Overview

Comprehensive Description

Biology

Found near shore (including semi-enclosed sea areas) (Ref. 11230). Undergoes a spawning migration in spring (March to June) and a feeding migration in fall (September to November) in the Inland Sea of Japan. Feeds on small fishes. Another major fishing gear that is used are set nets. This species is the most important Scomberomorus species in Japan which is cultured and released for fishery. Marketed fresh and especially tasty in winter. Eaten pan-fried, broiled and baked (Ref. 9988).
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Northwest Pacific: confined to the subtropical and temperate waters of China, the Yellow Sea and Sea of Japan north to Vladivostok, former USSR. Often confused with Scomberomorus munroi.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

In the northwest Pacific this species is confined to the subtropical and temperate waters of China, the Yellow Sea and the Sea of Japan north to Vladivostok, former USSR. This species may occur to southern China, including Hainan Island. This species may be increasing its range in the north of Japan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Subtropical and temperate waters of China, the Yellow Sea, and the Sea of Japan north to Vladivostok.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 19 - 21; Dorsal soft rays (total): 15 - 19; Analsoft rays: 16 - 20; Vertebrae: 48 - 50
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1000 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

100.0 cm FL (male/unsexed; (Ref. 168)); max. published weight: 7,100 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Interpelvic process small and bifid. Lateral line gradually curving down toward caudal peduncle. The only species in the genus with a straight intestine. Swim bladder absent. Body covered with small scales. Anterior quarter of first dorsal fin and a narrow distal margin of the rest of the dorsal fin black. Sides with seven or more rows of longitudinal spots on the sides; some spots connected together.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; oceanodromous (Ref. 51243); marine; depth range 0 - 200 m (Ref. 54883)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is pelagic, oceanodromous, and found near shore (including semi-enclosed sea areas). It undergoes a spawning migration in spring (March to June) and a feeding migration in fall (September to November) in the Inland Sea of Japan. It feeds on small fishes. Larvae exhibited almost exclusive piscivory from first feeding in tanks (Shoji and Tanaka 2001, 2004).

Length of maturity at 50% is 60 cm fork length (FL) for females and 40 cm FL for males in Japan (Inoue et al. 2007). Longevity is estimated to be six years based on a growth study using scales in Japan (Kishida et al. 1985), and maximum length is 103 cm FL. Generation length is therefore estimated to be approximately 2–3 years.

Maximum size is more than 100 cm FL, 9.4 kg. The all-tackle game fish record is a 9.35 kg fish caught at Shirasaki, Wakayama, Japan in 2007 (IGFA 2011).

There are two migrations in the Inland Sea of Japan, a spawning migration in the spring (March to June) and a feeding migration in the fall (September to November) according to Hamada and Iwai (1967).




Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 40 - 40
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found near shore (including semi-enclosed sea areas) (Ref. 11230). Undergoes a spawning migration in spring (March to June) and a feeding migration in fall (September to November) in the Inland Sea of Japan. Feeds on small fishes. Another major fishing gear that is used are set nets.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p.   http://www.fishbase.org/references/FBRefSummary.php?id=168 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scomberomorus niphonius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACAGCCCTAAGCCTGCTTATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGAGACGACCAGATTTATAACGTAATCGTTACAGCCCATGCCTTCGTCATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGTTTTGGAAACTGACTTATCCCCCTAATGATCGGGGCCCCCGACATAGCATTCCCTCGAATGAATAACATAAGCTTTTGACTTCTACCCCCTTCCTTCCTCCTACTCCTCGCCTCTTCCGGCGTTGAAGCCGGGGCTGGGACTGGTTGAACAGTCTATCCTCCCCTTGCCGGCAATCTGGCTCACGCTGGAGCATCCGTCGACTTAACTATTTTCTCTCTTCACCTGGCAGGGATTTCTTCAATCCTTGGGGCAATCAACTTCATTACGACAATCATTAATATGAAACCCCCAGCTATCTCCCAATACCAAACACCCTTATTTGTGTGGGCTGTCCTAATTACAGCTGTCCTTCTTCTATTATCACTTCCAGTTCTTGCCGCTGGTATTACAATACTTCTTACAGACCGTAACCTAAATACAACCTTCTTCGACCCGGCAGGCGGAGGAGACCCAATCCTTTATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Scomberomorus niphonius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 36
Specimens with Barcodes: 37
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Chang, S.-K., Di Natale, A., Fox, W., Juan Jorda, M., Nelson, R. & Uozumi, Y.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is found along the coasts of China, Korea, Japan and north to Vladivostok, Russia. This species is heavily fished in many parts of its range, and there have been at least one occurrence of a localized collapse in the inland Sea of Japan. Although recovery efforts are underway in the Inland Sea, no information is available on this species population in China or Korea, where an estimated 50% or more of the global catch occurs. It is listed as Data Deficient. More information on catch and effort of this species in China and Korea is needed, as this species may qualify for a threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is taken throughout its range but is the most important Scomberomorus species in Japan. FAO worldwide reported landings show a gradual increase from 1,900 tonnes in 1950 to 60,685 tonnes in 2006 (FAO 2009). It is an important fishery in South Korea, where 40,000 tonnes were recorded in 2007, and where 50% of the global catch occurs. Reported landings in China may not be accurate.

Two different stock assessments have been conducted in the East China Sea and in the Inland Sea. In the East China Sea, this species is caught by purse seiners, and catch per unit effort (CPUE) since 1994 by Japanese purse seiners is increasing. In the Inland Sea, this species was very depleted in the past as estimated biomass in 1985 was 60,000 tonnes and dropped to 2,000 tonnes in 1998. There is a slight increase to 5,000 tonnes in 2007 based on recovery program that begin in 2002 with a restocking program (Uozumi pers comm 2009). In the western part of Japan, catches are increasing as this species is likely increasing its range because it used to be rare in this region. There are no major fisheries for this species on the eastern part of Japan.

In Taiwan, reported catches of this species to FAO have declined from 15,000 tonnes in 2007 to 1,400 tonnes in 2008, but this needs to be confirmed as catches are reported from distant water long-lines which are not normally used to catch this species (Chang, pers comm 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
This is a highly commercial species caught with gillnets, purse seiners and set nets. This species is the most important Scomberomorus species in Japan, where it is cultured and released for fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is cultured and released in the Inland Sea in Japan. In Japan, there are regulations to control effort (including regulating the number of boats and catch size) as well as seasonal closures in the Inland Sea. However, more information on the harvest and population status of this species population is needed in China and Korea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; price category: very high; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Japanese Spanish mackerel

The Japanese Spanish mackerel, Scomberomorus niphonius, also known as the Japanese seerfish, is a species of true mackerel in the scombrid family (Scombridae).[1] Their maximum reported length is 100 cm, and the maximum reported weight is 7.1 kg.[2]

Fisheries

Japanese Spanish mackerel is an important species for fisheries in east Asia. South Korea is the country reporting the biggest annual catches, followed by Japan and Taiwan. These added to a relatively modest total catch of about 56,000 tonnes in 2009. However, China reports very large catches of unidentified seerfish (Scomberomorus spp., fluctuating around 400,000 tonnes in 2000–2009), without reporting catches of any single Scomberomorus species.[3] It is likely that these catches include a significant proportion of Japanese Spanish mackerel.

Capture of Japanese Spanish mackerel in tonnes from 1950 to 2009 [4]
Japanese Spanish mackerel on sale in Yuhuan, China

Notes

  1. ^ "Scomberomorus niphonius (Cuvier, 1832)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=172446. Retrieved 9 March 2012.
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). "Scomberomorus niphonius" in FishBase. March 2012 version.
  3. ^ FAO (Food and Agriculture Organization of the United Nations) (2011). Yearbook of fishery and aquaculture statistics 2009. Capture production. Rome: Food and Agriculture Organization of the United Nations. p. 230. ftp://ftp.fao.org/FI/CDrom/CD_yearbook_2009/root/capture/yearbook_capture.pdf.
  4. ^ Scomberomorus niphonius (Cuvier, 1831) FAO, Species Fact Sheet. Retrieved 2 March 2012.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!