Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Chum salmon (Oncorhynchus keta), also known as dog salmon, calico salmon or keta salmon, is one of the seven species of Pacific (“true”) salmon (genus Oncorhynchus). Of all the Pacific salmon, O. keta has the largest native range, inhabiting the Northern Pacific Ocean, Bering Sea, and further into the Arctic Ocean than its congenitors. As anadromous (migrating between fresh and marine waters) fish, chum salmon spawn in fresh waterways, usually in the lowest parts of streams within 100 km from shore, in rivers from Korea across Russia and Alaska and as historically as far south as central California, although populations no longer spawn south of Northern Oregon. Like pink salmon (O. gorbuscha), chum hatchings migrate directly into estuaries and ocean waters without feeding and these two species occasionally interbreed; this strategy differs from most other Pacific salmon species which can linger for months in fresh water before heading to sea. Chum spend 3-5 years in ocean waters before returning in summer to early winter, depending on their natal spawning ground. Once back in fresh waters males develop large fangs and very bright red coloration. Adults then die upon spawning (i.e. they are semelparous, spawn only once). Chum reach up 20 kg (although average size is 3-7 kg), and are the second largest Pacific salmon after king salmon (O. tshawytscha). Until recently chum salmon was the least popular of Alaskan salmon fisheries, as it traditionally fetched a lower price than other salmon. Hatchery releases now make Alaskan runs very productive and O. keta one of the most valuable fisheries species. As managed under the Pacific Salmon Treaty, all Alaskan chum populations healthy and not overfished. However, of the four “evolutionarily significant units” – which compose Chum genetic diversity in Washington, Oregon and California, two are now protected under the Endangered Species Act under threatened status, and their habitats designated as critical. Initiatives to restore these populations (the Hood Canal Summer Run population and the Lower Columbia River population) are in effect. (NOAA/National Marine Fisheries Service Fishwatch; Pacific Salmon Commission; US Fish and Wildlife Service, Fairbanks fish and wildlife field office; Washington Department of Fish and Wildlife; Wikipedia 2012)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits ocean and coastal streams. Migrating fry form schools in estuaries, remain close to shore for a few months and finally disperse to enter the sea (Ref. 1998). Epipelagic (Ref. 58426). Juveniles and adults feed mainly on copepods, tunicates and euphausiids but also on pteropods, squid and small fishes (Ref. 1998). Adults cease feeding in freshwater (Ref. 1998). Males and females die after spawning. The catch is mostly canned but also sold fresh, dried-salted, smoked, and frozen. Eaten steamed, fried, broiled, boiled, microwaved, and baked (Ref. 9988). Utilized for caviar. The Alaska Salmon fishery of this species has been certified by the Marine Stewardship Council (http://www.msc.org/) as well-managed and sustainable (http://www.msc.org/html/content_485.htm).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Black Sea, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, European waters (ERMS scope), FAO fishing area 67, North East Pacific, North Pacific, North West Territories
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Korea , Japan, Okhotsk and Bering Sea (Ref. 1998), Arctic Alaska south to San Diego, California, USA. Asia: Iran (Ref. 39702).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species has the widest natural range of all the Pacific salmon species. In Asia, the range extends from Korea north to the Arctic Ocean and west along the coast of northern Asia to the Lena River/Laptev Sea. In North America, chum salmon occurred historically from the Sacramento River drainage, California (rarely the San Lorenzo River, southern California), to northwestern Alaska, and east along the arctic coast to the Anderson and Mackenzie rivers, Northwest Territories (Salo 1991). The species is now rare or locally extirpated from southern Oregon southward. Immatures are widely distributed over the North Pacific Ocean. See Frissell (1993) for a map indicating present and former distribution in the Pacific Northwest and California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North Pacific Rim from Korea and the Japanese Island of Honshu east to Monterey Bay California; Arctic Ocean from the Laptev Sea in Russia to Mackenzie R. in Canada

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific and Arctic, introduced elsewhere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 14; Analspines: 0; Analsoft rays: 13 - 17; Vertebrae: 59 - 71
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

100.0 cm FL (male/unsexed; (Ref. 559)); max. published weight: 15.9 kg (Ref. 40637); max. reported age: 7 years (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished by the lack of distinct black spots on the back and tail and by the presence of 18 to 28 short, stout, smooth gill rakers on the first arch (Ref. 27547). Pelvic fins with axillary process; caudal truncate to slightly emarginate (Ref. 27547). Large individuals are steel-blue dorsally, with speckles of black; silver on the sides; silvery to white ventrally. Males have tinges of black on the tips of its caudal, anal and pectoral fins. Spawning males are dark olive to black dorsally; grey-red with green vertical bars on the sides; dark grey ventrally; anal and pelvic fins with white tips. Spawning females resemble spawning males but less distinctly marked.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Benthopelagic Habitat

This taxon is one of a number of benthopelagic species in the Amur River system. Benthopelagic river fish are found near the bottom of the water column, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

Other large benthopelagic river fish of the Amur Basin is the 200 cm yellowcheek (Elopichthys bambusa) and the 122 cm Mongolian redfin (Chanodichthys mongolicus)

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Environment

benthopelagic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 250 m (Ref. 50550)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 144.5

Graphical representation

Depth range (m): 0 - 144.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Chum salmon spend most of their lives (2-7 years, usually 3-5 years) in the ocean. Adults return to spawn in streams where they hatched, sometimes moving up to 2,000 km upstream in rivers lacking major barriers in Alaska and Canada but usually spawning not far from salt water (usually within 100 km). Spawning occurs in gravel riffles in rivers and streams of various sizes. The female digs a redd, or nest, by displacing gravel and making depressions in an area of about 2.25 sq meters (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 250m.
Recorded at 250 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Anadromous. Adults return to spawn in areas where they were hatched. Individuals may move up to 2,000 km upstream to spawn in rivers lacking major barriers (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Juveniles are typically euryphagous. They feed on planktonic and benthic organisms. Food spectrum narrows during migration from the river to the sea. Diet composition is determined by river conditions and by the hydrological conditions of the coastal region of the sea, particularly the water level in the river and the tide cycle, as well as illumination at night (Ref. 9027).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In fresh water juveniles feed on Diptera larvae, diatoms, and cyclops; in salt water they feed on a variety of zoo- plankton. Adults feeds on: polychaetes, pteropods, squid, crustacean larvae, copepods, amphipods, fish (Wydoski and Whitney 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Transplanting attempts have been unsuccessful outside natural range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Enters freshwater during advanced stage of sexual development and spawning occurs almost immediately (Ref. 1998). Spawning occurs at depths of ~3 meters, current speeds of ~20cm/sec. near the head waters over sand and pebbles at 4-11° C water temperature. At spawning time the female excavates a hole of around 1 meter diameter and 50 cm depth before spawning can occur (Ref. 12218). Nest building is done by the female by lying on one side and lashing its tail to displace the sand and silt on the river bed. The pair then settles in the nest, mouths gape, and with rapid vibration of the pair, eggs and milt are released. The female then covers the nest. Males are aggressive and may spawn with different females; females likewise may spawn with other males and therefore builds different nests. Adults die after a week (Ref. 1998). A fish spawns 700-7,000 eggs in two to three egg releases. Eggs are ~300-3,500 per spawn. Egg size is ~6.7 mm, water temp. is 8-10°C at 60 days before hatching. Larva size is around 16 mm. Come springtime the juveniles go to the ocean and come back 3-4 years later to their exact birthplace. This fish reaches maturity in 2-4 years. Larvae are found around the spawning site, Juveniles are found around the coast. Juveniles migrate to the ocean at ~27-45 mm during February at water temperatures around 4° C (Ref. 12218).Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 7 years (wild) Observations: As in other members of its genus, these animals age and die shortly after spawning. It is not considered ageing but rather sudden death.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In many areas, chum salmon enter streams in distinct seasonal runs (e.g., summer and fall). In Washington, spawning usually occurs in fall, October-December. In California, spawning has been observed from early August to early February. Spawning adults generally are 2-5 years old, sometimes up to seven years old. Adults die within about a week after spawning. Depending on water temperature, eggs hatch in several months, and the alevins complete yolk absorption within the gravel environment. Fry migrate directly to the sea soon after emergence, with a peak in April-May in Washington, spending relatively little time in fresh water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Oncorhynchus keta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 99 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGATGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTCTATTTAGTATTTGGTGCCTGAGCCGGGATAGTAGGCACCGCCCTTAGTCTACTGATTCGGGCAGAACTAAGCCAGCCGGGCGCTCTTCTAGGGGAT---GACCAGATCTATAACGTGATCGTCACAGCCCATGCCTTCGTTATGATTTTCTTTATAGTTATGCCGATTATGATCGGAGGCTTTGGAAACTGATTAATTCCCCTAATGATCGGGGCCCCTGATATGGCATTCCCTCGAATAAATAACATAAGCTTCTGACTCCTTCCACCATCCTTTCTCCTCCTCCTATCTTCCTCTGGAGTTGAAGCCGGAGCTGGCACCGGGTGAACAGTCTACCCCCCTCTGGCCGGCAACCTAGCCCACGCAGGAGCCTCAGTTGATCTGACGATCTTCTCCCTTCATTTAGCCGGGATCTCCTCAATTTTAGGAGCCATTAATTTTATTACTACCATTATTAACATAAAACCCCCGGCTATCTCTCAGTACCAAACCCCACTTTTTGTTTGAGCTGTGCTAGTTACTGCTGTCCTTCTACTACTCTCCCTCCCCGTTCTGGCAGCAGGCATTACTATGTTACTCACGGACCGAAATCTAAACACCACTTTCTTTGACCCGGCAGGCGGGGGAGATCCAATTTTATACCAGCACCTCTTTTGATTCTTCGGCCACCCAGAAGTCTATATTCTTATCCTCCCAGGCTTTGGTATAATTTCACATATCGTTGCATACTACTCCGGTAAAAAAGAACCATTTGGGTACATGGGAATAGTCTGAGCTATGATAGCCATCGGATTGTTAGGATTTATCGTCTGAGCCCACCATATGTTCACTGTCGGAATAGACGTTGACACTCGTGCCTACTTTACATCTGCCACCATGATTATCGCTATCCCCACAGGAGTAAAAGTATTTAGCTGACTAGCTACACTACACGGAGGC---TCA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Oncorhynchus keta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 102
Specimens with Barcodes: 110
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: Columbia R.

Status: Threatened
Date Listed: 08/02/1999
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: summer-run Hood Canal


Population detail:

Population location: U.S.A. (WA) all naturally spawned summer-run populations in Hood Canal and its tributaries and Olympic Penninsula rivers between Hood Canal and Dungeness Bay
Listing status: T

Population location: U.S.A. (OR, WA) all naturally spawned populations in the Columbia R. and its tributaries
Listing status: T

For most current information and documents related to the conservation status and management of Oncorhynchus keta, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In jeopardy in Oregon and the Columbia River basin, evidently due to degraded water quality, incidental overharvest, and competition from hatchery fishes in streams (Nehlsen et al. 1991). Nearly extinct in southern coastal Oregon due to overfishing and habitat damage. In the Columbia River basin, reduced primarily by habitat degradation from forest and agricultural practices, urbanization, pollution, and overharvest in mainstem fisheries directed at coho and fall chinook (Nehlsen et al. 1991). In the Washington coast/Puget Sound area, populations in the Duwamish-Green and Elwha rivers generally are very small or extirpated due to habitat loss and degradation (Nehlsen et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Allendorf et al. (1997) proposed criteria for prioritizing Pacific salmon stocks for conservation; data limitations introduce subjectivity into the process, so expert judgment and peer review should be incorporated into the process.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: See Nehlsen et al. (1991) for general protection and management recommendations for anadromous salmonids. See Thomas et al. (1993) for information on habitat management for this and other at-risk fish species in the Pacific Northwest. Waples and Teel (1990) emphasized the importance of monitoring the genetic consequences of the large-scale artificial propagation programs involving Pacific salmon (see also Waples 1990). Meffe (1992) gave reasons why the hatchery approach to recovery ultimately will fail, and he emphasized that overharvest and habitat destruction need to be addressed in a major landscape-level effort.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: public aquariums; price category: medium; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: An important commercial fish in Alaska and Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chum salmon

Chum salmon, raw
Nutritional value per 100 g (3.5 oz)
Energy502 kJ (120 kcal)
Carbohydrates0 g
- Dietary fiber0 g
Fat3.77 g
- saturated0.84 g
- monounsaturated1.541 g
- polyunsaturated0.898 g
Protein20.14 g
- Tryptophan0.226 g
- Threonine0.883 g
- Isoleucine0.928 g
- Leucine1.637 g
- Lysine1.849 g
- Methionine0.596 g
- Cystine0.216 g
- Phenylalanine0.786 g
- Tyrosine0.68 g
- Valine1.037 g
- Arginine1.205 g
- Histidine0.593 g
- Alanine1.218 g
- Aspartic acid2.062 g
- Glutamic acid3.006 g
- Glycine0.967 g
- Proline0.712 g
- Serine0.822 g
Water75.38 g
Alcohol0 g
Vitamin A equiv.30 μg (4%)
Thiamine (vit. B1)0.08 mg (7%)
Riboflavin (vit. B2)0.18 mg (15%)
Niacin (vit. B3)7 mg (47%)
Pantothenic acid (B5)0.75 mg (15%)
Vitamin B60.4 mg (31%)
Folate (vit. B9)4 μg (1%)
Vitamin B123 μg (125%)
Vitamin C0 mg (0%)
Vitamin E1.09 mg (7%)
Calcium11 mg (1%)
Iron0.55 mg (4%)
Magnesium22 mg (6%)
Manganese0.015 mg (1%)
Phosphorus283 mg (40%)
Potassium429 mg (9%)
Sodium50 mg (3%)
Zinc0.47 mg (5%)
Percentages are relative to
US recommendations for adults.
Source: USDA Nutrient Database

The chum salmon, Oncorhynchus keta, is a species of anadromous fish in the salmon family. It is a Pacific salmon, and may also be known as dog salmon or Keta salmon, and is often marketed under the name Silverbrite salmon. The name Chum salmon comes from the Chinook Jargon term tzum, meaning "spotted" or "marked", while "Keta" comes from the Evenki language of Eastern Siberia via Russian.

Contents

Appearance

Chum have an ocean coloration of silvery blue green. When adults are near spawning, they have purple blotchy streaks near the caudal fin. Spawning males typically grow an elongated snout or kype and have enlarged teeth. Some researchers speculate these characteristics are used to compete for mates.

Spawning

Chum Salmon of a breeding season.
Artificially-incubated chum salmon

Most Chum salmon spawn in small streams and intertidal zones. Some Chum travel more than 3,200 km (2,000 mi) up the Yukon River. Chum fry migrate out to sea from March through July, almost immediately after becoming free swimmers. They spend one to three years traveling very long distances in the ocean. These are the last salmon to spawn (November to January). They die about two weeks after they return to the freshwater to spawn. They utilize the lower tributaries of the watershed, tend to build nests called redds, really little more than protected depressions in the gravel, in shallow edges of the watercourse and at the tail end of deep pools. The female lays eggs in the redd, the male sprays sperm on the eggs, and the female covers the eggs with gravel. The female can lay up to 4000 eggs.

Age

Chum live for an average of 6 to 7 years, and chum in Alaska mature at the age of 5 years.

Distribution

Chum salmon have the largest natural range of any Pacific salmon, and undergo the longest migrations within the genus Oncorhynchus, far up the Yukon River and deep into the Amur River basin in Asia. In lesser numbers they migrate thousands of kilometres up the Mackenzie River.[1] Chum are found around the north Pacific, in the waters of Korea, Japan, and the Okhotsk and Bering seas (Kamchatka, Chukotka, Kuril Islands, Sakhalin, Khabarovsk Krai, Primorsky Krai), British Columbia in Canada, and from Alaska to California in the United States. In Arctic Ocean they are found in limited numbers from the Laptev Sea to the Beaufort Sea.[1]

Sizes

Adult chum usually weigh from 4.4 to 10.0 kg, (9.7 lbs to 22.0 lbs) with an average length of 60 cm (24 inches). The record for chum is 19 kg (42 lbs) and 112 cm (44 inches) and was caught at Edie Pass in British Columbia.

Diet

Juvenile chum eat zooplankton and insects. Recent studies show that they also eat comb jellies. As adults, they eat smaller fish.

Commercial use and value

The chum salmon is the least commercially valuable salmon. Despite being extremely plentiful in Alaska, commercial fishers often choose not to fish for them because of their low market value. Recent market developments have increased the demand for Chum salmon. Markets developed for chum from 1984 to 1994 in Japan and northern Europe which increased demand.[citation needed] They are a traditional source of dried salmon.

Conservation

There are few healthy groups of chum remaining in North America outside of Alaska.[citation needed] This is partially because of dams, which block the free flow of the water and the migration of the fish.

Two populations of Chum have been listed under the U.S. Endangered Species Act, as threatened species. These are the Hood Canal Summer Run population and the Lower Columbia River Population.

Susceptibility to diseases

Chum are thought to be fairly resistant to whirling disease, but it is unclear.

See also

Notes

  1. ^ a b Augerot, Xanthippe; Foley, Dana Nadel (2005). Atlas of Pacific salmon: the first map-based status assessment of salmon in the North Pacific. University of California Press. pp. 68–71. ISBN 978-0-520-24504-4. 

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Within a region, early run (summer) and late run (fall) chum salmon sometimes are recognized as different stocks (see Salo 1991).

Phylogenetic analysis based on mtDNA data indicates a sister relationship between pink salmon and chum salmon (Domanico and Phillips 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!