Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Oncorhynchus mykiss is among the most important game fishes in North America. These common fish are found in cold headwaters, creeks, and small to large rivers, as well as lakes. They are anadromous in coastal streams, moving upstream from the ocean to spawn (unlike salmon, adults usually survive spawning and may breed again). (Page and Burr 1991)

The different forms of Oncorhynchus mykiss are known by different common names. The sea-run Rainbow Trout are known as Steelhead; interior populations are sometimes known as Redband Trout. These fish are highly variable in color, but have small, irregular black spots on the back and most fins. There are radiating rows of black spots on the caudal (tail) fin and a pink to red stripe on the side. Stream and spawning fish have intense dark colors whereas lake fish are light and silvery. The upper jaw reaches barely behind the eye in young and female individuals, but well behind the eye in large males. Sea-run individuals (Steelhead) are silvery and largely lack the pink stripe on the side; they typically develop a more pointed head and grow much larger than Rainbow Trout. (Page and Burr 1991)

Rainbow Trout are native to the Pacific Slope of North America from Alaska and northwestern Canada to Baja California. They have been widely introduced in cold waters elsewhere in North America and the rest of the world. (Page and Burr 1991)

In contrast to the Rainbow Trout, the Golden Trout (O. aguabonita) has a red belly and cheek, a gold lower side, and large black spots on the dorsal and caudal fins (but in some areas where they co-occur, these two species hybridize). The Cutthroat Trout (O. clarki) has an orange or red "cutthroat" mark on the underside of the lower jaw and small teeth on the floor of the mouth between the gill arches (no such teeth are present in Rainbow Trout). Salvelinus species have light spots on a dark background. Salmon have 13 or more anal rays (8 to 12 in Rainbow Trout). (Page and Burr 1991)

For detailed information on the biology and status of this species, including conservation issues, see this resource from the NOAA Fisheries Office of Protected Resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits cold headwaters, creeks, small to large rivers, and lakes. Anadromous in coastal streams (Ref. 5723). Stocked in almost all water bodies as lakes, rivers and streams, usually not stocked in water reaching summer temperatures above 25°C or ponds with very low oxygen concentrations. Feeds on a variety of aquatic and terrestrial invertebrates and small fishes. At the sea, preys on fish and cephalopods. Undertakes short spawning migrations. Anadromous and lake forms may migrate long distances to spawning streams (Ref. 59043). Utilized fresh, smoked, canned, and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988). Cultured in many countries and is often hatched and stocked into rivers and lakes especially to attract recreational fishers (Ref. 9988).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Atlantic Europe, Baltic sea, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, Eritrea, European waters (ERMS scope), FAO fishing area 67, Gulf of Maine, Kenya, Madagascar, Mauritius, New Zealand Exclusive Economic Zone, North East Pacific, North Pacific, North Sea, North West Atlantic, North West Territories, Oosterschelde, Polish Exclusive Economic Zone, Red Sea, Reunion, South Africa (country), Tanzania, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Oncorhynchus_mykiss are only native to the Pacific Coast of North America, extending from Alaska down to the border between California and Mexico. However, they have been introduced throughout the United States. and in every continent except for Antarctica for game fishing purposes. There are two forms: freshwater resident and anadromous. The resident form is commonly called rainbow trout while the anadromous form is called steelhead.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Native to Pacific Slope from Kuskokwim River, Alaska to (at least) Rio Santa Domingo, Baja California, Mexico; upper Mackenzie River drainage (Arctic basin), Alberta and British Columbia in Canada; endorheic basins of southern Oregon, USA. Widely introduced in cold waters elsewhere in North America and rest of the world (Ref. 5723). Eastern Pacific: Kamchatkan Peninsula and have been recorded from the Commander Islands east of Kamchatka and sporadically in the Sea of Okhotsk as far south as the mouth of the Amur River along the mainland. The records outside Kamchatka probably represent migrating or straying Kamchatkan steelhead (penshinensis) rather than the established native population (Reg. 50080). Several countries report adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Oncorhynchus mykiss are only native to the Pacific Coast of North America, extending from Alaska down to the border between California and Mexico. However, they have been introduced throughout the United States. and in every continent except for Antarctica for game fishing purposes. There are two forms: freshwater resident and anadromous. The resident form is commonly called rainbow trout while the anadromous form is called steelhead.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Native to the Pacific coastal inland waters. Introduced into the Atlantic drainages.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to streams along the Pacific coast of North America from the Kuskokwim River, Alaska, south to northern Baja California; also the upper Mackenzie River drainage (Arctic basin), Alberta and British Columbia, and endorheic (i.e. having no outflow of water) basins of southern Oregon (Page and Burr 1991). The species has been widely introduced and established in suitable habitats all over the world (Lee et al. 1980). At sea, O. mykiss occurs hroughout the North Pacific above 40° N from the North American coast to the Sea of Okhotsk (Burgner et al. 1992); it is most abundant in the Gulf of Alaska and eastern part of the North Pacific, conforming to the 5°C isotherm in the north and 15°C isotherm in the south. Seasonal shifts in distribution are correlated with changes in water temperature (Sutherland 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North Pacific Ocean from the Kamchatka Peninsula in Asia to the northern Baja Peninsula

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific and adjacent basins, introduced widely elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Physical description varies widely with sex, age, and habitat. In general, they are streamlined, with 8 to 12 spines in the anal fin and lack teeth at the base of the tongue (unlike their close relatives, Oncorhynchus_clarkii). The undersides tend to be silvery with a pinkish red stripe along the upper-middle part of the body, though this stripe can vary from dark to light. Resident rainbows and spawning steelhead tend to be lighter with more pronounced pink stripes, while ocean-going steelhead are darker and silvery to blend into their ocean environment. Most have black spots above the lateral line, and resident rainbows tend to have more intense spotting, well below the lateral line. Juvenile fish have 8 to 13 parr marks on their sides and become silvery as they mature.

Range mass: 25.4 (high) kg.

Average mass: 4 kg.

Range length: 120 (high) cm.

Range basal metabolic rate: 0.6 to 75 cm^3 oxygen/hour.

Average basal metabolic rate: 55 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 12; Analspines: 0; Analsoft rays: 8 - 12; Vertebrae: 60 - 66
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Physical description varies widely with sex, age, and habitat. In general, they are streamlined, with 8 to 12 spines in the anal fin and lack teeth at the base of the tongue (unlike their close relatives, Oncorhynchus clarkii). The undersides tend to be silvery with a pinkish red stripe along the upper-middle part of the body, though this stripe can vary from dark to light. Resident rainbows and spawning steelhead tend to be lighter with more pronounced pink stripes, while ocean-going steelhead are darker and silvery to blend into their ocean environment. Most have black spots above the lateral line, and resident rainbows tend to have more intense spotting, well below the lateral line. Juvenile fish have 8 to 13 parr marks on their sides and become silvery as they mature.

Range mass: 25.4 (high) kg.

Average mass: 4 kg.

Range length: 120 (high) cm.

Range basal metabolic rate: 0.6 to 75 cm^3 oxygen/hour.

Average basal metabolic rate: 55 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 5504)); max. published weight: 25.4 kg (Ref. 7251); max. reported age: 11 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body elongate, somewhat compressed especially in larger fish. No nuptial tubercles but minor changes to head, mouth and color occur especially in spawning males. Coloration varies with habitat, size, and sexual condition. Stream residents and spawners darker, colors more intense. Lake residents lighter, brighter, and more silvery. Caudal fin with 19 rays (Ref. 2196). Differs from Oncorhynchus gorbuscha by having the following unique characters: by having the following unique characters: anal fin with 6-9½ (usually 8½ ) branched rays; 115-130 scales in midlateral row; 16-17 gill rakers; breeding males lacking hump; juveniles lacking parr marks; wide pink to red stripe from head to caudal base, except in sea-run form; and juveniles with 5-10 parr marks (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The natural habitat of the species is freshwater with about 12°C in summer. It is unclear whether its anadromy is a truly genetic adaptation or simply an opportunistic behavior. It seems that any stock of rainbow trout is capable of migrating, or at least adapting to seawater, if the need or opportunity arises. Adults feed upon fish eggs, minnow and other small fish (including other trout); young feed on small insects and crustaceans. Utilized fresh, smoked, canned and frozen; eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988). Rainbow trout is cultured in many countries and is often hatched and stocked into rivers and lake especially to attract recreational fishermen (Ref. 9988).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Montana: both pure and moderately hybridized populations of westslope cutthroat trout have a high incidence of basibranchial teeth, whereas pure rainbow trout lack these teeth; presence of basibranchial teeth in some individuals of a rainbow trout population indicates hybridization with westslope cutthroat trout (Leary et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Freshwater, brackish, or marine waters of temperate zones. The anadromous form, called steelhead, spawn and complete their early development in freshwater mountain streams, then migrate to spend their adult life in the ocean. In freshwater, they prefer cool water but have been known to tolerate water temperatures up to 24°C (native climates have water temperatures around 12°C in the summer). Productive streams have a good mixture of riffles and pools and overhanging vegetation for shade. Most importantly, they require gravel beds to lay their eggs, and therefore, are sensitive to sedimentation and channel scouring. Juvenile trout prefer protective cover and low velocity water and have been known to be swept away and killed in water that is too fast. Since they are native to the western U.S., then tend to be found in coastal streams and rivers which naturally have reduced flow in summer months.

Range elevation: 0 to 3000 m.

Range depth: 10 to 200 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 200 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Freshwater, brackish, or marine waters of temperate zones. The anadromous form, called steelhead, spawn and complete their early development in freshwater mountain streams, then migrate to spend their adult life in the ocean. In freshwater, they prefer cool water but have been known to tolerate water temperatures up to 24°C (native climates have water temperatures around 12°C in the summer). Productive streams have a good mixture of riffles and pools and overhanging vegetation for shade. Most importantly, they require gravel beds to lay their eggs, and therefore, are sensitive to sedimentation and channel scouring. Juvenile trout prefer protective cover and low velocity water and have been known to be swept away and killed in water that is too fast. Since they are native to the western U.S., then tend to be found in coastal streams and rivers which naturally have reduced flow in summer months.

Range elevation: 0 to 3000 m.

Range depth: 10 to 200 m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; lakes and ponds; rivers and streams; temporary pools; coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The natural habitat of the species is fresh water with about 12°C in summer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29 specimens in 2 taxa.

Environmental ranges
  Depth range (m): 0.142 - 33

Graphical representation

Depth range (m): 0.142 - 33
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Capable of surviving in a wide range of temperature conditions. Does best where dissolved oxygen concentration is at least 7 ppm. Anadromous populations occur in coastal rivers. Resident populations now inhabit small headwater streams, large rivers, lakes, or reservoirs; often in cool clear lakes and cool swift streams with silt-free substrate. In streams, deep low velocity pools are important wintering habitats (Sublette et al. 1990).

Usually requires a gravel stream riffle for successful spawning. Lake populations move to tributaries to spawn. Eggs are laid in gravel in a depression made by the female. Salinity of 8 ppt is the upper limit for normal development of eggs and alevins (Morgan et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Anadromous forms migrate up to at least hundreds of miles between spawning streams and nonspawning marine waters. Stream-dwelling trout may spend an entire life in few hundred meters of stream (Moyle 1976). Lake-dwelling trout typically migrate to tributaries to spawn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rainbow trout and steelhead are insectivorous and piscivorous. Resident rainbow trout tend to eat more fish than steelhead. Both species primarily feed on invertebrate larvae drifting in mid-water to conserve energy that would be expended if they were foraging for food in the substrate. Young rainbow trout and steelhead eat insect larvae, crustaceans, other aquatic invertebrates, and algae.

Animal Foods: fish; insects; aquatic or marine worms; aquatic crustaceans

Plant Foods: algae

  • Smith, R. 1991. Rainbow Trout (Oncorhynchus mykiss). Pp. 304-323 in J Stoltz, J Schnell, eds. Trout: The Wildlife Series. Harrisburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous (Ref. 5951). Young rainbow trout feed predominantly on zooplankton (Ref. 26523). Rainbow trout of all sizes fed mainly on midge (adults, larvae and pupae). As the fish grew larger, terrestrial prey became the most important food item (Ref. 55755). Possible cohabitation with G. olidus (Ref. 26860). Rainbow trout also have sea dwelling populations known as 'steelhead' (Ref. 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Rainbow trout and steelhead are insectivorous and piscivorous. Resident rainbow trout tend to eat more fish than steelhead. Both species primarily feed on invertebrate larvae drifting in mid-water to conserve energy that would be expended if they were foraging for food in the substrate. Young rainbow trout and steelhead eat insect larvae, crustaceans, other aquatic invertebrates, and algae.

Animal Foods: fish; insects; aquatic or marine worms; aquatic crustaceans

Plant Foods: algae

Primary Diet: carnivore (Insectivore )

  • Smith, R. 1991. Rainbow Trout (Oncorhynchus mykiss). Pp. 304-323 in J Stoltz, J Schnell, eds. Trout: The Wildlife Series. Harrisburg, PA: Stackpole Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In lakes, feeds mostly on bottom-dwelling invertebrates (e.g., aquatic insects, amphipods, worms, fish eggs, sometimes small fish) and plankton. In streams, feeds primarily on drift organisms. May ingest aquatic vegetation (probably for attached invertebrates). Diet changes seasonally. In the ocean, the diet consists of fishes and crustaceans.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum spathaceum endoparasitises eye (lens) of Salmo gairdneri

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Rainbow trout and steelhead are important predators in their native habitats, they also serve as important sources of food for larger predators.

Commensal/Parasitic Species:

  • sea lamprey (Petromyzon_marinus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In the Great Lakes, sea lampreys are the most common predators of all Salmonidae species, including rainbow trout. Other predators in both native and introduced habitats include: larger Salmonidae, fish-eating birds like great blue herons (Ardea_herodias), mergansers (Mergus), and kingfishers (Ceryle), and mammals including mink (Mustela_vison and Mustela_lutreola), raccoons (Procyon_lotor), river otters (Lontra), grizzly bears (Ursus_arctos), American black bears (Ursus_americanus), humans, and larger marine mammals who feed on migrating steelhead. Rainbow trout tend to stick to the sides of streams and rivers where shading is prevalent, the water is less swift, and protection is greatest. Trout species are vigilant and capable of rapid swimming to escape predation.

Known Predators:

  • kingfishers (Ceryle)
  • grizzly bears (Ursus_arctos)
  • American black bears (Ursus_americanus)
  • river otters (Lontra_canadensis)
  • mink (Mustela_vison and Mustela_lutreola)
  • raccoons (Procyon_lotor)
  • sea lampreys (Petromyzon_marinus)
  • mergansers (Mergus_merganser)
  • great blue herons (Ardea_herodias)
  • other trout species (Salmonidae)
  • humans (Homo_sapien)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Rainbow trout and steelhead are important predators in their native habitats, they also serve as important sources of food for larger predators.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

In the Great Lakes, sea lampreys are the most common predators of all salmonid species, including rainbow trout. Other predators in both native and introduced habitats include: larger trout, fish-eating birds like great blue herons (Ardea herodias), mergansers (Mergus), and kingfishers (Ceryle), and mammals including mink (Neovison vison and Mustela lutreola), raccoons (Procyon lotor), river otters (Lontra), grizzly bears (Ursus arctos), American black bears (Ursus americanus), humans, and larger marine mammals who feed on migrating steelhead. Rainbow trout tend to stick to the sides of streams and rivers where shading is prevalent, the water is less swift, and protection is greatest. Trout species are vigilant and capable of rapid swimming to escape predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Whirling Disease 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Proliferative Kidney Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection (Hysterothylacium sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Camallanus Infection 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aeromonosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

In a survey of populations in the contiguous U.S., Huntington et al. (1996) identified 28 healthy native stocks of winter steelhead (20 in Washington, 7 in Oregon, 1 in California) and 6 healthy native stocks of summer steelhead, all in Oregon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size for all subspecies and stocks greatly exceeds 1 million.

Total annual abundance for all North American steelhead stocks was estimated at 1.6 million fish (Burgner et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Normal life span 5-6 years (Simpson and Wallace 1982). Predation by Caspian terns and double-crested cormorants causes significant mortality of juvenile steelhead in the Columbia River estuary (Ryan et al. 2003). Aggressively defends feeding territories in streams. Has caused contraction of range of native brook trout in southern Appalachian Mountains region (Larson and Moore 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There is little communication between rainbow trout and steelhead. Once the fry emerge from the gravel, they become hostile to each other and compete for habitat. Larger fish usually win out the best habitat and food sources, and there is a size hierarchy within aquatic systems among all trout species. Potential mates communicate before spawning with visual cues. Oncorhynchus_mykiss individuals are visual predators, relying on a keen sense of vision to detect prey. Salmonidae species use both chemical cues and detection of the earth's magnetic fields to navigate to and from natal streams and on ocean journeys.

Communication Channels: visual ; tactile

Perception Channels: visual ; magnetic

  • Grubb, T. 2003. The Mind of the Trout: A Cognitive Ecology for Biologists and Anglers. Madison, WI: The University of Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

There is little communication between rainbow trout and steelhead. Once the fry emerge from the gravel, they become hostile to each other and compete for habitat. Larger fish usually win out the best habitat and food sources, and there is a size hierarchy within aquatic systems among all trout species. Potential mates communicate before spawning with visual cues. Oncorhynchus mykiss individuals are visual predators, relying on a keen sense of vision to detect prey. Trout species use both chemical cues and detection of the earth's magnetic fields to navigate to and from natal streams and on ocean journeys.

Communication Channels: visual ; tactile

Perception Channels: visual ; magnetic

  • Grubb, T. 2003. The Mind of the Trout: A Cognitive Ecology for Biologists and Anglers. Madison, WI: The University of Wisconsin Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: May feed at any time throughout a 24-hour period, but usually feeds most actively around dusk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Oncorhynchus_mykiss larvae go through a series of morphological changes to prepare for life in the sea, and spend their adult life there for 2 to 3 years before migrating upstream to spawn in their natal stream.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reported not to establish breeding populations if the peak emergence of fry corresponds to flood season and cold summer temperatures and if temperature does not fall below 13° C (Ref. 59043). Males mature generally at 2 years and females at 3. Spawning happens from November until May in the Northern hemisphere and from August to November on the Southern hemisphere. The size of the eggs depends on the size of the female. In captivity spawning is fostered by abdominal massage. Egg size 3-6 mm, fry length after hatching 12-20 mm. Hatchlings are well developed and equipped with a large yolk sac. The female finds a spot and digs a pit. While digging, an attendant male courts her or is busy driving away other males. As soon as the pit is completed, the female drops into it and is immediately followed by the male. The pair is side by side, they open their mouth, quiver and release egg and sperm. Females produce from 700 to 4,000 eggs per spawning event (Ref. 4706). At this point, a subordinate male moves in and releases sperm into the nest. The female quickly moves to the upstream edge of the nest and starts digging a new pit, covering the eggs. The whole process is repeated for several days until the female deposits all her eggs (Ref. 27547). Young fish move downstream at night, shortly after emergence (Ref. 4706). Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Oncorhynchus mykiss larvae go through a series of morphological changes to prepare for life in the sea, and spend their adult life there for 2 to 3 years before migrating upstream to spawn in their natal stream.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Oncorhynchus_mykiss individuals live for 6 to 8 years in the wild, possibly up to 11 years.

Range lifespan

Status: wild:
11 (high) years.

Typical lifespan

Status: wild:
6 to 8 years.

  • Michigan Department of Natural Resources. 2005. "Steelhead: Oncorhynchus Mykiss" (On-line). Accessed October 07, 2005 at http://www.michigan.gov/dnr/0,1607,7-153-10364_18958-45692--,00.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Oncorhynchus mykiss individuals live for 6 to 8 years in the wild, possibly up to 11 years.

Range lifespan

Status: wild:
11 (high) years.

Typical lifespan

Status: wild:
6 to 8 years.

  • Michigan Department of Natural Resources. 2005. "Steelhead: Oncorhynchus Mykiss" (On-line). Accessed October 07, 2005 at http://www.michigan.gov/dnr/0,1607,7-153-10364_18958-45692--,00.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Female fish find suitable nest sites while their male mate guards the site from other interested males and predators. The female digs the nest (called a redd) with her anal fin and then descends upon it to position her vent and anal fin into the deepest part of the redd. The male joins her in a parallel position so that their vents are opposite each other. The male and female open their mouths, arch their backs, and deposit the eggs and milt (fish sperm) at the same time. The eggs are enveloped in a cloud of milt and are fertilized. Only a few seconds elapse from the time the female drops into the redd and fertilization occurs. The female then covers the nest with gravel and repeats the process again a few times until she has deposited all of her eggs.

Mating System: polygynous

Adult rainbow trout and steelhead lay their eggs in a series of nests in gravel. Collectively, the nests are called a redd. When they hatch, the hatchlings are still attached to, and survive on their yok sac. They remain in the protective gravel for about 2 to 3 weeks when they have shed their yolk sacs and are fit enough to survive in the open water. Juvenile fish tend to stick to shallow and side areas of the streams where there is protective cover and slow-moving currents. The remain in their native streams for 1 to 3 years while they grow fit enough to spawn or migrate to the ocean, in the case of steelheads.

Breeding interval: Rainbow trout breed every three to five years. Though steelhead are one of the only salmonids able to spawn twice in a lifetime, the return rate is very low, about 10-20%

Breeding season: Spawning occurs from March to July, depending on temperature and other climatic variables. Winter steelhead in California start spawning as early as January.

Range number of offspring: 200 to 8000.

Range time to hatching: 3 to 16 weeks.

Range time to independence: one to three years.

Range age at sexual or reproductive maturity (female): 3 to 11 years.

Range age at sexual or reproductive maturity (male): 3 to 11 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Average number of offspring: 3500.

Female rainbow trout and steelehead simply lay their eggs in a gravel bed and leave the young hatchlings to mature on their own. Male steelhead frequently breed with multiple female partners, possibly because more females than males die during the breeding period.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); inherits maternal/paternal territory

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Female fish find suitable nest sites while their male mate guards the site from other interested males and predators. The female digs the nest (called a redd) with her anal fin and then descends upon it to position her vent and anal fin into the deepest part of the redd. The male joins her in a parallel position so that their vents are opposite each other. The male and female open their mouths, arch their backs, and deposit the eggs and milt (fish sperm) at the same time. The eggs are enveloped in a cloud of milt and are fertilized. Only a few seconds elapse from the time the female drops into the redd and fertilization occurs. The female then covers the nest with gravel and repeats the process again a few times until she has deposited all of her eggs.

Mating System: polygynous

Adult rainbow trout and steelhead lay their eggs in a series of nests in gravel. Collectively, the nests are called a redd. When they hatch, the hatchlings are still attached to, and survive on their yok sac. They remain in the protective gravel for about 2 to 3 weeks when they have shed their yolk sacs and are fit enough to survive in the open water. Juvenile fish tend to stick to shallow and side areas of the streams where there is protective cover and slow-moving currents. The remain in their native streams for 1 to 3 years while they grow fit enough to spawn or migrate to the ocean, in the case of steelheads.

Breeding interval: Rainbow trout breed every three to five years. Though steelhead are one of the only salmonids able to spawn twice in a lifetime, the return rate is very low, about 10-20%

Breeding season: Spawning occurs from March to July, depending on temperature and other climatic variables. Winter steelhead in California start spawning as early as January.

Range number of offspring: 200 to 8000.

Range time to hatching: 3 to 16 weeks.

Range time to independence: one to three years.

Range age at sexual or reproductive maturity (female): 3 to 11 years.

Range age at sexual or reproductive maturity (male): 3 to 11 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; sexual ; fertilization (External ); oviparous

Average number of offspring: 3500.

Female rainbow trout and steelehead simply lay their eggs in a gravel bed and leave the young hatchlings to mature on their own. Male steelhead frequently breed with multiple female partners, possibly because more females than males die during the breeding period.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); inherits maternal/paternal territory

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns usually in spring (February-June), or later depending on water temperature and location. Lays 200-9000 eggs (Wydoski and Whitney 1979), which hatch in 3-4 weeks at 10-15 C. Fry emerge from gravel 2-3 weeks after hatching. Many are sexually mature in 2-3 years. See Stearley (1992) for a discussion of the historical ecology and life history evolution of Pacific salmons and trouts (Oncorhynchus).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fish respond to magnetic fields: rainbow trout
 

The trigeminal cranial nerve of rainbow trout helps them detect magnetic fields by containing magnetosensitive nerve fibers.

   
  "In 1997, the first known magnetoreceptors -- directly linking magnetite to neural connections and activity -- were found in vertebrates. A team of zoologists from Auckland University, led by Dr. Michael Walker, had been studying this mysterious sense in trout, and knew that a region of its skull contained magnetite.

"Recording neural activity from that region, they discovered that a specific subgroup of nerve fibers within a branch of the trigeminal cranial nerve called the ros V nerve fired in response to changes in the surrounding magnetic field. They also found magnetite in a tissue layer directly beneath the trout's olfactory (smell) organs. When they injected a colored dye into the ros V nerve's newly exposed magnetosensitive fibers, the dye revealed that the fibers terminated and ramified all around the magnetite-containing cells within the trout's olfactory tissue." (Shuker 2001:46)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
  • Bohannon, J. 2007. MICHAEL WALKER: Seeking Nature's Inner Compass. Science. 5852(318): 904-907.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Crystals create iridescent sheen: rainbow trout
 

The scales of a rainbow trout have a silvery shine due to guanine crystals.

   
  "The scales of a rainbow trout, reflective yet translucent. The silvery lustre is due to crystals of guanine, produced in the body as a waste product. The tiny black speckles are pigment cells, and at intervals there are large clusters of these where the pigment is distributed right across each cell, instead of only in the centre; here we get the large black patches which produce colour changes in response to hormones released during the breeding season - hence the name rainbow trout. The overlapping scales form a waterproof armour which is flexible enough to allow for the flexing of the body during swimming." (Foy and Oxford Scientific Films 1982:87)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus mykiss

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 263 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTGAGTCTACTGATTCGGGCGGAACTAAGCCAGCCGGGCGCTCTTCTGGGGGAT---GACCAAATCTATAACGTGATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATGCCAATTATAATCGGGGGCTTTGGAAACTGATTAATTCCCCTAATAATCGGAGCCCCTGATATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCTCCATCCTTTCTCCTCCTCCTGTCTTCATCAGGAGTTGAAGCCGGCGCGGGTACTGGATGAACAGTATACCCCCCTCTAGCCGGCAACCTCGCCCACGCAGGAGCCTCTGTTGATTTAACTATCTTCTCCCTTCATTTAGCTGGAATCTCCTCAATTTTAGGAGCCATTAATTTTATTACGACCATTATTAACATAAAACCTCCAGCCATCTCTCAGTACCAAACCCCCCTATTCGTTTGAGCCGTGCTAGTTACTGCTGTCCTTCTGTTACTTTCCCTCCCCGTCCTGGCAGCAGGCATTACTATGTTACTTACAGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCAATTTTATACCAACACCTCTTTTGATTCTTCAGCCACCCAGAGGTCTATATTCTCATCCTCCCAGGCTTTGGTATAATTTCACACATCGTTGCGTACTACTCCGGCAAAAAGGAACCCTTCGGGTATATAGGAATGGTCTGAGCTATAATAGCCATCGGGTTGTTAGGATTTATCGTTTGAGCCCACCATATGTTCACTGTAGGGATAGACGTGGACACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus mykiss

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 263
Specimens with Barcodes: 324
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Steelhead are endangered in Washington and California, and threatened in California, Oregon, Washington, and Idaho. Most of their decline has resulted from impacts to habitat and shrinking of spawning routes due to dams and other diversions. Siltation, caused by forestry practices, and erosion, caused by urban and agricultural development, has also impacted spawning beds.

IUCN Red List of Threatened Species: no special status

US Federal List: endangered

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Steelhead are endangered in Washington and California, and threatened in California, Oregon, Washington, and Idaho. Most of their decline has resulted from impacts to habitat and shrinking of spawning routes due to dams and other diversions. Siltation, caused by forestry practices, and erosion, caused by urban and agricultural development, has also impacted spawning beds.

US Federal List: endangered

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Very large range; abundant; secure on a range-wide scale. See also information for the many subspecies and stocks (e.g., steelhead, redband trout, etc.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: southern CA coast

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: upper Willamette R.

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: upper Columbia R. Basin

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: central CA coast

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: south central CA coast

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Central Valley CA

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: lower Columbia R.

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: middle Columbia R.

Status: Threatened
Date Listed: 09/07/2000
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: northern CA

Status: Threatened
Date Listed: 06/17/1998
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Snake R. Basin

Status: Under Review
Date Listed:
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Klamath Mountains Province


Population detail:

Population location: All naturally spawned populations (and their progeny) in streams and tributaries to the Columbia R. between the Cowlitz and Wind Rivers, WA, inclusive, and the Willamette and Hood Rivers, OR, inclusive, excluding the Upper Willamette River Basin above Willamette Falls and excluding the Little and Big White Salmon Rivers in WA
Listing status: T

Population location: All naturally spawned populations (and their progeny) in the Upper Columbia R. Basin upstream from the Yakima R., WA, to the U.S./Canada border, and also including the Wells Hatchery stock
Listing status: T

Population location: U.S.A. (OR, WA) All naturally spawned populations in streams above and excluding the Wind R. in Washington, and the Hood R. in Oregon, upstream to, and including, the Yakima R. Excluded are steelhead from the Snake R. Basin
Listing status: T

Population location: All naturally spawned populations (and their progeny) in streams in the Snake R. Basin of southeast WA, northeast OR, and ID
Listing status: T

Population location: All naturally spawned populations and their progeny in river basins from Redwood Creek in Humboldt County, CA to the Gualala River in Mendocino County, CA (inclusive)
Listing status: T

Population location: All naturally spawned populations (and their progeny) in rivers from the Santa Maria R., San Luis Obispo County, CA (inclusive) to Malibu Cr., Los Angeles County, CA (inclusive)
Listing status: E

Population location: All naturally spawned populations (and their progeny) in streams from the Pajaro R. (inclusive) located in Santa Cruz County, CA, to (but not including) the Santa Maria R
Listing status: T

Population location: U.S.A. (OR) All naturally spawned winter-run populations in the Willamette R. and its tributaries from Willamette Falls to the Calapooia R., inclusive
Listing status: T

Population location: All naturally spawned populations (and their progeny) in streams from the Russian R. to Aptos Cr., Santa Cruz County, CA (inclusive), and the drainages of San Francisco and San Pablo Bays eastward to the Napa R. (inclusive), Napa County, CA, excluding the Sacramento-San Joaquin R. Basin of the Central Valley of CA
Listing status: T

Population location: All naturally spawned populations (and their progeny) in the Sacramento and San Joaquin Rivers and their tributaries, excluding San Francisco and San Pablo Bays and their tributaries
Listing status: T

For most current information and documents related to the conservation status and management of Oncorhynchus mykiss, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: On a range-wide scale, this species is not significantly threatened. However, many subspecies and populations face serious threats (see separate accounts).

Declines in winter steelhead stocks from the Siuslaw River north to Tillamook Bay, Oregon, may have resulted from deterioration of ocean feeding conditions, widespread use of hatchery stock, predation by marine mammals, and ocean drift-net fishing (Nehlsen et al. 1991). Declining winter catches on the Illinois River (tributary to the Rogue River), Oregon, since the mid-1970s have been attributed to water withdrawal for irrigation (Nehlsen et al. 1991). In the Columbia River basin, winter stocks are threatened by habitat degradation, main stem passage problems, and interactions with hatchery fish (Nehlson et al. 1991). Declines in several winter populations in the Puget Sound area of Washington have resulted from habitat degradation (e.g., water quality problems, siltation, and sedimentation); predation by sea lions has been reported as a problem for the Lake Washington population (Nehlsen et al. 1991). Whirling disease has caused population declines in some areas. The disease is caused by a protozoan pathogen (inadvertently introduced from Europe) and involves tubifex worms as an alternate host. Brown trout (Salmo trutta) are unaffected by the protozoan and serve as a reservoir.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: A management concern in the West: keeping rainbow trout out of waters inhabited by native salmonids such as cutthroat trout and Gila trout so that the native species maintain their genetic integrity.

Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Rainbow trout have been introduced throughout the world, negatively impacting species of native freshwater fishes and, therefore, native fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These fish are one of the most popular game fishes around the world, leading to nearly global introduction. They are introduced to stimulate local angling and associated recreational economies. However, where they are introduced, they can outcompete native trout species.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Rainbow trout have been introduced throughout the world, negatively impacting species of native freshwater fishes and, therefore, native fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

These fish are one of the most popular game fishes around the world, leading to nearly global introduction. They are introduced to stimulate local angling and associated recreational economies. However, where they are introduced, they can outcompete native trout species.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Important game fish. Various populations have been cultured and introduced due to unique qualities (e.g., large lake form Kamloops; Eagle Lake rainbow, adapted to alkaline waters and usually piscivorous; Arlee strain, noted for fast growth, disease resistance, and high catchability (Sublette et al. 1990). Used in carcinogen testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Smolt-to-adult survival of spring/summer run chinook salmon is negatively associated with releases of hatchery-reared steelhead in the Snake River (Levin and Williams 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rainbow trout

The rainbow trout (Oncorhynchus mykiss) is a species of salmonid native to tributaries of the Pacific Ocean in Asia and North America. The steelhead is a sea-run rainbow trout (anadromous) usually returning to freshwater to spawn after two to three years at sea; rainbow trout and steelhead trout are the same species. The fish are often called salmon trout.[1] Several other fish in the salmonid family are called trout; some are anadromous like salmon, whereas others are resident in freshwater only.[2]

The species has been introduced for food or sport to at least 45 countries, and every continent except Antarctica. In some locations, such as Southern Europe, Australia and South America, they have negatively impacted upland native fish species, either by eating them, outcompeting them, transmitting contagious diseases, (such as whirling disease transmitted by Tubifex) or hybridization with closely related species and subspecies that are native to western North America (see Salmo marmoratus and Salmothymus obtusirostris salonitana).

Contents

Taxonomy [edit]

The species was originally named by Johann Julius Walbaum in 1792 based on type specimens from Kamchatka. Richardson named a specimen of this species Salmo gairdneri in 1836, and in 1855, W. P. Gibbons found a population and named it Salmo iridia, later corrected to Salmo irideus, these names faded, however, once it was determined that Walbaum's type description was conspecific and therefore had precedence (see e.g. Behnke, 1966).[3] More recently, DNA studies showed rainbow trout are genetically closer to Pacific salmon (Onchorhynchus species) than to brown trout (Salmo trutta) or Atlantic salmon (Salmo salar), so the genus was changed.

Unlike the species' former name's epithet iridia (Latin: rainbow), the specific epithet mykiss derives from the local Kamchatkan name 'mykizha'; all of Walbaum's species names were based on Kamchatkan local names.

The oceangoing (anadromous) form (including those returning for spawning) are known as steelhead, (Canada and the United States) or ocean trout (Australia), although they are the same species.

Life cycle [edit]

Like salmon, steelhead are anadromous: they return to their original hatching ground to spawn. Similar to Atlantic salmon, but unlike their Pacific Oncorhynchus salmonid kin, steelhead are iteroparous (able to spawn several times, each time separated by months) and make several spawning trips between fresh and salt water. The steelhead smolts (immature or young fish) remain in the river for about a year before heading to sea, whereas salmon typically return to the seas as smolts. Different steelhead populations migrate upriver at different times of the year. "Summer-run steelhead" migrate between May and October, before their reproductive organs are fully mature. They mature in freshwater before spawning in the spring. Most Columbia River steelhead are "summer-run". "Winter-run steelhead" mature fully in the ocean before migrating, between November and April, and spawn shortly after returning. The maximum recorded life-span for a rainbow trout is 11 years.[4]

Feeding [edit]

Drawing of fish with open mouth, bent body and stones in background
Illustration of a rainbow trout

Rainbow trout are predators with a varied diet, and will eat nearly anything they can grab. Their image as selective eaters is only a legend. Rainbows are not quite as piscivorous or aggressive as brown trout or lake trout (char). Young rainbows survive on insects, fish eggs, and smaller fish (up to 1/3 of their length), along with crayfish and other crustaceans. As they grow, though, the proportion of fish consumed increases in most populations. Some lake-dwelling lines may become planktonic feeders. While in flowing waters populated with salmonids, trout eat varied fish eggs, including salmon and cutthroat trout, as well as the eggs of other rainbow trout, alevin, fry, smolt and even leftover carcasses.

Length and weight [edit]

Line chart with length on the X axis and weight on the Y axis, showing mass increasing with length

As rainbow trout grow, they lengthen and increase in mass. The relationship between length and mass is not linear. The relationship between total length (L, in inches) and total mass (W, in pounds) for steelhead and nearly all other fish can be expressed by an equation of the form:

W = cL^b\!\,

To convert from W to L use:

L = (\frac{1}{c}W)^\frac{1}{b}

The factor b is close to 3.0 for all species, and c is a constant that varies among species. For lentic rainbow trout, b = 2.990 and c = 0.000426, and for lotic rainbow trout, b = 3.024 and c = 0.000370.[5] In metric units for L in cm and W in grams, use c=0.0119 for lentic and c=0.0100 for lotic. The largest recorded rainbow trout can measure 120 cm (47 in) long and weigh 24 kg (53 lb).[6]

The relationship described in this section suggests a 13 in (33 cm) lentic rainbow trout weighs about 1.0 lb (0.45 kg), while an 18 in (46 cm) lentic rainbow trout weighs about 2.5 lb (1.1 kg).

Gallery [edit]

Hatcheries [edit]

The first rainbow trout hatchery was established on San Leandro Creek, a tributary of San Francisco Bay, in 1870, with trout production beginning in 1871. The hatchery was stocked with the locally native rainbow trout, and likely steelheads. The fish raised in this hatchery were shipped to hatcheries out of state for the first time in 1875, to Caledonia, New York and then in 1876 to Northville, Michigan. In 1877, another rainbow trout hatchery was established on Campbell Creek, a McCloud River tributary. However, the McCloud River stock indiscriminately mixed rainbow trout with Redband trout (Oncorhynchus mykiss stonei).[7]

Golden rainbow trout are bred from a single mutated color variant of Oncorhynchus mykiss.[8] Golden rainbow trout are predominantly yellowish, lacking the typical green field and black spots, but retaining the diffuse red stripe.[8][9] The palomino trout is a mix of golden and common rainbow trout, resulting in an intermediate color. The golden rainbow trout should not be confused with the naturally occurring golden trout.

Fishing [edit]

Rainbow trout, cleaned and iced, in a fish market in Western Australia
Photo of fried steelhead filet on a plate
Rainbow trout and potatoes

Rainbow trout and steelhead are both highly desired food and sportfish. A number of angling methods are common. Rainbow trout are a popular target for fly fishers. Spinners, spoons, and small crankbaits can also be used productively, either casting or trolling. Rainbow trout can also be caught on live bait; nightcrawlers, trout worms, and minnows are popular and effective choices. The IGFA recognizes the world record for rainbow trout was caught on Saskatchewan's Lake Diefenbaker by Sean Konrad on September 5, 2009. The fish weighed 48 lb, 0 oz (21.77 kg). Many anglers consider the Rainbow trout the hardest fighting trout species, as this fish is known for leaping when hooked and putting a powerful fight.

Aquaculture [edit]

Rainbow trout are farmed in many countries throughout the world. Since the 1950s, commercial production has grown exponentially,[10] particularly in Europe and recently in Chile. Worldwide, in 2007, 604,695 tonnes (595,145 long tons; 666,562 short tons) of farmed salmon trout were harvested with a value of US$ 2.589 billion.[11] The largest producer is Chile. In Chile and Norway, ocean cage production of steelheads has expanded to supply export markets. Inland production of rainbow trout to supply domestic markets has increased in countries such as Italy, France, Germany, Denmark and Spain. Other significant producing countries include the USA, Iran, Germany and the United Kingdom.[11]

There are tribal commercial fisheries for steelhead in Puget Sound, the Washington Coast and in the Columbia River.

As food [edit]

Rainbow trout is popular in Western cuisine, and is caught wild and farmed. It has tender flesh and a mild, somewhat nutty flavor. Farmed trout and trout taken from certain lakes have a pronounced earthy flavor which some people find unappealing. Wild rainbow trout that eat scuds (freshwater shrimp), insects such as flies, and crayfish are the most appealing. Farmed trout and some populations of wild trout, especially anadromous steelhead, have red/orange flesh as a result of high astaxanthin levels in their diets. Astaxanthin is a powerful antioxidant that may be from a natural source or synthetically produced. The resulting pink flesh is sometimes marketed under names such as Ruby Red or Carolina Red.

The flavour of the meat is related to the size of the fish, fish larger than 1 kg having more flavour than small trout just as beef is more flavourful than veal. Steelhead meat is pink like that of salmon, and is more flavorful than the light-colored meat of rainbow trout.[12]

The sperm of rainbow trout contains protamine, which counters the anticoagulant heparin. Protamine was originally isolated from fish sperm, but is now produced synthetically.

Conservation [edit]

Steelhead trout populations have declined due to human and natural causes. Steelheads (Oncorhynchus mykiss) historically occurred around the North Pacific Ocean from northwestern Mexico in North America to eastern Russia in Asia.[13]

Two West Coast Evolutionarily Significant Units (ESUs) are endangered under the Federal Endangered Species Act (Southern California and Upper Columbia River) and eight ESUs are threatened.[14] The U.S. National Marine Fisheries Service has a detailed description of threats. Southern California (south of Point Conception) ESU steelheads have been affected by habitat loss due to dams, confinement of streams in concrete channels, water pollution, groundwater pumping, urban heat island effects, and other byproducts of urbanization.

Several studies have shown almost all California coastal steelheads are of native origin, despite over a century of hatchery stocking. Genetic analysis shows that South Central California Coast (SCCC) distinct population segment (DPS) and Southern California (SC) DPS from Malibu Creek north, and including the San Gabriel River, Santa Ana River and San Mateo Creek, are not hatchery strains. However, steelheads from Topanga Creek and the Sweetwater River were partly, and from San Juan Creek completely, of hatchery origin.[13] Genetic analysis has also shown the steelheads in the streams of the Santa Clara County and Monterey Bay basins are not of hatchery origin, including the Coyote Creek, Guadalupe River, Pajaro River, Permanente Creek, Stevens Creek, San Francisquito Creek, San Lorenzo River, and San Tomas Aquino Creek basins.[15] Natural waterfalls and two major dams have isolated Russian River anadromous steelheads from its freshwater rainbow trout form above the impassable barriers; however, a recent genetic study of fin samples collected from steelheads at 20 different sites both above and below passage barriers in the watershed found that despite the fact that 30 million hatchery trout were stocked in the river from 1911 to 1925, the steelheads remain of native and not hatchery stock.[16]

The rainbow trout is susceptible to enteric redmouth disease. A considerable amount of research has been conducted on redmouth disease, given its serious implications for rainbow trout farmers. The disease does not affect humans.[17]

The U.S. National Marine Fisheries Service has identified 15 populations, called distinct population segments (DPSs), in Washington, Oregon and California.[18][19] Eleven of these DPSs are listed under the U.S. Endangered Species Act (ESA).[20] One DPS on the Oregon Coast is designated a U.S. Species of Concern. Species of Concern are those species that lack sufficient data to determine whether to list the species under the ESA.

Rainbow trout, and subspecies thereof, are currently EPA-approved indicator species for acute fresh water toxicity testing.[21]

In 2010, the Oregon Department of Fish and Wildlife hatchery expects to more than double its take over 2009. The 2009 population grew 60% over 2008. Hatchery-taken fish will spawn tens of thousands of juvenile "smolts" that will be released to swim downstream and mature in the Pacific.[22]

In March 2010, the Los Angeles Times reported the New Zealand mud snail had infested watersheds in the Santa Monica Mountains, complicating efforts to improve stream-water quality for the steelheads. According to the article, the snails have expanded "from the first confirmed sample in Medea Creek in Agoura Hills to nearly 30 other stream sites in four years." Researchers at the Santa Monica Bay Restoration Commission believe the snails' expansion may have been expedited after the mollusks traveled from stream to stream on the gear of contractors and volunteers.[23]

Hatcheries have also been demonstrated to present a risk to wild steelhead populations. Releases of conventionally reared hatchery steelheads pose ecological risks to pre-existing wild steelhead populations. Hatchery steelheads are typically larger than the wild forms, and can displace wild-form juveniles from optimal habitats. Dominance of hatchery steelheads for optimal microhabitats within streams may reduce wild steelhead survival as a result of reduced foraging opportunity and increased rates of predation.[24]

Subspecies [edit]

A few populations are recognized as subspecies:

See also [edit]

Notes [edit]

  1. ^ "Salmon Trout". Lewis and Clark Fort Mandan Foundation. Retrieved 2010-10-23. 
  2. ^ Trey Coombs (1999). Steelhead Fly Fishing. Globe Pequot. p. 5. ISBN 978-1-55821-903-8. Retrieved 2010-10-23. 
  3. ^ Robert J. Behnke (1966). "Relationships of the Far Eastern Trout, Salmo mykiss walbaum". Copeia 1966 (2): 346–348. JSTOR 1441145. 
  4. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Oncorhynchus mykiss" in FishBase. February 2006 version.
  5. ^ R. O. Anderson and R. M. Neumann, Length, Weight, and Associated Structural Indices, in Fisheries Techniques, second edition, B.E. Murphy and D.W. Willis, eds., American Fisheries Society, 1996.
  6. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  7. ^ Robert J. Behnke, Ted Williams (2007). About Trout: The Best of Robert J. Behnke from Trout Magazine. Globe Pequot. p. 6. ISBN 978-1-59921-203-6. Retrieved 2011-05-03. 
  8. ^ a b Golden Rainbow Trout. Pennsylvania Fish and Boat Commission FAQ.
  9. ^ Golden Rainbow Trout. Photo.
  10. ^ Cowx, I.G. Cultured Aquatic Species Information Programme Oncorhynchus mykiss Walbaum, 1792 (Salmonidae) Rainbow Trout Food and Agricultural Organisation of the United Nations Fisheries and Aquaculture Department (online), Rome, Updated 15 June 2005, Retrieved 27 September 2010
  11. ^ a b FAO: Species Fact Sheets: Oncorhynchus mykiss (Walbaum, 1792) Rome. Accessed 9 May 2009.
  12. ^ Doug Rose Your Christmas Steelhead. wogameandfish.com
  13. ^ a b Anthony J. Clemento, Eric C. Anderson, David Boughton, Derek Girman, John Carlos Garza (2009). "Population genetic structure and ancestry of Oncorhynchus mykiss populations above and below dams in south-central California". Conservation Genetics: 1321–1336. Retrieved 2011-06-11. 
  14. ^ "Map showing endangered species status of west coast steelhead". Alameda Creek Alliance. Retrieved FEb. 14, 2010. 
  15. ^ John Carlos Garza, Devon Pearse (2008-03). Population genetics of Oncorhynchus mykiss in the Santa Clara Valley Region, Final Report to the Santa Clara Valley Water District (Report). Santa Clara Valley Water District. pp. 1–54.
  16. ^ Kristy Deiner, John Carlos Garza, Robert Coey, Derek J. Girman (2007). "Population structure and genetic diversity of trout (Oncorhynchus mykiss) above and below natural and man-made barriers in the Russian River, California". Conservation Genetics: 437–454. Retrieved 2011-06-12. 
  17. ^ G. L. Bullock and R. C. Cipriano (1990). Enteric Redmouth Disease of Salmonids. LSC – Fish Disease Leaflet 82. Fish and Wildlife Service. lsc.usgs.gov
  18. ^ "Distinct Population Segments". U.S. National Marine Fisheries Service. 
  19. ^ "Steelhead Distinct Population Segments". U.S. National Marine Fisheries Service. 
  20. ^ "Endangered Species Act". 
  21. ^ EPA Whole Effluent Toxicity. Epa.gov. Retrieved on 2012-08-23.
  22. ^ Millman, Joel (January 21, 2010). "Fish Boom Makes Splash in Oregon". Wall Street Journal. Retrieved January 21, 2010. 
  23. ^ Hard-to-kill snails infest Santa Monica Mountain watersheds Even Formula 409 has proven ineffective at destroying the New Zealand mudsnail, an asexually reproducing, invasive species that poses a threat to steelhead restoration efforts and native creatures.
  24. ^ McMichael, G. A., T. N. Pearsons, and S. A. Leider. 1999. Behavioral interactions among hatchery-reared steelhead smolts and wild Oncorhynchus mykiss in natural streams. North American Journal of Fisheries Management 19: 948–956

Other references [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Sheepheaven Creek redband

The Sheepheaven Creek redband (Oncorhynchus mykiss spp.) is a species of fish in the Salmonidae family and a western subspecies of the McCloud River redband (Oncorhynchus mykiss stonei).[1] It is native to Sheepheaven Creek, Siskiyou County, California, United States.[2][3] Sheepheaven Creek redband were transplanted into Swamp Creek in 1972 and 1974 and into Trout Creek[disambiguation needed] in 1977. They can now be found in both locations.[4] Sheepheaven Creek redband are found to be the most distinct among all other trout groups, meriting recognition as a new subspecies.[5][6][7] They have the fewest gill rakers of any western trout.[8]

References

  1. ^ California Department of Fish and Game; California Inland Fisheries Branch (1973). Inland fisheries administrative report. 74-75. California: State of California, The Resources Agency, Department of Fish and Game.
  2. ^ J. R. Gold (1977). Systematics of western North American trout (Salmo). California.
  3. ^ Peter B. Moyle (1976). Inland Fishes of California. California: University of California Press.
  4. ^ Steven Ojai. "Fly Fishing the Sierra". http://stevenojai.tripod.com/redband.htm. Retrieved November 15, 2012.
  5. ^ Robert J. Behnke (2002). Trout and Salmon of North America. New York: Chanticleer Press. ISBN 0-7432-2220-2.
  6. ^ Molly Rebecca Stephens (2007). Systematics, Genetics and Conservation of Golden Trout. California: University of California.
  7. ^ Jeff Weaver; Stephanie Mehalick. "Genetic Sampling of Oncorhynchus mykiss in the Upper McCloud River Drainage". California Department of Fish and Game. http://www.nrm.dfg.ca.gov/FileHandler.ashx?DocumentID=31255. Retrieved November 16, 2012.
  8. ^ Robert J. Behnke (1992). American Fisheries Society Monograph - Native trout of western North America. 6. Bethesda, Maryland, United States: American Fisheries Society. ISBN 0-913235-78-4.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Baja California rainbow trout

The Baja California rainbow trout or San Pedro Martir trout or Nelson's trout (Oncorhynchus mykiss nelsoni) is a species of fish in the Salmonidae family.[1] It is endemic to North America.[2]

References

  1. ^ "ITIS Standard Report Page: Oncorhynchus mykiss nelsoni". itis.gov. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=553430. Retrieved October 8, 2012. 
  2. ^ Robert J. Behnke (1992). American Fisheries Society Monograph. 6. Bethesda, Maryland, United States: American Fisheries Society. ISBN 0-913235-78-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This highly variable species formerly was known as Salmo gairdneri, but this taxon is closely related to Pacific salmon and is conspecific with Asiatic steelhead (Oncorhynchus mykiss). For a complete taxonomic history, see Smith and Stearley (1989), Robins et al. (1991), and Behnke (1992).

"Redband" trout has been used as the name for nonanadromous populations adapted to harsh arid environments (Wishard et al. 1984); however, the term "redband" should not be used to imply a taxonomic relationship among all groups of rainbow trout in interior basins of Oregon and adjacent areas of Idaho, Nevada, and California (Wishard et al. 1984, Currens et al. 1990). Currens et al. (1990) found no evidence that all isolated groups of rainbow trout with plesiomorphic characteristics in the White River, Oregon desert basins, and northern California represent a monophyletic group.

Behnke (1992) included in O. mykiss three major groups: (1) the redband trout of the Columbia River basin east of the Cascade Mountains, and in upper Fraser River basin and the Athabasca headwaters of the Mackenzie River basin (subspecies gairdneri); (2) the redband trout of the Sacramento River basin, which he regarded as comprising two Kern River drainage subspecies (aguabonita and gilberti), plus the McCloud River subspecies (provisionally denoted as subspecies stonei); and (3) the coastal rainbow trout (nominal subspecies irideus of North America and mykiss of eastern Asia, though no known taxonomic characters separate mykiss from irideus). Behnke concluded that other forms, such as the redband trout native to Oregon desert basins, Upper Klamath Lake, the Pit River drainage, and Eagle Lake, California, cannot be consistently distinguished from the three groups listed above. He noted that their classification is a matter of personal preference and professional judgment. However, in the same publication, he stated that "the trout specialized for lacustrine conditions in Klamath Lake...is well differentiated from other groups of both redband and coastal rainbow trout and could be recognized as a subspecies, O. m. newberrii."

Hatchery rainbow trout derived mainly from coastal steelhead are widely stocked throughout the ranges of western trout (Behnke 1992). These hatchery fishes have led to hybridization with most populations of resident redband trout in the upper Sacramento River basin, the Oregon desert basins, and much of the Columbia River basin (Behnke 1992).

Oncorhynchus mykiss freely interbreeds with cutthroat trout (O. clarki) and Gila trout (O. gilae), producing fertile offspring (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!