Overview

Comprehensive Description

Biology

Marine species usually living on coral reefs but also recorded from pools, freshwater streams or lagoon mouths (Ref. 4343). Found on tabletop Acropora corals (Ref. 1602); a coral-commensal species (Ref. 72446). Monogamous (Ref. 52884). The male takes care of eggs deposited on a coral branch (Ref. 32163). Has the ability to change sex in both directions to favor reproductive success (Ref. 32163).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa to the Tuamoto Islands, north to the Ryukyu Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Gambier Islands, north to Ryukyu Islands, south to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 10 - 11; Analspines: 1; Analsoft rays: 8 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 50 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

5.0 cm TL (male/unsexed; (Ref. 4343))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Face red with vertical blue lines; uniformly dark brown to light brown or bright green with a longitudinal thin red stripe; red stripe at the base of dorsal fins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Marine species usually living on coral reefs but also recorded from pools, freshwater streams or lagoon mouths (Ref. 4343). Found on tabletop @Acropora@ corals (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 46888); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): 0.305 - 25
  Temperature range (°C): 25.778 - 29.336
  Nitrate (umol/L): 0.046 - 0.504
  Salinity (PPS): 32.279 - 36.148
  Oxygen (ml/l): 4.454 - 4.802
  Phosphate (umol/l): 0.092 - 0.327
  Silicate (umol/l): 0.910 - 4.467

Graphical representation

Depth range (m): 0.305 - 25

Temperature range (°C): 25.778 - 29.336

Nitrate (umol/L): 0.046 - 0.504

Salinity (PPS): 32.279 - 36.148

Oxygen (ml/l): 4.454 - 4.802

Phosphate (umol/l): 0.092 - 0.327

Silicate (umol/l): 0.910 - 4.467
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Marine species usually living on coral reefs but also recorded from pools, freshwater streams or lagoon mouths (Ref. 4343). Found on tabletop Acropora corals (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

The male takes care of eggs deposited on a coral branch (Ref. 32163). Has the ability to change sex in both directions to favor reproductive success (Ref. 32163).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Gobiodon cf. rivulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Gobiodon rivulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNCTATACTTAGTTTTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCTTAAGCCTACTCATTCGAGCCGAGCTTAGCCAACCTGGGGCCCTCCTTGGGGACGACCAGGTTTATAACGTAATCGTCACCGCCCACGCATTCGTGATGATTTTCTTTATAGTAATACCAATCATGATCGGAGGGTTTGGAAATTGATTAATTCCCTTAATGATCGGGGCCCCTGACATGGCCTTCCCCCGGATGAACAACATGAGCTTCTGACTTCTTCCCCCTTCTTTCCTCTTACTGCTGGCATCCTCAGGGGTTGAAGCAGGGGCCGGTACAGGATGAACTGTCTACCCCCCCTTGTCTGGCAATTTAGCGCATGCCGGAGCATCCGTTGATCTAACCATCTTTTCTCTACACCTTGCAGGCATTTCTTCTATCCTGGGAGCAATTAACTTCATTACTACTATTATTAACATAAAACCTCCTACCATCTCTCAATATCAGACGCCCCTATTCGTCTGGGCTGTGCTTATCACGGCAGTACTGCTGCTTCTCTCCCTCCCCGTTCTTGCTGCCGGGATTACGATGCTACTCACAGATCGGAACCTCAACACAACCTTCTTTGACCCCGCAGGAGGAGGGGACCCTATCCTTTACCAACACTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gobiodon rivulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!