Overview

Comprehensive Description

Biology

Found in small shoals on rough, rock, gravel, or pebble bottoms. Generally keeps far from the shore, near the bottom, mostly between 150 and 450 m in the northeastern Atlantic, and between 18 and 550 m in the northwestern Atlantic. Occurs at a temperature range of 0°-10° C (Ref. 9988). Solitary or in small groups. Feeds on crustaceans and shellfishes, benthic fishes (flatfishes and gurnard) and even on starfishes. Preyed upon by seals (Ref. 9988). Sold fresh, frozen as fillets or dried salted. Eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The tusk fish Brosme brosme has an elongate body that can reach up to 1 m in length. It has a relatively small head with a flat lower jaw and a downward sloping head. A barbel is present on the chin. It has one continuous flat dorsal fin running from in line with the pectoral fin to the tail and one continuous flat anal fin running from the middle of the body to the tail. Both are narrowly joined to the small, rounded tail fin. The pelvic fin is mildly elongate. A lateral line is present and curved in the middle. The tusk fish is variable in colour, often brownish grey above and paler underneath. The pale dorsal and anal fins have a black band near the margins and have white rims.Young specimens may have six transverse yellow bands on sides.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, North West Atlantic, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Atlantic: New Jersey to the Strait of Belle Isle and on the Grand Banks of Newfoundland. Rare at the southern tip of Greenland. Northeast Atlantic: off Iceland, in the northern North Sea, and along the coast of Scandinavia to the Murmansk Coast and at Spitzbergen.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Newfoundland to New Jersey
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southeastern Greenland and northern Newfoundland to New Jersey; also in eastern North Atlantic (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Atlantic: from New Jersey to the Strait of Belle Isle and on the Grand Banks of Newfoundland. Rare at the southern tip of Greenland. Northeast Atlantic: off Iceland, in the northern North Sea, and along the coast of Scandinavia to the Murmansk Coast and at Spitzbergen.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 93 - 103; Analsoft rays: 62 - 75; Vertebrae: 64 - 67
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 9988)); max. published weight: 30.0 kg (Ref. 9988); max. reported age: 20 years (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 120.0 cm TL (male/unsexed); max.weight: 30 kg .
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Barbel on present on chin, none on snout, its length equal to eye diameter. Color is variable; dorsally dark red-brown or green brown to yellow shading into pale color on belly. Young specimens may have six transverse yellow bands on sides. Vertical fins with dark margin rimmed with white.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 18 - 1000 m (Ref. 1371), usually 18 - 549 m (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found to depths of 20- 1000 m over rough, rocky or gravel bottoms.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5863 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5017 samples.

Environmental ranges
  Depth range (m): -9 - 25000
  Temperature range (°C): 0.485 - 13.162
  Nitrate (umol/L): 1.462 - 26.300
  Salinity (PPS): 31.182 - 35.412
  Oxygen (ml/l): 3.589 - 7.373
  Phosphate (umol/l): 0.353 - 1.829
  Silicate (umol/l): 1.629 - 17.288

Graphical representation

Depth range (m): -9 - 25000

Temperature range (°C): 0.485 - 13.162

Nitrate (umol/L): 1.462 - 26.300

Salinity (PPS): 31.182 - 35.412

Oxygen (ml/l): 3.589 - 7.373

Phosphate (umol/l): 0.353 - 1.829

Silicate (umol/l): 1.629 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The tusk fish is an offshore demersal species usually found at depths between 100 and 400 m, often on hard rocky ground.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 1000m.
From 20 to 1000 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Demersal; marine. Depth range: 20-1000 m. Found in small shoals on rough, rock, gravel, or pebble bottoms. Generally keeps far from the shore near the bottom, mostly between 150 and 450 m in the northeastern Atlantic, and between 18 and 550 m in the northwestern Atlantic. Occurs at a temperature range of 0°-10° C. Solitary or in small groups.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Sluggish. Seldom found on smooth, clean sand. Generally keeps far from shore. Forms small aggregations, but mostly solitary. Feeds on fish and invertebrates (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on crustaceans and shellfishes, benthic fishes (flatfishes and gurnard) and even on starfishes.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Brosme brosme (Cusk) preys on:
Crangon
Pandalidae
Decapoda
Gammaridae
Hyperiidae
Caprellidae
Isopoda
Cancer
Brachyura
Polychaeta
Ophiuroidea
Ostreoida
Bivalvia
Urophycis regia
Urophycis tenuis
Urophycis chuss

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Brosme brosme (Cusk) is prey of:
Gadidae
Hemitripterus americanus
Leucoraja erinacea
Leucoraja ocellata
Scophthalmus aquosus
Paralichthys dentatus
Hippoglossus hippoglossus
Squalus acanthias
Lophius americanus

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns in shallower waters between 40-400 m, usually 100 to 200 m. Most important spawning grounds are located between Scotland and Iceland, from 200 to 500 m depth. In the Gulf of Maine, spawning grounds can be found in shallower waters (>50 m). Some individuals even spawn close inshore in Cape Cod, Provincetown Harbor and the Isles of Shoals (Ref. 1371).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spawns in shallower waters between 40-400 m, usually 100 to 200 m. Most important spawning grounds are located between Scotland and Iceland, from 200 to 500 m. depth. In the Gulf of Maine, spawning grounds can be found in shallower waters. Some individuals even spawn close inshore in Cape Cod, Provincetown Harbor and the Isles of Shoals.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brosme brosme

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTTCTCATTCGAGCAGAGCTAAGTCAACCTGGCGCACTCCTTGGTGACGATCAAATTTATAATGTAATCGTTACAGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTCGGAAACTGACTAATCCCCTTAATAATCGGCGCCCCCGATATAGCCTTCCCTCGTATGAATAATATAAGCTTCTGACTTCTCCCGCCATCTTTCTTGCTCCTTCTAGCATCCTCCGGAGTAGAAGCGGGCGCCGGTACGGGGTGAACAGTCTATCCCCCTTTAGCAGGCAACCTTGCTCACGCTGGAGCCTCTGTTGATCTCACTATTTTCTCCCTTCACCTAGCAGGAATCTCATCAATTCTTGGAGCAATTAATTTTATTACTACTATTATTAACATAAAACCCCCAGCCATCTCACAGTACCAAACACCCCTATTTGTCTGAGCTGTCCTAATTACAGCCGTACTGCTTCTTCTCTCACTTCCCGTCTTAGCGGCCGGTATCACAATACTCCTGACTGACCGAAATCTTAATACTTCCTTCTTTGATCCTGCTGGAGGAGGAGACCCCATTCTATATCAGCACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Brosme brosme

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In Canada, fishing, unrestricted until 1999, is now capped but remains a source of mortality (COSEWIC, May 2003, http://www.cosewic.gc.ca/htmlDocuments/Detailed_Species_Assessment_e.htm).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cusk (fish)

Brosme for sale at the fish market in Bergen, Norway, in 2012

The cusk or tusk, Brosme brosme, is a marine cod-like fish in the ling family Lotidae. It is the only species in the genus Brosme.[1] Other common names include brismak, brosmius, torsk and moonfish.[2]

Contents

Description

It is easily distinguished at a glance from other cod-like fish as it has only one dorsal fin. Also characteristic is the nature of the dorsal, caudal, and anal fins, they are continuous at the base but separated by very deep notches so that they are obviously distinct. Moreover, the caudal fin is evenly rounded. It is variable in color, from slate to reddish brown above, and paling to gray on the lower sides and underneath. Older fish are usually plain colored, while the young often have transverse yellow bands on the sides. The maximum length is about 4 feet (120 cm) and top weight about 45 pounds (20 kg). IGFA world record stands at 37 pounds 14 oz (17,20 kg) caught by Anders Jonasson outside Söröya in northern Norway.

Distribution and habitat

Distribution of Cusk based on Icelandic studies published in 1998 and 2000

It is distributed on both sides of the North Atlantic, mostly in moderately deep water. On the North American coast it is regularly found southward to Cape Cod and occasionally off New Jersey. Its maximum range covers most of the North Atlantic, including the waters around Iceland and the Norwegian coast.[1] It is also found on the Mid-Atlantic Ridge.[3]

Tusk shows little genetic differentiation over large distances, except where populations are surrounded by deep-water areas, namely on the Mid-Atlantic Ridge and the Rockall Bank. This suggests that deep-water areas are barriers for adult movements, and that, though tusk has pelagic eggs and larvae, dispersal during early life stages is not effective over long distances either.[3]

It is normally found in water deeper than sixty feet (20 m), and practically always is taken over rough bottoms where rocks, ledges, or gravel are common. Good fishing areas are usually much more limited than is the case with cod, haddock, or pollock. It is an offshore fish and rarely is one taken in a harbor.

Habits

It spawns in the spring and summer, usually between April and early July. A medium sized female has been known to produce more than two million buoyant eggs. The young live near the surface until they are about 2 inches (5 cm) long, and then seek out rocky ocean floors in deep water.

Food

It is strictly a bottom-dwelling species, and is sluggish and a rather weak swimmer. It eats crustaceans and other soft bodied invertebrates and mollusks.

Fishing technique

US government photo

Cusk are primarily fished on the North American North Atlantic coastal shelf near the American state of Maine and the Canadian Maritimes.

In the Gulf of Maine, cusk are chiefly taken on hook and line. Line trawls account for most of the commercial catch off the New England coast, and most of them are caught during the winter and spring. The commercial catch individuals run between 1 and 2 feet long (30–60 cm), and average about 5 pounds (2 kg). It is an excellent food fish. It is marketed as fresh or frozen fillets; a part of the catch is smoked.

Global annual cusk catches in 1950-2003 from FAO statistics. The highest catch was 55,000 tonnes in 1980.

Conservation status

Fisheries and Oceans Canada (DFO) considers this species Threatened based on a 2003 Committee on the Status of Endangered Wildlife in Canada (COSEWIC) assessment. The status report identified that catches of cusk in the DFO summer bottom trawl survey had declined by roughly 90% from 1970 to the late 1990s.[4] A landings limit of 1000 mt was put in place in 1999 in the 4X North American Fisheries Organization (NAFO) area and was further restricted to 750 t and expanded to include the 4VWX5Z NAFO areas in 2003. Cusk are still commonly caught as bycatch in the longline and lobster fisheries and can be found in supermarkets in Atlantic Canada despite its Threatened status.

Cusk is a U.S. National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act(ESA).

References

  1. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2006). "Brosme brosme" in FishBase. May 2006 version.
  2. ^ Cusk Fish and seafood fact sheets. Agriculture and Agri-Food Canada
  3. ^ a b Knutsen, H.; Jorde, P. E.; Sannaes, H.; Hoelzel, R. A.; Bergstad, O. A.; Stefanni, S.; Johansen, T.; Stenseth, N. C. (2009). "Bathymetric barriers promoting genetic structure in the deepwater demersal fish tusk (Brosme brosme)". Molecular Ecology 18 (15): 3151–3162. doi:10.1111/j.1365-294X.2009.04253.x. PMID 19549108. edit
  4. ^ SARA registry report on Cusk (PDF) - Fisheries and Oceans Canada report on the state of cusk fisheries
  • E. C. Raney "Cusk." The Wise Fishermen's Encyclopedia (1951)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!