. For example, in 2005 anglers in Montana spent approximately $196,000,000 in activities directly related to trout fishing in the state.[71] Some of the salmonids that M. cerebralis infects (bull trout, cutthroat trout, and anadromous forms of rainbow trout—steelhead) are already threatened or endangered, and the parasite could worsen their population decline.[72]

New Zealand mud snail
Map of U.S. distribution of New Zealand mud snail
Distribution of New Zealand mud snail within the U.S. in 2009

The New Zealand mud snail (Potamopyrgus antipodarum), once endemic to New Zealand, has spread widely and has become naturalised and an invasive species in many areas including: Australia, Tasmania, Asia (Japan[73]), in the Garmat Ali River in Iraq since 2008[74]), Europe (since 1859 in England), and North America (U.S. and Canada: Thunder Bay in Ontario since 2001, British Columbia since July 2007[73]), most likely inadvertently during human activity.[75]

The mud snail was first detected in the U.S. in Idaho's Snake River in 1987. Since then, the snail has spread to the Madison River, Firehole River, and other watercourses around Yellowstone National Park, and has been discovered throughout the western U.S.[75] The exact means of transmission is unknown, but it is likely that it was introduced in water transferred with live game fish and has been spread by ship ballast or contaminated recreational equipment such as wading gear.[76]

Didymo

Didymosphenia geminata, commonly known as didymo or rock snot, is a species of diatom that produces nuisance growths in freshwater rivers and streams with consistently cold water temperatures.[77] In New Zealand, invasive didymo can form large mats on the bottom of rivers and streams in late winter. It is not considered a significant human health risk, but it can affect stream habitats and sources of food for fish, including rainbow trout, and make recreational activities unpleasant.[78] Even though it is native in North America, it is considered a nuisance organism or invasive species.[79]

Redmouth disease

Enteric redmouth disease is a bacterial infection of freshwater and marine fish caused by the pathogen Yersinia ruckeri. It is primarily found in rainbow trout and other cultured salmonids. The disease is characterized by subcutaneous hemorrhaging of the mouth, fins, and eyes. It is most commonly seen in fish farms with poor water quality. Redmouth disease was first discovered in Idaho rainbow trout in the 1950s.[80]

Steelhead declines[edit]

Steelhead populations in parts of its native range have declined due to a variety of human and natural causes. While populations in Alaska and along the British Columbia coast are considered healthy, populations in Kamchatka and some populations along the U.S. west coast are in decline. The U.S. National Marine Fisheries Service has 15 identified distinct population segments (DPS)s, in Washington, Oregon, and California. Eleven of these DPSs are listed under the U.S. Endangered Species Act, ten as threatened and one as endangered.[81] One DPS on the Oregon Coast is designated a U.S. Species of Concern.[81][82]

The Southern California DPS, which was listed as endangered in 2011, has been impacted by habitat loss due to dams, confinement of streams in concrete channels, water pollution, groundwater pumping, urban heat island effects, and other byproducts of urbanization.[83] Steelhead in the Kamchatka Peninsula are threatened by over-harvest, particularly from poaching and potential development, and are listed in the Red Data Book of Russia that documents rare and endangered species.[84]

Hatchery stocking influence[edit]

Photo of man inspecting steelhead broodstock in hatchery
Steelhead hatchery broodstock inspection

Several studies have shown that almost all California coastal steelhead are of native origin, despite over a century of hatchery stocking. Genetic analysis shows that the South Central California Coast DPS and Southern California DPS from Malibu Creek north, and including the San Gabriel River, Santa Ana River and San Mateo Creek, are not hatchery strains. Steelhead from Topanga Creek and the Sweetwater River were partly, and those from San Juan Creek completely, of hatchery origin.[85] Genetic analysis has also shown that the steelhead in the streams of the Santa Clara County and Monterey Bay basins are not of hatchery origin, including the Coyote Creek, Guadalupe River, Pajaro River, Permanente Creek, Stevens Creek, San Francisquito Creek, San Lorenzo River, and San Tomas Aquino Creek basins.[86] Natural waterfalls and two major dams have isolated Russian River steelhead from freshwater rainbow trout forms above the impassable barriers; a 2007 genetic study of fin samples collected from steelhead at 20 different sites both above and below passage barriers in the watershed found that although 30 million hatchery trout were stocked in the river from 1911 to 1925, the steelhead remain of native and not hatchery origin.[87]

Releases of conventionally reared hatchery steelhead pose ecological risks to wild steelhead populations. Hatchery steelhead are typically larger than the wild forms and can displace wild-form juveniles from optimal habitats. Dominance of hatchery steelhead for optimal microhabitats within streams may reduce wild steelhead survival as a result of reduced foraging opportunity and increased rates of predation.[88]

Uses[edit]

Fishing[edit]

Photo of fisherman holding a rainbow trout
Rainbow trout are a popular game fish for fly fishers.

Rainbow trout and steelhead are highly regarded game fish. Rainbow trout are a popular target for fly fishers, and several angling methods are used. The use of lures presented via spinning, casting or trolling techniques is common. Rainbow trout can also be caught on various live and dead natural baits. The International Game Fish Association recognizes the world record for rainbow trout as a fish caught on Saskatchewan's Lake Diefenbaker by Sean Konrad on September 5, 2009. The fish weighed 48 lb (22 kg) and was a genetically modified hatchery escapee.[89] Many anglers consider the rainbow trout the hardest-fighting trout species, as this fish is known for leaping when hooked and putting up a powerful struggle.[90] It is considered one of the top five sport fish in North America and the most important game fish west of the Rocky Mountains.[25]

There are tribal commercial fisheries for steelhead in Puget Sound, the Washington coast and in the Columbia River, but there has been controversy regarding over-harvesting of native stocks.[91]

The highly desirable sporting qualities and adaptability of the rainbow trout to hatchery rearing and new habitats resulted in it being introduced to many countries around the world by or at the behest of sport fishermen. Many of these introductions have resulted in environmental and ecological problems, as the introduced rainbow trout disrupt local ecosystems and outcompete or eat indigenous fishes.[92] Other introductions to support sport angling in waters either devoid of fish or with seriously depleted native stocks have created world-class fisheries such as in the Firehole River in Yellowstone National Park,[93][94][95] and in the Great Lakes.[96]

As food[edit]

See also: Salmon (food)
Photo of fried fish filet on a plate
Rainbow trout and potatoes

Rainbow trout is popular in Western cuisine and both wild-caught and farmed fish is eaten. It has tender flesh and a mild, somewhat nutty flavor.[48] Wild fish has a stronger, gamier taste than farmed fish.[47] While the taste of wild-caught trout is often promoted as superior,[97] it is illegal to sell or market wild-caught rainbow trout,[98][99] which are legally classified as game fish,[100] in the United States. Thus, rainbow trout and "steelhead" sold in American restaurants is farmed.[97] Farmed rainbow are considered one of the safest fish to eat and are noted for high levels of vitamin B and a generally appealing flavor.[101] Seafood Watch ranks farmed rainbow as a "Best Choice" fish for human consumption.[44]

The color and flavor of the flesh depends on the diet and freshness of the trout. Farmed trout and some populations of wild trout, especially anadromous steelhead, have reddish or orange flesh as a result of high astaxanthin levels in their diets. Astaxanthin is a powerful antioxidant that may be from a natural source or a synthetic trout feed. Rainbow trout raised to have pinker flesh from a diet high in astaxanthin are sometimes sold in the U.S. with labeling calling them "steelhead".[48] As wild steelhead are in decline in some parts of their range, farmed rainbow are viewed as a preferred alternative.[46] In Chile and Norway, rainbow trout farmed in saltwater sea cages are sold labeled as steelhead.[44]

Trout can be cooked as soon as they are cleaned, without scaling, skinning or filleting.[97] If cooked with the skin on, the meat tends to hold together better.[48] While trout sold commercially in Europe is often prepared and served this way, most trout sold commercially in the U.S. have had heads removed and have been fully or partially deboned and filleted. Medium to heavy bodied white wines, such as chardonnay, sauvignon blanc or pinot gris are typical wine pairings for trout.[102]

Notes[edit]

  1. ^ "Synonyms of Oncorhynchus mykiss (Walbaum, 1792)". Fishbase. Retrieved 2014-02-06. 
  2. ^ "Symbols of Washington State". Washington State Legislature. Retrieved 2013-11-29. 
  3. ^ a b Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. p. 67. ISBN 0-7432-2220-2. 
  4. ^ a b c Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Genus Oncorhynchus". Trout and Salmon of North America. New York: The Free Press. pp. 10–21. ISBN 0-7432-2220-2. 
  5. ^ Richardson, John; Swainson, William; Kirby, William (1836). "Fauna Boreali-Americana, or, The Zoology of the Northern Parts of British America: Containing Descriptions of the Objects of Natural History Collected on the Late Northern Land Expeditions, Under Command of Captain Sir John Franklin, R.N. (1829) Part Third: The Fish". London: Richard Bentley. p. 221. OCLC 257860151. 
  6. ^ "Invertebrate Zoology and Geology". California Academy of Sciences. Retrieved 2013-12-16. 
  7. ^ Behnke, Robert J. (1966). "Relationships of the Far Eastern Trout, Salmo mykiss Walbaum". Copeia 1966 (2): 346–348. doi:10.2307/1441145. JSTOR 1441145. 
  8. ^ Smith, Gerald R.; Stearley, Ralph F. (1989). "The Classification and Scientific Names of Rainbow and Cutthroat Trouts". Fisheries 14 (1): 4–10. doi:10.1577/1548-8446(1989)014<0004:TCASNO>2.0.CO;2. 
  9. ^ a b Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. pp. 65–122. ISBN 0-7432-2220-2. 
  10. ^ a b Meyer, J.; Fradkin, S. (2002). "Summary of Fisheries and Limnological Data for Lake Crescent, Washington". Olympic National Park Report (Port Angeles, Washington: National Park Service). 
  11. ^ Rasmussen, Joseph B.; Taylor, Eric B. (2009). "Status of the Athabasca Rainbow Trout Oncorhynchus mykiss in Alberta" (PDF). Government of Alberta-Fish and Wildlife Division. Retrieved 2013-11-29. 
  12. ^ "Little Kern Golden Trout" (PDF). SOS: California's Native Fish Crisis. California Trout. p. 74. Retrieved 2014-01-02. 
  13. ^ Hendrickson, Dean A.; Perez, Hector Espinosa; Findley, Lloyd T.; Forbes, William; Tomelleri, Joseph R.; Mayden, Richard L.; Nielsen, Jennifer L.; Jensen, Buddy; Campos, Gorgonio Ruiz; Romero, Alejandro Varela; van der Heiden, Albert; Camarena, Faustino; Gracia de Leon, Francisco J. (2002). "Mexican native trouts: A Review of Their History and Current Systematic and Conservation Status" (PDF). Reviews in Fish Biology and Fisheries (Kluwer Academic Publishers) 12: 273–316. Archived from the original on 2014-03-03. 
  14. ^ McCoy, John (2013-05-11). "50 Years Later, Golden Rainbows Still 'a Treat' for Mountain State Fishermen". Saturday Gazette-Mail (Charleston, West Virginia: The Charleston Gazette). Retrieved 2013-12-29. 
  15. ^ a b c "Golden Rainbow Trout". Pennsylvania Fish and Boat Commission FAQ. Retrieved 2013-11-28. 
  16. ^ "Golden Rainbow Trout". Retrieved 2013-11-28. 
  17. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. pp. 88, 106. ISBN 0-7432-2220-2. 
  18. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Cutthroat trout Oncorhynchus clarki". Trout and Salmon of North America. The Free Press. p. 139. ISBN 0-7432-2220-2. 
  19. ^ "Rainbow Trout Fin Clips" (PDF). Minnesota Department of Natural Resources. Retrieved 2013-12-30.  Fin clipping is a management tool used to identify hatchery-reared fish.
  20. ^ "Questions and Answers about the Fin Clip Fishery in Hills Creek Reservoir" (PDF). Oregon Department of Fish and Wildlife. Retrieved 2013-12-01. 
  21. ^ a b c Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. pp. 68–72. ISBN 0-7432-2220-2. 
  22. ^ "List of Population Characteristics records for Oncorhynchus mykiss". Fishbase. Retrieved 2014-02-23. 
  23. ^ "Steelhead Fishing in Lake Erie Tributaries". New York State Department of Environmental Conservation. Retrieved 2014-02-03. 
  24. ^ Tyler, C.R; Pottinger, T.G.; Santos, E.; Sumpter, J.P.; Price, S-A; Brooks, S.; Nagler, J.J. (1996). "Mechanisms Controlling Egg Size and Number in Rainbow Trout Oncorhynchus mykiss" (PDF). Biology of Reproduction 54 (1): 8–15. doi:10.1095/biolreprod54.1.8. 
  25. ^ a b Staley, Kathryn; Mueller, John (May 2000). "Rainbow Trout (Oncorhynchus mykiss)" (PDF). U.S. Department of Agriculture. Retrieved 2013-12-16. 
  26. ^ "Wisconsin Trout Fishing: Trout Stream Classifications". Wisconsin Department of Natural Resources. 2014-01-27. Retrieved 2014-01-03. 
  27. ^ "Steelhead/Rainbow Trout Species Profile". Alaska Department of Fish and Game. Retrieved 2013-08-26. 
  28. ^ "Mariculture in Tasmania Ocean Trout". Marine Education Association of Australasia. Retrieved 2014-02-23. 
  29. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. p. 70. ISBN 0-7432-2220-2. 
  30. ^ Nichols, Krista M.; Edo, Alicia Felip; Wheeler, Paul A.; Thorgaard, Gary H. (July 2008). "The Genetic Basis of Smoltification-Related Traits in Oncorhynchus mykiss". Genetics 179 (3): 1559–1575. doi:10.1534/genetics.107.084251. PMC 2475755. PMID 18562654. Retrieved 2014-02-04. 
  31. ^ Hale, MC; Thrower, FP; Berntson, EA; Miller, MR; Nichols, KM (August 2013). "Evaluating Adaptive Divergence Between Migratory and Nonmigratory Ecotypes of a Salmonid Fish, Oncorhynchus mykiss". G3 (Bethesda) 3 (8): 1273–1285. doi:10.1534/g3.113.006817. PMC 3737167. PMID 23797103. 
  32. ^ "Recreational Salmon Fishing Salmon/Steelhead Species Information Steelhead (Rainbow Trout) Oncorhynchus mykiss". Washington Department of Fish and Wildlife. Retrieved 2014-01-07. 
  33. ^ "BC Fish Facts-Steelhead" (PDF). British Columbia Ministry of Fisheries. Retrieved 2013-11-28. 
  34. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. p. 117. ISBN 0-7432-2220-2. 
  35. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Rainbow and Redband Trout". Trout and Salmon of North America. New York: The Free Press. pp. 82–83. ISBN 0-7432-2220-2. 
  36. ^ Fuller, Pam L.; Nico, Leo G.; Williams, James D. (1999). "Case Study: Rainbow Trout". Nonindigenous Fishes Introduced into Inland Waters of the United States. Bethesda, Maryland: American Fisheries Society. pp. 250–251. ISBN 978-1-888569-14-8. OCLC 41262458. 
  37. ^ Schley, Ben (2009-05-21). "A Century of Fish Conservation (1871–1971)". U.S. Fish and Wildlife Service. Retrieved 2013-11-28. 
  38. ^ Behnke, Robert J.; Williams, Ted (2007). About Trout: The Best of Robert J. Behnke from Trout Magazine. Globe Pequot. pp. 6–7. ISBN 978-1-59921-203-6. Retrieved 2011-05-03. 
  39. ^ "Fish and Aquatic Conservation". U.S. Fish and Wildlife Service. Retrieved 2013-11-28. 
  40. ^ "Conservation-Salmon Hatcheries Overview". Washington Department of Fish and Wildlife. Retrieved 2013-11-28. 
  41. ^ Frye, Jason. "The Cherokee Tribal Fish Hatchery". Our State magazine. Retrieved 2013-11-28. 
  42. ^ Burden, Dan (March 2012). "Trout Profile". Agricultural Resource Marketing Center. Retrieved 2013-11-29. 
  43. ^ "Farmed Rainbow Trout / Steelhead Salmon". Agriculture and Agri-Food Canada. Retrieved 2014-08-12. 
  44. ^ a b c d e f g h O'Neill, Brendan (2006-06-23). "Seafood Watch Report: Farmed Rainbow Trout" (PDF). Monterey Bay Aquarium. pp. 2–6. Retrieved 2014-01-06. 
  45. ^ a b c "Cultured Aquatic Species Information Programme: Oncorhynchus mykiss (Walbaum, 1792)". Food and Agricultural Organization of the United Nations, Fisheries and Aquaculture Department. Retrieved 2014-01-09. 
  46. ^ a b c "Seafood Watch: Rainbow Trout". Monterey Bay Aquarium. Retrieved 2014-01-06. 
  47. ^ a b Egan, Timothy (1998-02-25). "Trout as Wild as All Outdoors, Almost". The New York Times. Retrieved 2014-01-06. 
  48. ^ a b c d Harlow, Jay. "Dependable, Delectable Rainbow Trout". Sally's Place. Retrieved 2013-11-28. 
  49. ^ Bullock, G. L.; Cipriano, R.C. (1990). "Enteric Redmouth Disease of Salmonids LSC". Fish Disease Leaflet 82. U.S. Fish and Wildlife Service. Archived from the original on 2009-06-16. 
  50. ^ Fuller, P.; Larson, J.; Fusaro, A.; Neilson, M. (2013-11-04). "Fact Sheet-Oncorhynchus mykiss". USGS Nonindigenous Aquatic Species Database, Gainesville, FL. U.S. Geological Survey. Retrieved 2013-11-30. 
  51. ^ "Species Profile: Steelhead". U.S. Fish and Wildlife Service. Retrieved 2013-11-29. 
  52. ^ "Whole Effluent Toxicity". Environmental Protection Agency. 2013-09-12. Retrieved 2013-11-29. 
  53. ^ Washabaugh, William; Washabaugh, Catherine (2000). Deep Trout: Angling in Popular Culture. Oxford, United Kingdom: Berg. p. 119. ISBN 1-85973-393-X. 
  54. ^ "Circle Creek Fish Passage Project". Trout Unlimited. Retrieved 2014-01-04. 
  55. ^ "Steelhead Project Report". Wild Salmon Center. November 2004. Retrieved 2013-12-01. 
  56. ^ "About Us". California Trout. Retrieved 2013-12-01. 
  57. ^ "About Us". The Steelhead Society of British Columbia. Retrieved 2013-12-01. 
  58. ^ "Truchas Mexicanas". Retrieved 2014-02-12. 
  59. ^ Parker, David; Avers, Thomas; Courtney, Michael (2011). "Weight, Length, and Growth in Cutbow Trout (O. m. x clarkii)" (PDF). Nature Precedings. Retrieved 2014-01-04. 
  60. ^ Allendorf, Fred W.; Leary, Robb F.; Hitt, Nathaniel P.; Knudsen, Kathy L.; Lundquist, Laura L. and Spruell, Paul (October 2004). "Intercrosses and the U.S. Endangered Species Act: Should Hybridized Populations be Included as Westslope Cutthroat Trout?" (PDF). Conservation Biology (Washington, D.C.: Society for Conservation Biology) 18 (5): 1203–1213. doi:10.1111/j.1523-1739.2004.00305.x. 
  61. ^ Dickson, Tom. "Montana's Redband Trout". Montana Outdoors (Montana Fish, Wildlife & Parks) (May–June 2011). Retrieved 2013-11-29. 
  62. ^ Shreck, Carl B.; Behnke, Robert J. (1971). "Trouts of the Upper Kern River Basin, California, with Reference to Systematics and Evolution of Western North American Salmo" (subscription required). Journal of the Fisheries Research Board of Canada (NRC Research Press) 28 (7): 987–998. doi:10.1139/f71-143. 
  63. ^ "Kern River Rainbow Trout" (PDF). Cal Trout. Retrieved 2014-03-03. 
  64. ^ "California Golden Trout" (PDF). Cal Trout. Retrieved 2014-03-03. 
  65. ^ "Whirling Disease Initiative: Final Report" (PDF). Montana Water Center, Montana State University. October 2009. p. 1. Retrieved 2013-12-30. 
  66. ^ Elwell, Leah C. Steinbach; Stromberg, Kajsa Eagle; Ryce, Eileen K.N.; Bartholomew, Jerri L. "Whirling Disease in the United States – A Summary of Progress in Research and Management 2009". Whirling Disease Foundation, Trout Unlimited. Retrieved 2013-12-31. 
  67. ^ a b Faisal, Mohamed; Garling, Donald (December 2004). "What Is Whirling Disease?" (PDF). North Central Regional Aquaculture Center and Michigan State University Extension. Retrieved 2013-12-31. 
  68. ^ Nehring, R. B. "Whirling Disease in Feral Trout Populations in Colorado". In Bergersen, E. P., and Knopf, B. A. (1996). Proceedings, Whirling Disease Workshop, Denver, Colorado, February 6–8, 1996: Where Do We Go from Here? Fort Collins, Colorado: Colorado Cooperative Fish and Wildlife Research Unit, pp. 126–144. OCLC 37379539
  69. ^ Vincent, E. R. "Whirling Disease – the Montana Experience, Madison River". In Bergersen, E. P., and Knopf, B. A. (1996). Proceedings, Whirling Disease Workshop, Denver, Colorado, February 6–8, 1996: Where Do We Go from Here? Fort Collins, Colorado: Colorado Cooperative Fish and Wildlife Research Unit, p. 159. OCLC 37379539
  70. ^ Tennyson, J.; Anacker, T.; Higgins, S. (January 13, 1997). "Scientific Breakthrough Helps Combat Trout Disease". U.S. Fish and Wildlife Service Whirling Disease Foundation News Release. Retrieved 2014-01-05. 
  71. ^ "Montana's Wild Trout". The Trout Conservancy. Archived from the original on 2014-01-01. 
  72. ^ Gilbert, M. A.; Granath, W. O. Jr. (2003). "Whirling Disease and Salmonid Fish: Life Cycle, Biology, and Disease". Journal of Parasitology 89 (4): 658–667. doi:10.1645/GE-82R. JSTOR 3285855. PMID 14533670. 
  73. ^ a b Davidson, Timothy M.; Brenneis, Valance E. F.; de Rivera, Catherine; Draheim, Robyn; Gillespie, Graham E. (2008). "Northern Range Expansion and Coastal Occurrences of the New Zealand Mud Snail Potamopyrgus antipodarum (Gray, 1843) in the Northeast Pacific" (PDF). Aquatic Invasions (Regional Euro-Asian Biological Invasions Centre) 3 (3): 349–353. doi:10.3391/ai.2008.3.3.12. 
  74. ^ Naser, Murtada D.; Son, Mikhail O. (2009). "First Record of the New Zealand Mud Snail Potamopyrgus antipodarum (Gray 1843) from Iraq: the Start of Expansion to Western Asia?" (PDF). Aquatic Invasions 4 (2): 369–372. doi:10.3391/ai.2009.4.2.11. 
  75. ^ a b Benson, A. J.; Kipp, R. M.; Larson, J.; Fusaro, A. (2013). "Potamopyrgus antipodarum". USGS Nonindigenous Aquatic Species Database. U.S. Geological Survey. Retrieved 2013-05-25. 
  76. ^ "Aquatic Nuisance Project Fact Sheet: New Zealand Mudsnail (Potamopyrgus antipodarum)". Aquatic Nuisance Species Project. Retrieved 2014-01-03. 
  77. ^ "DPIPWE - Didymo (Rock Snot)". Tasmania Department of Primary Industries, Parks, Water and Environment. Retrieved 2014-08-12. 
  78. ^ Biosecurity New Zealand (August 2007). "Is Didymo an Exotic Species?". Biosecurity New Zealand. Retrieved 2013-12-01. 
  79. ^ "Invasive Aquatic Species-Didymo". U.S. Department of Agriculture. Retrieved 2013-12-16. 
  80. ^ Busch, R. A. (March 1978). "MFR Paper 1296 Enteric Redmouth Disease (Haggerman Strain)" (PDF). Marine Fisheries Review 40 (3). Retrieved 2014-01-05. 
  81. ^ a b "Steelhead Trout (Oncorhynchus mykiss)". NOAA Fisheries, Office of Protected Resources. Retrieved 2013-11-28. 
  82. ^ "Appendix D Evolutionarily Significant Units, Critical Habitat, and Essential Fish Habitat" (PDF). California Department of Water Resources. Retrieved 2013-11-29. 
  83. ^ "South-Central/Southern California Coast Steelhead Recovery Planning Domain 5-Year Review: Summary and Evaluation of Southern California Coast Steelhead Distinct Population Segment" (PDF). National Oceanic and Atmospheric Administration. 2011. Retrieved 2013-12-03. 
  84. ^ Rahr III, Guido. "Bountiful Breed: Kamchatka Siberia's Forbidden Wilderness". Public Broadcasting System (PBS). Retrieved 2013-12-04. 
  85. ^ Clemento, Anthony J.; Anderson, Eric C.; Boughton, David; Girman, Derek; Garza, John Carlos (2009). "Population Genetic Structure and Ancestry of Oncorhynchus mykiss Populations Above and Below Dams in South-central California" (PDF). Conservation Genetics 10 (5): 1321–1336. doi:10.1007/s10592-008-9712-0. Retrieved 2014-01-03. 
  86. ^ Garza, John Carlos; Pearse, Devon (March 2008). Population Genetics of Oncorhynchus mykiss in the Santa Clara Valley Region, Final Report to the Santa Clara Valley Water District (Report). Santa Clara Valley Water District. pp. 1–54.
  87. ^ Deiner, Kristy; Garza, John Carlos, Coey, Robert, Girman, Derek J. (2007). "Population Structure and Genetic Diversity of Trout (Oncorhynchus mykiss) Above and Below Natural and Man-made Barriers in the Russian River, California" (PDF). Conservation Genetics 8 (2): 437–454. doi:10.1007/s10592-006-9183-0. Retrieved 2011-06-12. 
  88. ^ McMichael, G. A.; Pearsons, T. N.; Leider, S. A. (1999). "Behavioral Interactions Among Hatchery-reared Steelhead Smolts and Wild Oncorhynchus mykiss in Natural Streams". North American Journal of Fisheries Management 19 19 (4): 948–956. doi:10.1577/1548-8675(1999)019<0948:BIAHRS>2.0.CO;2. 
  89. ^ Keim, Brandon (2009-09-15). "48-Pound Trout: World Record or Genetic Cheat?". Wired. Condé Nast. Retrieved 2013-11-29. 
  90. ^ Waterman, Charles F. (1971). The Fisherman's World. New York: Random House. p. 57. ISBN 0-394-41099-8. OCLC 319916607. 
  91. ^ Stellmon, Josh (2008). "Under the Guise of 'Treaty Rights:' The Nez Perce Tribe of Idaho, Steelhead, and Gillnetting". Public Land and Resources Law Review 29. Retrieved 2014-01-05. 
  92. ^ "100 of the World's Worst Invasive Alien Species". Invasive Species Specialist Group (ISSG) of the IUCN Species Survival Commission. Retrieved 2013-11-28. 
  93. ^ Brooks, Charles E. (1979). The Living River: A Fisherman's Intimate Profile of the Madison River Watershed—Its History, Ecology, Lore and Angling Opportunities. Garden City, New Jersey: Nick Lyons Books. pp. 56–59. ISBN 0-385-15655-3. OCLC 5751574. 
  94. ^ The Yellowstone Fly-Fishing Guide. Guilford, CT: The Globe Pequot Press. 1997. p. 11. ISBN 1-55821-545-X. "In 1994 Yellowstone Park official introduced a fee permit policy to help pay the increased cost of protecting and enhancing this world-class fishery." 
  95. ^ Santella, Chris (2004). "Brown and Rainbow trout on the Madison River". Fifty Places to Fly Fish Before You Die: Fly Fishing Experts Share The World's Greatest Destinations. Harry M. Abrams Inc. ISBN 1-58479-356-2. "... thanks to the Firehole's geothermal activity, the river bottom undulates with plant life. Few fish are caught here and tourists continue on to the West Yellowstone park exit, thinking that its too bad there are no fish in that pretty river that skirts the road. Little do they know that they have been following one of the most fabled trout streams in the world!" 
  96. ^ "Fishing New York's Great Lakes". New York State Department of Environmental Conservation. Retrieved 2013-11-28. 
  97. ^ a b c Wright, Leonard M. (1996). Trout Maverick. New York: Lyons & Burford. p. 19. ISBN 1-55821-476-3. 
  98. ^ "§87-6-206, Montana Code Annotated". Montana Legislative Services. 2014. Retrieved 2014-01-06. 
  99. ^ "§87-6-707, Montana Code Annotated". Montana Legislative Services. 2014. Retrieved 2014-01-06. 
  100. ^ "§87-6-101, Montana Code Annotated". Montana Legislative Services. 2014. Retrieved 2014-01-06. 
  101. ^ Cancila, Katherine (2010-09-16). "The 5 Safest Fish to Eat – Salmon, Tilapia, Rainbow Trout and More". Babble. Disney. Retrieved 2014-01-06. 
  102. ^ "Pairing Wine with Fish". Wine Folly. May 20, 2013. Retrieved 2014-02-15. 

Further reading[edit]

  • Combs, Trey (1976). Steelhead Fly Fishing and Flies. Portland, Oregon: Frank Amato. ISBN 0-936608-03-X. 
  • Combs, Trey (1991). Steelhead Fly Fishing. New York: Lyons and Burford Publishers. ISBN 1-55821-119-5. 
  • Gerlach, Rex (1988). Fly Fishing for Rainbows-Strategies and tactics for North America's Favorite Trout. Mechanicsburg, Pennsylvania: Stackpole Books. ISBN 0-8117-0624-9. 
  • Halverson, Anders (2010). An Entirely Synthetic Fish: How Rainbow Trout Beguiled America and Overran the World. New Haven, Connecticut: Yale University Press. ISBN 978-0-300-14088-0. OCLC 440281085.  Review, Interviews
  • Marshall, Mel (1973). Steelhead. New York: Winchester Press. ISBN 0-87691-093-2. 
  • McClane, A. J.; Gardner, Keith (1984). "Rainbow Trout and Steelhead". McClane's Game Fish of North America. New York: Times Books. pp. 54–93. ISBN 0-8129-1134-2. 
  • McDermand, Charles (1946). Waters of the Golden Trout Country. New York: G.P. Putnam's Sons. 
  • Montaigne, Fen (1998). "Kamchatka". Reeling in Russia. New York: St. Martins Press. pp. 251–270. ISBN 0-312-18595-2. 
  • Scott and Crossman (1985) Freshwater Fishes of Canada. Bulletin 184. Fisheries Research Board of Canada. Page 189. ISBN 0-660-10239-0
  • Walden, Howard T. 2nd (1964). "Rainbow, Cutthroat, and Golden Trout". Familiar Freshwater Fishes of America. New York: Harper & Row, Publishers. pp. 14–33. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Sheepheaven Creek redband trout

The Sheepheaven Creek redband trout (Oncorhynchus mykiss spp.) is a species of fish in the Salmonidae family and a western subspecies of the McCloud River redband trout (Oncorhynchus mykiss stonei).[1] It is native to Sheepheaven Creek, Siskiyou County, California, United States.[2][3] Sheepheaven Creek redband were transplanted into Swamp Creek in 1972 and 1974 and into Trout Creek in 1977. They can now be found in both locations.[4] Sheepheaven Creek redband are found to be the most distinct among all other trout groups, meriting recognition as a new subspecies.[5][6][7] They have the fewest gill rakers of any western trout.[8]

References[edit]

  1. ^ California Department of Fish and Game; California Inland Fisheries Branch (1973). Inland fisheries administrative report. 74-75. California: State of California, The Resources Agency, Department of Fish and Game. 
  2. ^ J. R. Gold (1977). Systematics of western North American trout (Salmo). California. 
  3. ^ Peter B. Moyle (1976). Inland Fishes of California. California: University of California Press. 
  4. ^ Steven Ojai. "Fly Fishing the Sierra". Retrieved November 15, 2012. 
  5. ^ Robert J. Behnke (2002). Trout and Salmon of North America. New York: Chanticleer Press. ISBN 0-7432-2220-2. 
  6. ^ Molly Rebecca Stephens (2007). Systematics, Genetics and Conservation of Golden Trout. California: University of California. 
  7. ^ Jeff Weaver; Stephanie Mehalick. "Genetic Sampling of Oncorhynchus mykiss in the Upper McCloud River Drainage". California Department of Fish and Game. Retrieved November 16, 2012. 
  8. ^ Robert J. Behnke (1992). American Fisheries Society Monograph - Native trout of western North America 6. Bethesda, Maryland, United States: American Fisheries Society. ISBN 0-913235-78-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Athabasca rainbow trout

The Athabasca rainbow trout, Oncorhynchus mykiss ssp. is a species of fish in the Salmonidae family and a localized subspecies of the rainbow trout (Oncorhynchus mykiss) and is found in the headwaters of the Athabasca river in Alberta Canada.[1] The Athabasca rainbow trout is considered by fisheries biologist Robert J. Behnke as a form of the Columbia River redband trout (O. mykiss gairdneri), but considered a separate subspecies by biologist L. M. Carl of the Ontario Ministry of Resources, Aquatic Ecosystems Research Section and associates from work published in 1994. The Athabasca river is a tributary of the Mackenzie river system which flows north into the Arctic ocean. The Athabasca rainbow trout is one of the few native rainbow trout populations found in an Arctic ocean tributary. Populations of either coastal rainbow trout (O. m. irideus) or Columbia River redband trout (O. m. gairdneri) exist in Peace and Liard river tributaries in the Mackenzie river system.[2]

The Athabasca rainbow is considered a "May be at risk" species[3] in Alberta due to potential habitat loss and hybridization with introduced rainbow trout.[1]

Notes[edit]

  1. ^ a b Rasmussen, Joseph B.; Taylor, Eric B. (2009). "Status of the Athabasca Rainbow Trout Oncoryhnchus mykiss in Alberta" (PDF). Government of Alberta-Fish and Wildlife Division. Retrieved 2013-11-29. 
  2. ^ Behnke, Robert J.; Tomelleri, Joseph R. (illustrator) (2002). "Redband Trout of the Columbia River Basin". Trout and Salmon of North America. The Free Press. pp. 81–86. ISBN 0743222202. 
  3. ^ Rasmussen, Joseph B.; Taylor, Eric B. (2009). "Appendix 1: Definitions of status ranks and legal designations" (PDF). Status of the Athabasca Rainbow Trout Oncoryhnchus mykiss in Alberta. Government of Alberta-Fish and Wildlife Division. pp. 26–27. Retrieved 2013-11-29. "May be at risk: Any species that may be at risk of extinction or extirpation, and is therefore a candidate for a detailed risk assessment" 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This highly variable species formerly was known as Salmo gairdneri, but this taxon is closely related to Pacific salmon and is conspecific with Asiatic steelhead (Oncorhynchus mykiss). For a complete taxonomic history, see Smith and Stearley (1989), Robins et al. (1991), and Behnke (1992).

"Redband" trout has been used as the name for nonanadromous populations adapted to harsh arid environments (Wishard et al. 1984); however, the term "redband" should not be used to imply a taxonomic relationship among all groups of rainbow trout in interior basins of Oregon and adjacent areas of Idaho, Nevada, and California (Wishard et al. 1984, Currens et al. 1990). Currens et al. (1990) found no evidence that all isolated groups of rainbow trout with plesiomorphic characteristics in the White River, Oregon desert basins, and northern California represent a monophyletic group.

Behnke (1992) included in O. mykiss three major groups: (1) the redband trout of the Columbia River basin east of the Cascade Mountains, and in upper Fraser River basin and the Athabasca headwaters of the Mackenzie River basin (subspecies gairdneri); (2) the redband trout of the Sacramento River basin, which he regarded as comprising two Kern River drainage subspecies (aguabonita and gilberti), plus the McCloud River subspecies (provisionally denoted as subspecies stonei); and (3) the coastal rainbow trout (nominal subspecies irideus of North America and mykiss of eastern Asia, though no known taxonomic characters separate mykiss from irideus). Behnke concluded that other forms, such as the redband trout native to Oregon desert basins, Upper Klamath Lake, the Pit River drainage, and Eagle Lake, California, cannot be consistently distinguished from the three groups listed above. He noted that their classification is a matter of personal preference and professional judgment. However, in the same publication, he stated that "the trout specialized for lacustrine conditions in Klamath Lake...is well differentiated from other groups of both redband and coastal rainbow trout and could be recognized as a subspecies, O. m. newberrii."

Hatchery rainbow trout derived mainly from coastal steelhead are widely stocked throughout the ranges of western trout (Behnke 1992). These hatchery fishes have led to hybridization with most populations of resident redband trout in the upper Sacramento River basin, the Oregon desert basins, and much of the Columbia River basin (Behnke 1992).

Oncorhynchus mykiss freely interbreeds with cutthroat trout (O. clarki) and Gila trout (O. gilae), producing fertile offspring (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!