Overview

Brief Summary

Elephantfish or cockfish (Callorhinchus callorynchus)

The elephantfish occurs in rocky, sandy and muddy substrates on coasts and continental shelves from Southern Brazil to Southern Patagonia in the southwest Atlantic and from Peru and Chile in the southeast Pacific. It has also been reported from the Argentine section of the Beagle Channel, Tierra del Fuego and off the coast of Uruguay (1). The depth range is generally from nearshore to about 170 m, but there are reported captures from 600 m. This may indicate that the fish occupies and/or migrates to deeper waters than currently reported or may occupy different depth ranges in different parts of its range.

it has very large pectoral fins, one dorsal spine. A female grows to 102cm (2) and a male to 85 cm.

There may be seasonal migrations to shallower waters in the spring and autumn for spawning with a return to deeper waters during the winter.

The diet consists mainly of shelled invertebrates, particularly bivalve molluscs, gastropods and polychaetes. Differences in the diet of males and females and between juveniles and adults are attributed to prey availability and morphology and behaviour of predators (e.g., tooth plates of juveniles are not as large or strong as those of adults).

Mating and spawning occurs in spring and early summer with a primary spawning season from July- November. Spawning migrations into shallow waters lead to eggs at depths of 20 to 40 m, but also as deep as 104 m (2). It probably has an early onset of sexual maturity and relatively high fecundity. Females mature at 49 cm SL and males at 40 (2).

The Red List Category is "Least Concern". The fish is widespread and is captured year-round as part of commercial bottom trawl fisheries and is also captured on lines and as part of a small recreational fishery exists. It seems to be relatively abundant throughout its range. Landings from Argentina seem to fluctuate. They increased from 1992 to a peak in 1999, followed by an abrupt fall in the 2000-2002 and a rise from 2002-2004 (3). Declining landings in Chile from 1992-2004 may be due to shifting fishing effort between Hake and C. callorhynchus. Callorhinchus species are relatively productive and C. callorhynchus is not considered to be at immediate threat. As this species is fished throughout its range, the situation should be monitored closely, as overfishing may potentially threaten this species. Studies of C. callorhynchus off the coast of Argentina indicate there may be separate populations, which seem to be related to food abundance and availability. There may be aggregations by sex and size.

  • 1. López, H.L., N.A. San Román and E.E. Di Giácomo 2000 On the South Atlantic distribution of Callorhinchus callorhynchus (Holocephali: Callorhynchidae). J. Appl. Ichthyol. 16(1):39. (Ref. 34015)   http://www.fishbase.org/references/FBRefSummary.php?id=34015&speccode=8399
  • 2. Di Giacomo, E. E. and M. R. Perier. 1994. Reproductive Biology of cockfish, Callorhinchus callorhynchus (Holocephali: Callorhynchidae), in Patagonian waters (Argentina). Fishery Bulletin 92: 531-539.
  • 34. Di Giacomo, E. E., Perier, M. R., Pascual, M. S. and E. A. Zampatti. 2005. The sea and its resources: San Matías Gulf. In: The Patagonian plateau falling into the sea: the coast of Río Negro. 1st Edition. Massera, F., Lew, J and Serra Peirano, G (Eds.). Viedma, Government of Río Negro, 409-439.
  • Other references
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205) http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
  • Callorhinchus callorynchus at FishBase1758
  • Cervigón, F. and W. Fischer 1979 INFOPESCA. Catálogo de especies marinas de interes economico actual o potencial para América Latina. Parte 1. Atlántico centro y suroccidental. FAO/UNDP, SIC/79/1. 372 p. FAO, Rome. (Ref. 6077). http://www.fishbase.org/references/FBRefSummary.php?id=6077&speccode=19
  • Dagit, D.D., Chiaramonte,G.E., Romero, M., Di Giácomo, E. & Acuña, E. 2007. Callorhinchus callorynchus. 2008 IUCN Red List of Threatened Species.
  • Menni, R.C., R.A. Ringuelet and R.H. Aramburu 1984 Peces marinos de la Argentina y Uruguay. Editorial Hemisferio Sur S.A. Buenos, Aires, Argentina. 359 p. (Ref. 2806)   http://www.fishbase.org/references/FBRefSummary.php?id=2806&speccode=12925
  • •Nakamura, I., T. Inada, M. Takeda and H. Hatanaka 1986 Important fishes trawled off Patagonia. Japan Marine Fishery Resource Research Center, Tokyo. 369 p. (Ref. 27363)   http://www.fishbase.org/references/FBRefSummary.php?id=27363&speccode=7119
Creative Commons Attribution 3.0 (CC BY 3.0)

© Olingo

Supplier: Olingo

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Occurs in sandy and muddy substrates. Apparently associated with Stromateus brasiliensis and Discopyge tschudii (Ref. 34015). Oviparous (Ref. 50449). Max length (Itamar Alves Martins, pers. comm., 2002).
  • Menni, R.C., R.A. Ringuelet and R.H. Aramburu 1984 Peces marinos de la Argentina y Uruguay. Editorial Hemisferio Sur S.A. Buenos, Aires, Argentina. 359 p. (Ref. 2806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Ranges from Southern Brazil to Southern Patagonia in the southwest Atlantic and from Peru and Chile in the southeast Pacific. It has also been reported from the Argentine section of the Beagle Channel, Tierra del Fuego (López et. al. 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeastern Pacific and southwestern Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southeast Pacific and Southwest Atlantic.
  • Nakamura, I., T. Inada, M. Takeda and H. Hatanaka 1986 Important fishes trawled off Patagonia. Japan Marine Fishery Resource Research Center, Tokyo. 369 p. (Ref. 27363)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1
  • Nakamura, I., T. Inada, M. Takeda and H. Hatanaka 1986 Important fishes trawled off Patagonia. Japan Marine Fishery Resource Research Center, Tokyo. 369 p. (Ref. 27363)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

89.2 cm SL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pectorals very large (Ref. 27363).
  • Nakamura, I., T. Inada, M. Takeda and H. Hatanaka 1986 Important fishes trawled off Patagonia. Japan Marine Fishery Resource Research Center, Tokyo. 369 p. (Ref. 27363)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Depth range is generally from nearshore to about 170 m, however there are reported captures of this species from 481 m off Chile. This may indicate that the species occupies and/or migrates to deeper waters than currently reported, or may occupy different depth ranges in different parts of its range. A coastal and continental shelf dweller that likely occupies a variety of rocky, sandy and/or muddy bottoms throughout its range.

Maximum recorded size for females is 102 cm total length (TL) and 85 cm TL for males. Like the related species C. millii and C. capensis, C. callorhynchus probably has an early onset of sexual maturity and relatively high fecundity. C. callorhynchus is oviparous with spawning and reproductive behaviors similar to those described for C. milii and C. capensis. Mating and spawning occurs in spring and early summer with a primary spawning season from July to November. In the Gulf of San Mathías, Argentina, where most work on this species has been conducted, spawning migrations into shallow waters have been observed with eggs collected at depths of 20 to 40 m, but also as deep as 104 m (Di Giácomo and Perier 1994).

The diet (Di Giácomo et al. 1994) consists primarily of shelled invertebrate prey, particularly bivalve molluscs, gastropods and polychaetes. Differences in the diet of males and females and between juveniles and adults are attributed to prey availability and morphology and behavior of predators (e.g., tooth plates of juveniles are not as large or strong as those of adults).

The following morphometric details are given as standard length (SL) measurements, which refers to the distance from the tip of the snout to the origin of the upper caudal lobe. Females mature at 49 cm SL and males at 40 cm SL (Di Giácomo and Perier 1994). The maximum recorded size for C. callorhynchus is 102 cm total length (TL) (Di Giácomo and Perier 1994). Size at birth is 13 cm TL and gestation time is probably in the region of 6 to 12 months.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 116m.
From 10 to 116 meters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 10 - 116 m (Ref. 34015)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3119 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1904 samples.

Environmental ranges
  Depth range (m): 14 - 600
  Temperature range (°C): 3.179 - 17.125
  Nitrate (umol/L): 4.280 - 27.049
  Salinity (PPS): 33.179 - 35.126
  Oxygen (ml/l): 3.873 - 6.739
  Phosphate (umol/l): 0.830 - 1.909
  Silicate (umol/l): 2.451 - 23.105

Graphical representation

Depth range (m): 14 - 600

Temperature range (°C): 3.179 - 17.125

Nitrate (umol/L): 4.280 - 27.049

Salinity (PPS): 33.179 - 35.126

Oxygen (ml/l): 3.873 - 6.739

Phosphate (umol/l): 0.830 - 1.909

Silicate (umol/l): 2.451 - 23.105
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous (Ref. 50449).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Callorhinchus callorynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTTTTTGGTGCCTGGGCAGGAATAGTTGGTACTGCCCTTAGTCTATTAATTCGAGCTGAACTAAGCCAGCCTGGAGCATTAATAGGCGATGATCAAATCTATAATGTTATTGTTACTGCACATGCCTTTGTAATAATTTTCTTTATAGTTATACCCATTATAATCGGAGGTTTTGGAAACTGATTGATCCCTTTAATAATCGGTGCACCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGATTATTACCTCCCTCCTTTCTTCTTCTCTTAGCTTCTGCAGGAGTTGAAGCTGGAGCAGGAACAGGTTGAACTGTCTATCCACCACTAGCTGGCAACCTTGCACATGCCGGAGCATCCGTAGATTTAACCATCTTCTCCTTACATTTAGCAGGTATCTCATCTATTCTAGCTTCTATTAATTTTATCACAACAATTATTAACATAAAACCCCCATCTATAACGCAATATCAAACACCTTTATTTGTATGATCAATCCTTATTACTACAATTCTTCTCCTACTTTCCCTACCTGTCCTAGCTGCAGGTATCACCATACTACTTACTGATCGTAATCTCAATACAACATTCTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Callorhinchus callorynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2007

Assessor/s
Dagit, D.D., Chiaramonte,G.E., Romero, M., Di Giácomo, E. & Acuña, E.

Reviewer/s
Kyne, P.M., Fowler,S.L., Compagno, L.J.V., Cavanagh, R.D. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
Callorhinchus callorhynchus is widespread around southern South America off Peru, Chile, Argentina, Uruguay and southern Brazil. It is captured year-round as part of commercial bottom trawl fisheries in Argentina, Chile and Peru, mostly at depths of 90 to 130 m. This species is also captured on lines and a small recreational fishery exists. C. callorhynchus appears to be relatively abundant throughout its range. Data on fishery trends from Argentina indicates that landings of this species appear to be fluctuating: landings increased from 1992 to a peak in 1999 followed by an abrupt fall in the 2000 to 2002 period, before rising again from 2002 to 2004. This ?boom and bust cycle' , is similar to that observed in other species of Callorhinchus (such as C. milii) that have been sustainably fished, although it should be noted that this was under strict management. Although landings in Chile appeared to decline from 1992 to 2004, it is thought that this is the result of shifting fishing effort between Hake and C. callorhynchus. In Peru, C. callorhynchus is also caught by beach seine in a multi-species fishery. This species is only of minor importance to fisheries in Peru and landings are unsteady but a slight decline in its landings from the beach seine fishery has been observed. While additional fishery data from Brazil and Uruguay may well present regional differences in relative abundance and/or declines related to local fishing trends; at present no such data are available. Given that this species appears to be exhibiting the same ?boom and bust cycle' observed in C. milii in Australia and New Zealand (which has been sustainably fished since the 1960s) in Argentina, that the apparent decline in Chilean landings is attributed to a shift in effort, and that Callorhinchus species are relatively productive, it is not considered to be at immediate threat and it is currently assessed as Least Concern. However, given that this species is fished throughout its range it is important that the situation is monitored closely and this assessment may need to be re-visited in the near term.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Very little is known with regard to population size and structure of C. callorhynchus throughout its range. Studies of C. callorhynchus off the coast of Argentina indicate that there may be separate populations which appear to be related to food abundance and availability. Aggregations by sex and size have also been observed. Data are not available for regions outside of the Gulf of San Matías.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
C. callorhynchus is exploited locally throughout its range primarily as a component of bottom trawl fisheries, typically fished at depths of 90 to 130 m. Although captured year-round, there does appear to be seasonal migrations to shallower waters in the spring and autumn for spawning with a return to deeper waters during the winter. May be targeted more specifically in some regions. Also caught recreationally using lines. In Argentina this species is primarily caught as bycatch in the hake (Merluccius hubbsi) fishery.

Overfishing may potentially threaten this species based on recent declines in numbers landed in Argentina (landings increased from 479 mt in 1992 to a peak in 1999 of 1,979 mt followed by an abrupt fall in the 2000-2002 periods, followed by another increase to 1,712 mt in 2003 followed by a slight decline to 1,554 mt in 2004) (Di Giácomo and Perier 2005). This ?boom and bust' cycle has been observed in other Callorhinchus species that have been sustainably fished (D. Didier pers. obs.) however it should be noted that this was under strict management thus caution must be applied in any such comparisons. Additional data, particularly from other parts of the range, are needed to verify if this is a singular localized event or indicative of a trend in declining numbers of this species throughout its range.

In Chile, total landings increased from ~1,000 t to between ~3,000 t and ~4,500 t between 1990 and 1992, followed by a sharp decline to ~1,000 t again in 1995. However, it is thought that this is the result of a shift in effort to targeting Hake. Landings of C. callorhynchus have fluctuated ~1,500 t to ~500 t since 1995.

In Peru C. callorhynchus is also caught by beach seine in a multi-species fishery. This species is of minor importance to fisheries in Peru and data from landings were not recorded prior to 1996. An average catch of 7.81 mt per year was taken off Peru between 1996 and 2003, ranging from 11.87 mt in 1998 to 4.54 mt in 2000. The landings are unsteady but a slight decline is observed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Very little information is currently available with regard to specific regulations and conservation measures although as part of a bycatch fishery C. callorhynchus may not be subject to rigorous regulations. Any regulations and conservation measures will likely vary by country and region.

Note that management (continued monitoring of CPUE and responding by altering TAC's) of another Callorhinchus species (C. milli) in New Zealand and Australia have resulted in a sustainable fishery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Callorhinchus callorynchus

The elephantfish (or cockfish) (Callorhinchus callorynchus) is a species of fish in the Callorhinchidae family found in Peru, Chile, Argentina, Uruguay, and southern Brazil. Its natural habitat is open seas.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!