Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Comprehensive Description

The Coho or Silver Salmon (Oncorhynchus kisutch) has black spots on the back and upper lobe of the caudal fin. The gums are light at the base of the teeth. At sea, these salmon are metallic blue above and silver below. Breeding males have dusky green on the back and head, with bright red sides and a black belly; females have bonze to pink-red sides. Spawning males develop a strongly hooked snout and large teeth. Maximum length is around 100 cm. Chinook Salmon (O. tshawytscha) are very similar in appearance to Coho Salmon while at sea, but Chinook Salmon are larger, have black spots on both the upper and lower caudal fin lobes, and have gums that are dark at the base of the teeth. (Page and Burr 1991)

Coho Salmon occur in northeastern Asia and, in North America, in Arctic and Pacific drainages from Point Hope, Alaska, to Monterey Bay, California (occasionally as far south as Baja California). These fish are anadromous, returning from the ocean to the coastal streams or rivers where they were born to spawn. They reproduce just once, then die. (Page and Burr 1991)

For detailed information on the biology and status of this species, including conservation issues, see this resource from the NOAA Fisheries Office of Protected Resources.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

The fish occur in the ocean or in lakes; adults return to the rivers where they were born (Ref. 27547). The young fish emerge in springtime and they usually live in fresh water for 1-2 years (sometimes up to 4 years, Ref. 27547); later they migrate at night to freshwater lakes or to the sea (Ref. 1998). Epipelagic (Ref. 58426). The fish that stay more than two years in fresh water and become sexually ripe without ever going to sea, are called residuals; they never spawn (Ref. 27547). Young fish in lakes and rivers eat mainly insects; they stay almost entirely in deep parts of the river and soon become strongly territorial (Ref. 27547). Upon reaching the sea, the smolts remain close to the coast for a certain time, eating planktonic crustaceans (Ref. 27547). As they grow, they migrate farther out into the sea and hunt larger organisms (Ref. 27547) such as jellyfish, squids and fishes (Ref. 58426). They are hunted by various fishes, birds (mergansers, loons and kingfishers), mammals and lampreys (Ref. 1998). This kind is traded as fresh fish, dried or salted, smoked, canned, preserved and frozen (Ref. 9988). They are steamed, grilled, broiled, cooked in the microwave and baked (Ref. 9988). The Alaska Salmon fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_485.htm).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Oncorhynchus kisutch, commonly known as coho salmon, are primarily found in coastal waters. Coho salmon do not range widely in the open ocean like that of many other salmon species. Oncorhynchus kisutch are also found in fresh water, during their first year and later while spawning. They are found in fresh streams of the North Pacific, ranging from Baja, California to Alaska (Wheeley, 1985).

Biogeographic Regions: nearctic (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

New Brunswick to Chesapeake Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, European waters (ERMS scope), FAO fishing area 67, Gulf of Maine, North East Pacific, North Pacific, North West Atlantic, North West Territories, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native range includes the Pacific Ocean and tributary drainages, in eastern Asia from the Anadyr River south to northern Japan and in North America from Point Hope, Alaska, south to central California and infrequently at sea as far south as Baja California. The species is most abundant between Oregon and southeastern Alaska, rare south of central California. It has been widely stocked in lakes and reservoirs throughout North America and elsewhere.

See Frissell (1993) for a map indicating present and former distribution in the Pacific Northwest and California. See Moyle et al. (1989) for further information on distribution in California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: distributed from the Anadyr River in Russia south towards Hokkaido, Japan, and from Point Hope in Alaska southwards to Chamalu Bay in Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Oncorhynchus kisutch typically spend the first year of their life in fresh water. Upon moving to the ocean, growth increases dramatically. At about the third year, coho salmon reach maturity. They weigh from 6 to 12 pounds and can be up to 38 inches in length.

Oncorhynchus kisutch are deep-bodied salmon with unique color characteristics. The dorsal surface is a metallic blue while the sides are a silver color. Black spots appear on the back and upper lobe of the caudal fin. A lateral line is also present. The line is curved toward the front of the fish and straightens out as it approaches the back of the fish. While spawning, the fish's back and belly turn dark. Spawning males' sides develop a bright red line and their jaws become hooked (Clemens and Wilby, 1961).

Range mass: 3 to 6 kg.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 9 - 13; Analspines: 0; Analsoft rays: 12 - 17; Vertebrae: 61 - 69
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 61 cm

Weight: 6000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 980 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

108 cm TL (male/unsexed; (Ref. 40637)); 65.5 cm (female); max. published weight: 15.2 kg (Ref. 40637); max. reported age: 5 years (Ref. 36794)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Characterized by the presence of small black spots on the back and on the upper lobe of the caudal fin, and by the lack of dark pigment along the gum line of the lower jaw (Ref. 27547). The gill rakers are rough and widely spaced; the lateral line is nearly straight (Ref. 27547). The adipose fin is slender; the pelvic fins have an axillary extension (Ref. 27547). Fish in the sea are dark metallic blue or greenish on the back and upper sides, a brilliant silver color on middle and lower sides, and white below; small black spots are present on the back and upper sides and on the upper lobe of the caudal fin (Ref. 27547). During the spawning season fish turn dark to bright green on head and back, bright red on the sides, and often dark on the belly (Ref. 27547). Females are less brightly colored than males (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat

Coho Salmon live in fresh and ocean water. In fresh water, coho like relatively slow moving water with fine gravel. In the ocean, coho tend to live closer to shores than in the open ocean. (StreamNet, 1996)

Aquatic Biomes: rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

anadromous species; born in freshwater, spends most of life at sea, returns upriver to spawn
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 34 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.065 - 151
  Temperature range (°C): 7.819 - 7.819
  Nitrate (umol/L): 20.559 - 20.559
  Salinity (PPS): 33.279 - 33.279
  Oxygen (ml/l): 4.214 - 4.214
  Phosphate (umol/l): 1.826 - 1.826
  Silicate (umol/l): 30.305 - 30.305

Graphical representation

Depth range (m): 0.065 - 151
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Coho salmon usually spend 2 (range 1-3) growing seasons in the ocean before spawning. In the ocean, they remain over the continental shelf and generally stay within 30 km of their natal stream (but some may range up to several hundred kilometers away).

Spawning occurs in just about any accessible coastal stream, generally in forested areas, usually at 6-12 C in loose coarse gravel at heads of riffles (or tails of pools) in rounded troughs excavated by females where water is 10-54 cm deep. Females construct and deposit eggs in each of several redds. Individuals generally spawn in their natal stream; however, rapid colonization of newly accessible habitat has been observed.

Young spend a few weeks to 2 years (varies geographically) in freshwater streams before migrating to the sea (young in the north spend a longer time in fresh water than do those in the south). Often this period is substantial and amounts to approximately half of the life cycle. Hatchlings that have left the spawning site seek shallow water, usually along stream margins. Older juveniles prefer pools and runs with good cover, high oxygen levels, and abundant invertebrate populations. Fry may summer in brackish water in southeastern Alaska.

Stocked populations in lakes and reservoirs migrate upstream to spawn or more commonly do not reproduce (must be restocked annually).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 250 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Introduction

This species has been introduced or released in Dutch waters.
  • Nijssen, H.; de Groot, S.J. (1987). De vissen van Nederland: systematische indeling, historisch overzicht, het ontstaan van de viskweek, uitheemse vissoorten, determineersleutels, beschrijvingen, afbeeldingen, literatuur, van alle in Nederlandse wateren voor komende zee- en zoetwatervissoorten [Fishes of the Netherlands: systematic classification, historical overview, origins of fish culture, non-indigenous species, determination keys, descriptions, drawings, literature references on all marine and freshwater fish species living in Dutch waters]. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-006-1. 224 pp.   http://www.marinespecies.org/aphia.php?p=sourcedetails&id=73 External link.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Adults migrate up streams typically in late summer and fall (late fall through mid-winter in the far south), when heavy fall rains result in flows strong enough to breach sand bars at the mouths of coastal streams (Moyle et al. 1989).. Some populations, now considered extinct, may have migrated hundreds of miles inland to spawn in tributaries of the upper Columbia River in Washington and the Snake River in Idaho (NMFS 1995).

See NMFS (1995) for information on the oceanic distributions of the different spawning stocks in Washington, Oregon, and California.

In California, "big river coho salmon" begin entering streams typically in September or October, migrate upstream 100-200 km or more to spawning sites; "short-run coho salmon" rarely migrate more than 100 km upstream (Moyle et al. 1989). In California, juveniles begin migration downstream to ocean in early spring; migrate in schools of 10-50 (Moyle et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In fresh water streams and rivers, juvenile coho salmon defend territories and compete for limited feeding sites with other fish. In order to attain these feeding sites, they may charge or chase other fish away, as growth and fitness depend on it. Coho salmon attack prey by sprinting and striking. They are able to maneuver well in order to capture prey. In fresh water, coho eat insects and smaller fish. When they move to the ocean they begin to grow rapidly due to the abundance of food. Once these fish reach the ocean their diet changes to other fish, such as herring and squid (Groot et. al., 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The fish occur in the ocean or in lakes; adults return to the rivers where they were born (Ref. 27547). The young fish emerge in springtime and they usually live in fresh water for 1-2 years (sometimes up to 4 years, Ref. 27547); later they migrate at night to freshwater lakes or to the sea (Ref. 1998). Epipelagic (Ref. 58426). The fish that stay more than two years in fresh water and become sexually ripe without ever going to sea, are called residuals; they never spawn (Ref. 27547). Young fish in lakes and rivers eat mainly insects; they stay almost entirely in deep parts of the river and soon become strongly territorial (Ref. 27547). Upon reaching the sea, the smolts remain close to the coast for a certain time, eating planktonic crustaceans (Ref. 27547). As they grow, they migrate farther out into the sea and hunt larger organisms (Ref. 27547) such as jellyfish, squids and fishes (Ref. 58426). They are hunted by various fishes, birds (mergansers, loons and kingfishers), mammals and lampreys (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Fry feed on a variety of small invertebrates. Parr feed on aquatic insects and their larvae, terrestrial insects, and some small fishes. At sea, preys primarily on other fishes (Moyle 1976), also inverts (see Hassler 1987 for details).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: In a survey of populations in the contiguous U.S., Huntington et al. (1996) identified only three healthy native stocks, all in Washington.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fry initially form schools, later become territorial after attaining parr stage. Tends to form schools in ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Feeding activity of juveniles reduced in winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Adults migrate from the sea or lake, school at mouths of rivers, and move upstream when rains increase river flow (Ref. 1998). As a rule, the winter entries (December and January) occur in the southern part of the range, with appearance in fresh water becoming progressively earlier to the north (Ref. 30381, 30382, 30383). At the spawning area, the female finds a spot and digs a pitt. At this point she is aggressive toward other females. While digging, an attendant male courts her or is busy driving away other males. As soon as the pitt is completed, the female drops into it and is immediately followed by the male. The pair are side by side, they open their mouth, quiver and release egg and sperm (Ref. 27547). At this point, other males move in and release sperm into the nest (Ref. 1998). The female quickly moves to the upstream edge of the nest and starts digging a new pitt, covering the eggs. The whole process is repeated for several days until the female deposits all her eggs. The male then leaves and may seek another female. The spent female usually continues to dig, until she dies (Ref. 27547).Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
4.1 years.

Average lifespan

Status: wild:
5.0 years.

Average lifespan

Status: wild:
4.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5 years (wild) Observations: The salmon ages and dies shortly after spawning. It is not considered ageing but rather sudden death.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

At three to four years of age, coho salmon reach sexual maturity. From September to October, coho swim to the fresh water streams where they were born (up to 400 miles). Once the fish reach their natal site females dig a nest in a gravel-type area. After the nest is made a female and one male (occasionally 2) breed. In this breeding, the female lays her eggs and the male's sperm is spread over them, thus fertilizing them. After fertilization has occurred, the eggs are buried by other female coho that are digging their nests. Following reproduction, males and females die, giving the waters more nutrients. Larvae hatch 6-8 weeks after fertilization. The larvae remain in the gravel for 2-3 weeks. Coho live in streams or rivers for about a year until they move to the ocean. (Wheeler, 1985)

Average age at sexual or reproductive maturity (male)

Sex: male:
1095 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1095 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawning occurs mainly November-January in California, mainly in December in southern Oregon and northern California, most frequently in January south of the Mattole River, and September-December (mainly November-December) in Washington and Oregon

Female may guard nest for up to 2 weeks. Eggs incubate in winter and hatch in 1.5-4 months, depending on temperature. Young emerge from gravel 2-10 weeks after hatching.

Adults die soon after spawning, at age 2-5 years (usually at three years in Washington, Oregon, and California, 4 years in southeastern Alaska); some males return to spawn after only 6 months at sea.

Stocked populations usually do not reproduce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus kisutch

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 159 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC3751-07|EF126369|Oncorhynchus kisutch| ACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTA---AGTCTACTGATTCGAGCAGAACTGAGCCAGCCGGGCGCTCTTCTAGGGGAT---GATCAGATTTACAACGTAATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTCATGCCGATTATGATCGGAGGCTTTGGAAACTGATTAATCCCCCTAATG---ATCGGAGCCCCTGATATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCGCCATCCTTTCTCCTCCTCCTATCTTCCTCTGGAGTTGAAGCCGGGGCTGGCACCGGGTGAACAGTTTATCCCCCTCTGGCCGGCAACCTCGCCCACGCAGGAGCCTCAGTTGATCTG---ACTATCTTCTCCCTTCATTTAGCCGGGATCTCCTCAATTTTAGGAGCCATTAATTTTATTACGACCATTATTAACATAAAGCCCCCAGCTATCTCTCAGTACCAAACCCCACTTTTTGTTTGAGCTGTGCTAGTCACTGCTGTTCTTCTACTACTCTCTCTCCCCGTTCTGGCAGCA---GGCATTACTATGTTACTTACAGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCAATTTTATACCAGCACCTCTTTTGATTCTTCGGTCACCCAGAAGTCTATATTCTGATCCTCCCCGGCTTTGGTATAATTTCACATATCGTTGCGTACTATTCCGGTAAAAAA---GAACCATTCGGGTATATGGGAATAGTCTGAGCTATAATAGCCATCGGATTATTAGGATTTATCGTCTGAGCCCACCATATGTTCACTGTTGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus kisutch

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 159
Species: 163
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

There has been a serious decline of wild coho stocks in the Strait of Georgia, due to loss of habitat (from dams) and overfishing. A plan of harvest management has been developed and implemented by the Dept. of Fisheries and Oceans. (Pacific Salmon Foundation, 1995)

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Still widespread around the margins of the North Pacific Ocean, and abundant in some areas, but logging and poor watershed management have caused many local extirpations and numerous declines; many runs are reported as now being of less than 25-50 individuals each.

Other Considerations: The wild populations are of primary concern. Each coastal stream probably comprises a distinctive strain adapted for local environments.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 11/20/1996
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Central California Coast ESU

Status: Threatened
Date Listed: 06/18/1997
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Southern Oregon Northern California Coast ESU

Status: Threatened
Date Listed: 06/28/2005
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Lower Columbia River ESU

Status: Threatened
Date Listed: 04/13/2011
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Oregon Coast ESU


For most current information and documents related to the conservation status and management of Oncorhynchus kisutch, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Of 2594 stocks in British Columbia and Yukon, Slaney et al. (1996) categorized 29 as extirpated, 214 as high risk, 22 as moderate risk, 21 as special concern, 1024 as unthreatened, and 1284 as unknown status. In the 1900s, indigenous, naturally reproducing populations are believed to have been extirpated in nearly all Columbia River tributaries and to be in decline in numerous coastal streams in Washington, Oregon, and California; at least 33 populations have been identified by agencies and conservation groups as being at moderate to high risk of extinction (NMFS 1995); at least 15 stocks in the contiguous U.S. have been extirpated (Nehlsen et al. 1991). Wild fish are increasingly rare throughout the range, especially at the southern and eastern parts of the range (see Nehlsen et al. 1991 for a review of the status and declines of these populations). Stable or increasing in a portion of northern California and in northwestern Washington; special concern, threatened, endangered, or extirpated elsewhere (see map in Frissell 1993). In California, populations fluctuate, but the general trend seems to be downward for wild, short-run populations in small coastal streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Many populations have been negatively impacted by logging, agricultural activities, overgrazing, urbanization, stream channelization, wetland loss, and poor watershed management practices that increase stream temperatures, cause siltation, or otherwise destroy or degrade habitat; road construction also has negatively altered many smaller coastal streams; dams, water withdrawals, and unscreened diversions for irrigation also have contributed to the decline. Poor ocean conditions (e.g., El Nino conditions) are believed to have played a prominent role in the decline of populations in Washington, Oregon, and California (NMFS 1995). The effects of extended drought on water supplies and water temperatures are a major concern for California populations of coho salmon. Native populations are most at risk in the southern and eastern parts of the range, largely as a result of the effects of successful hatchery programs (Nehlsen et al. 1991). Potential problems associated with hatchery programs include genetic impacts on indigenous, naturally reproducing populations, disease transmission, predation on wild fishes, difficulty in determination of wild run status due to incomplete marking of hatchery releases, and replacement (rather than supplementation) of wild stocks through competition and continued annual introductions of hatchery fishes (NMFS 1995). It is difficult to assess the degree to which recreational and commercial harvest have contributed to the decline. Spawning fish can withstand moderate disturbance. See NMFS (Federal Register, 6 May 1997) for further information on threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: Recovery will be difficult due to the large number of small coastal streams in which changes in logging and road construction plans would have to be made (Moyle et al. 1989).

Management Requirements: Hatcheries contribute to much of production (Hassler 1987). Meffe (1992) gave reasons why the hatchery approach to recovery ultimately will fail, and he emphasized that overharvest and habitat destruction need to be addressed in a major landscape-level effort. See Thomas et al. (1993) for information on habitat management for this and other at-risk fish species in the Pacific Northwest.

To regulate fishery for optimum yield, California, Washington, and Oregon have limited entry of new fishing boats into fleet and have instituted catch quotas (Hassler 1987).

Stocks transplanted to non-native streams exhibit reduced survival (see Williams et al. 1992).

Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

Biological Research Needs: Determine genetic variation among wild populations in different streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Some spawning streams are protected in state parks and TNC preserves, but adults are harvested on the way up river to spawn.

Needs: Protect spawning and rearing (juvenile) habitats. See Nehlsen et al. (1991) for general protection and management recommendations for anadromous salmonids.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Oncorhynchus kisutch make a good meal. Often, coho are either sold frozen or canned by commercial fisherman. Twice as many coho salmon are harvested commercially in North America than in Asia. During the late 1950's about 10 million coho salmon per year were caught. These numbers declined to 4.5 million coho per year in the 60's and have now risen to about 10.5 million coho per year. Fishing for coho is also an important sport for trollers and flyfisherman. (McNeil et. al, 1980)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Provides extensive commercial and sport fishery (Hassler 1987). Comprised around 10% of the commercial Pacific salmon catch in the 1970s, with several million caught in North America waters (see Sandercock 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coho salmon

The Coho salmon, Oncorhynchus kisutch, (from the Russian кижуч kizhuch) is a species of anadromous fish in the salmon family. Coho salmon are also known as silver salmon or "silvers". It is the state animal of Chiba, Japan.

Contents

Description

During their ocean phase, Coho have silver sides and dark blue backs. During their spawning phase, the jaws and teeth of the coho become hooked. After entering fresh water they develop bright red sides, bluish green heads and backs, dark bellies and dark spots on their backs. Sexually maturing coho develop a light pink or rose shading along the belly and the males may show a slight arching of the back. Mature adults have a pronounced red skin color with darker backs and average 28 inches (71 cm) and 7 to 11 pounds (3.2 to 5.0 kg), occasionally reaching up to 36 pounds (16 kg). Mature females may be darker than males, with both showing a pronounced hook on the nose.[1]

Reproduction

The eggs hatch in the late winter or early spring after 6 to 7 weeks in the redd. Once hatched, they remain mostly immobile in the redd during the alevin life-stage, which lasts for 6–7 weeks. Alevin no longer have the protective egg shell, or chorion, and rely on their yolk sac for nourishment during growth. The alevin life stage is very sensitive to aquatic and sedimental contaminants. When the yolk sac is completely resorbed, the alevin leaves the redd. Young coho spend one to two years in their freshwater natal streams, often spending the first winter in off-channel sloughs, before transforming to the smolt life-stage. Smolts are generally 100–150 millimetres (3.9–5.9 in) and as their parr marks fade the adult's characteristic silver scales start to dominate. Smolts migrate to the ocean from late March through July. Some fish leave fresh water in the spring, spend summer in brackish estuarine ponds and then return to fresh water in the fall. Coho salmon live in salt water for one to three years before returning to spawn. Some precocious males known as "jacks" return as two-year-old spawners. Spawning males develop a strongly hooked snout and large teeth.

Range

Silver Salmon caught in the ocean just off Raspberry Island, Alaska in the Kodiak Archipelago.

The traditional range of the coho salmon runs along both sides of the North Pacific ocean, from Hokkaidō, Japan and eastern Russian, around the Bering Sea to mainland Alaska, and south all the way to Monterey Bay, California.[2] Coho salmon have also been introduced in all the Great Lakes, as well as many landlocked reservoirs throughout the United States.

Human uses

Coho salmon are the backbone of the Alaskan troll fishery; however, the majority are caught by the net fishery (Gillnet and Seine). Coho salmon average 3.5% by fish of the annual Alaska salmon harvest; 5.9% by weight of the annual Alaska salmon harvest. (Alaska Seafood Marketing Institute, 2003, p. 2)

This species is a game fish in fresh and salt water from July to December, especially with light fishing tackle. It is one of the most popular sport fish in the Pacific Northwest of the United States and Canada. Its popularity is due in part to the reckless abandon which it frequently displays chasing bait and lure while in salt water, and the large number of coastal streams it ascends during its spawning runs. Its habit of schooling in relatively shallow water, and often near beaches, makes it accessible to anglers on the banks as well as in boats.

Ocean-caught coho is regarded as excellent table fare. It has a moderate to high amount of fat, which is considered essential when judging taste. Only Spring Chinook and Sockeye salmon have higher levels of fats in their meat.

Historically, the coho, along with other species, has been a staple in the diet of several Indigenous Peoples, who would also use it to trade with other tribes farther inland. The coho salmon is also a symbol of several tribes, representing life and sustenance.

During November 1997, a Portland television station and The Oregonian teamed with the Oregon chapter of the American Meteorological Society (AMS) to name the strong Columbia River Gorge winds through a contest. Some 7,000 entries were submitted to the "Name our East Wind Contest" with a total of 2,424 different names. The name 'Coho' was judged to be the best name, since it is easy to pronounce (and spell), it's an indigenous name to the Pacific Northwest, Coho salmon are wild fast swimmers analogous to the wind, and it relates to the widely known westerly Chinook winds that are also a name of a salmon.

Ecology

In their freshwater stages coho feed on plankton and insects, then switch to a diet of small fish upon entering the ocean as adults. Spawning habitats are small streams with stable gravel substrates.

Salmonid species on the west coast of the United States have experienced dramatic declines in abundance during the past several decades as a result of human-induced and natural factors.[3]

Conservation

The U.S. National Marine Fisheries Service (NMFS) has identified seven populations, called Evolutionary Significant Units (ESUs), of coho salmon in Washington, Oregon and California.[4][5] Four of these ESUs are listed under the U.S. Endangered Species Act (ESA).[6] These are the Lower Columbia River (threatened), Oregon Coast (threatened), Southern Oregon and Northern California Coasts (threatened), and Central California Coast (endangered). The long-term trend for the listed populations is still downward, though there was one recent good year with an increasing trend in 2001.[7]

The Puget Sound/Strait of Georgia ESU in Washington state is a NMFS "Species of Concern".[8] Species of Concern are those species for which insufficient information prevents resolving the U.S. National Oceanic and Atmospheric Administration's concerns regarding status and threats and whether to list the species under the ESA.

On May 6, 1997, NMFS, on behalf of the Secretary of Commerce, listed as threatened the Southern Oregon/Northern California Coast coho salmon ESU.[9] The coho salmon population in the Southern Oregon/Northern California region has declined from an estimated 150,000–400,000 naturally spawning fish in the 1940s to fewer than 10,000 naturally producing adults today. These reductions are due to natural and man-made changes, including short-term atmospheric trends, such as El Niño, which causes extremes in annual rainfall on the northern California coast; predation by the California Sea Lion and Pacific Harbor Seal; and commercial timber harvesting.[citation needed]

More than 680,000 coho returned to Oregon in 2009, double that of 2007. The Oregon Department of Fish & Wildlife required volunteers to herd fish into hatchery pens. There were reports of creeks with so many fish that "you could literally walk across on the backs of Coho," said Grant McOmie, outdoors correspondent for a Portland television station. Lower temperatures in 2008 North Pacific waters brought in fatter plankton which, along with greater outflows of Columbia River water, feeding the resurgent populations. The 2009 run was so large that food banks were able to freeze 40 tonnes (39 long tons; 44 short tons) for later use.[10]

.

Footnotes

References

Technical reports

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Apparently does not comprise genetically distinct, temporally segregated runs within a single river drainage, such as those that characterize the chinook salmon and steelhead trout; however, each coastal stream probably has a distinctive strain adapted to local conditions (Moyle et al. 1989). NMFS (1995) determined that there are six major stock groupings in the region extending from southern British Columbia to southern California.

Moyle et al. (1989) divided coho populations in California into two groups: "big river coho salmon" and "short-run coho salmon" (see GMIGRCOM).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!