Pomacanthus zonipectus — Details

Cortez Angelfish learn more about names for this taxon

Overview

Comprehensive Description

Biology

Learn more about this article

A diurnal feeder or substrate feeder. Primary food item are sponges supplemented by tunicates, algae, bryozoans, hydroids and eggs. Adults often range widely over the reef in pairs or loose aggregations while juveniles are territorial and solitary. Oviparous (Ref. 240), monogamous (Ref. 52884). Breeding occurs from midsummer to early fall and juveniles are most abundant from August through November.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Description

Learn more about this article

Common names: angelfish (English), ángel (Espanol), isabelita (Espanol)
 
Pomacanthus zonipectus (Gill, 1862)


Cortez angelfish


Deep compressed body; a small mouth with brush-like teeth; preopercle with large spine at its angle, with vertical margin smooth; bone between preopercle and operculum without spines; bone under eye without large, rear-pointing spines; a single, un- notched dorsal fin, XI, 24-25; anal rays III, 20-22; dorsal and anal fins usually end in filaments; tail straight; lateral line complete; scales of variable sizes, very rough, with distinct ridges on the exposed part, scales extend out onto the median fins.


Grey, darker at front; rear of body and adjacent dorsal and anal fins charcoal or blackish;  a broad yellow bar just behind margin of cheek, a second narrower yellow bar bordered with black just behind pectoral fin base; tail fin pale yellowish; juvenile black with six curved yellow bars on head, body, and tail with narrow blue bars between them.



Size: to 50 cm.

Habitat: usually seen solitarily or in pairs on rocky reefs. Juveniles "clean" parasites from the surface of other fishes.

Depth: 1-50 m.

Southern Baja and Gulf of California to Peru, including all the oceanic islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Distribution

Learn more about this article

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Eastern Pacific: Gulf of California (Puerto Peñasco) and north of Bahía Magdalena (Bahía San Juanico), Mexico to Peru.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Range Description

Learn more about this article

This species is distributed in the eastern Pacific Ocean. It ranges from the northern Gulf of California (from Puerto Peñasco, Mexico) in the north, to Peru in the south. This species may be vagrant in southern California (USA), the Galapagos Islands (Ecuador), Cocos Island (Costa Rica) and Malpelo Island (Colombia); it has not been recorded from Clipperton Island (France). It is usually found at depths of 6-12 m, but can occur up to 50 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

National Distribution

Learn more about this article

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Depth

Learn more about this article

Depth Range (m): 1 (S) - 50 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Zoogeography

Learn more about this article

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, Tropical Eastern Pacific (TEP) endemic

Regional Endemism: All species, TEP endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Physical Description

Morphology

Size

Learn more about this article

Length max (cm): 50.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Size

Learn more about this article

Maximum size: 304 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Max. size

Learn more about this article

46.0 cm TL (male/unsexed; (Ref. 9333))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Type Information

Learn more about this article

Holotype for Pomacanthodes zonipectus Gill
Catalog Number: USNM 5922
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: San Salvador, San Salvador Department, El Salvador, Pacific
  • Holotype: Gill, T. N. 1862. Proceedings of the Academy of Natural Sciences of Philadelphia. 14 (3-4): 244.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Ecology

Habitat

Learn more about this article

Depth: 6 - 12m.
From 6 to 12 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Environment

Learn more about this article

reef-associated; non-migratory; marine; depth range 6 - 12 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Habitat and Ecology

Learn more about this article

Habitat and Ecology
It is typically associated with rocky reefs and adjacent sandy areas (Allen 1980, Dominici-Arosemena and Wolff 2006). The juveniles can be found in tidal rock pools. Adults often range widely over the reef in pairs or loose aggregations whereas juveniles tend to be territorial and solitary. The diet consists largely of colonial tunicates and sponges (Allen 1980). Breeding occurs from midsummer to early fall and juveniles are most abundant from August through November.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Depth range based on 66 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.3 - 84
  Temperature range (°C): 24.488 - 26.532
  Nitrate (umol/L): 0.290 - 7.461
  Salinity (PPS): 33.826 - 35.023
  Oxygen (ml/l): 4.292 - 4.879
  Phosphate (umol/l): 0.543 - 0.858
  Silicate (umol/l): 4.062 - 6.806

Graphical representation

Depth range (m): 0.3 - 84

Temperature range (°C): 24.488 - 26.532

Nitrate (umol/L): 0.290 - 7.461

Salinity (PPS): 33.826 - 35.023

Oxygen (ml/l): 4.292 - 4.879

Phosphate (umol/l): 0.543 - 0.858

Silicate (umol/l): 4.062 - 6.806
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

 

Source: Ocean Biogeographic Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Migration

Learn more about this article

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Trophic Strategy

Learn more about this article

A diurnal feeder or substrate feeder. Primary food item are sponges supplemented by tunicates, algae, bryozoans, hydroids and eggs. Adults often range widely over the reef in pairs or loose aggregations while juveniles are territorial and solitary. Omnivore (Ref. 57615).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Feeding

Learn more about this article

Feeding Group: Ectoparasite cleaner, Omnivore

Diet: benthic microalgae, sea-stars/cucumbers/urchins, sponges/seasquirts/bryozoa, soft corals/hydroids
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Life History and Behavior

Reproduction

Learn more about this article

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pomacanthus zonipectus

Learn more about this article

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTATTTGGTGCTTGAGCCGGGATGGTAGGCACTGCTTTGAGCCTACTAATTCGAGCCGAGCTGAATCAACCGGGCAGCCTTCTCGGAGACGACCAGATTTACAATGTTATCGTTACAGCACACGCATTTGTAATAATTTTTTTTATGGTAATGCCCGCCATAATCGGAGGCTTTGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCATTTCCTCGAATAAACAATATAAGCTTTTGACTCCTGCCCCCTTCTCTTCTTCTTCTCCTCGCTTCTGCCGGAGTAGAAGCCGGAGCTGGAACTGGATGAACAGTTTACCCACCCCTAGCTGGCAATCTAGCCCACGCAGGAGCATCCGTAGACTTAACCATCTTCTCCCTCCACCTGGCTGGGATCTCTTCAATTCTTGGGGCTATTAACTTTATCACAACCATCATTAACATAAAACCTCCTGCTATTTCACAGTATCAAACTCCACTATTTGTGTGAGCCGTTCTAATTACTGCAGTGCTACTTCTTCTTTCTCTTCCCGTCCTTGCTGCCGGCATCACAATACTTCTCACAGACCGAAATCTCAACACTACTTTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTTTACCAACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Statistics of barcoding coverage: Pomacanthus zonipectus

Learn more about this article

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Conservation

Conservation Status

IUCN Red List Assessment

Learn more about this article


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R., Allen, G., Myers, R., Zapata, F., Barraza, E., Robertson, R., Rocha, L.A. & Craig, M.T.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and is common in many parts of its range. There are no major threats for this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

NatureServe Conservation Status

Learn more about this article

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

National NatureServe Conservation Status

Learn more about this article

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Population

Learn more about this article

Population
This species is common and generally stable throughout its range on the continental coast, but is considered more uncommon at the extremities of its range. It has not been observed recently in Galapagos Islands (Ecuador) nor Malpelo Island (Colombia).

This fish was studied in Gulf of Papagayo, Costa Rica (Dominici-Arosemena et al. 2005) with a density of 0.01±0.01 ind./m2. This low density may be due to great exploitation of this fish for aquaria activity. At Gulf Dulce, Costa Rica, it had a density of 0.006±0.009 ind./m2 and a relative abundance of 0.154% (Figueroa 2001). Within a five-site study survey, at Catalinas Islands, this fish could be rarely observed in just two sites, with five overall observations (Espinoza and Salas 2005). According to Aburto-Oropeza and Balart (2001), P. zonipectus is a common species at Los Islotes, Gulf of California, with an occurrence frequency between 10-30%. In Cabo Pulmo, Mexico, this fish was considered scarce at 0.1-1% of relative abundance (Villarreal-Cavazos et al. 2000). However, it is frequently seen at Cabo Pulmo, but primarily as individuals or in pairs (Lea et al. 1989).

In Bahía de Navidad, Jalisco, México, this fish was not captured within 12 (one each month) field trips throughout a year (Rojo-Vázquez et al. 2001). A survey at Gorgona Island coral reefs, Colombia (Rubio 1986), showed that this fish seems to be abundant in coralline bottoms, frequent in sandy substrata while occasional in rocky bottoms and tide-pools. Zapata and Morales (1997), also in the same place, recorded a density of 0.009±0.040 ind./10 m2, with an observational frequency of 6.1%.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Threats

Learn more about this article

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Learn more about this article

Major Threats

There are no major threats for this species. It is collected for the aquarium trade (Fenner 1995, Dominici-Arosemena et al. 2005), but the impacts of collection are believed to be localized.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Management

Conservation Actions

Learn more about this article

Conservation Actions

There appear to be no direct conservation measures in place for this species. The distribution overlaps with several protected areas and populations of this species are believed to be present in a number of these.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Relevance to Humans and Ecosystems

Benefits

Importance

Learn more about this article

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Wikipedia

Pomacanthus zonipectus

Learn more about this article

Pomacanthus zonipectus is a marine angelfish from the Eastern Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 46 cm in length.

References

Stub iconThis Perciformes article is a stub. You can help Wikipedia by expanding it.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

comment on or rate this article

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!