Overview

Comprehensive Description

Biology

Found in small shoals on rough, rock, gravel, or pebble bottoms. Generally keeps far from the shore, near the bottom, mostly between 150 and 450 m in the northeastern Atlantic, and between 18 and 550 m in the northwestern Atlantic. Occurs at a temperature range of 0°-10° C (Ref. 9988). Solitary or in small groups. Feeds on crustaceans and shellfishes, benthic fishes (flatfishes and gurnard) and even on starfishes. Preyed upon by seals (Ref. 9988). Sold fresh, frozen as fillets or dried salted. Eaten steamed, fried, broiled, boiled, microwaved and baked (Ref. 9988).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 The tusk fish Brosme brosme has an elongate body that can reach up to 1 m in length. It has a relatively small head with a flat lower jaw and a downward sloping head. A barbel is present on the chin. It has one continuous flat dorsal fin running from in line with the pectoral fin to the tail and one continuous flat anal fin running from the middle of the body to the tail. Both are narrowly joined to the small, rounded tail fin. The pelvic fin is mildly elongate. A lateral line is present and curved in the middle. The tusk fish is variable in colour, often brownish grey above and paler underneath. The pale dorsal and anal fins have a black band near the margins and have white rims.Young specimens may have six transverse yellow bands on sides.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Cusk have a range and distribution similar to that of Atlantic cod. They are found in the northwest Atlantic Ocean from New Jersey to the Strait of Belle Isle in Canada, along the coast of Newfoundland, and occasionally off the southern tip of Greenland. In the northeast Atlantic Ocean, they are found along the coasts of Iceland, Scandinavia, and northern Ireland and England, including the northern North Sea.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); atlantic ocean (Native )

  • Cohen, D., T. Inada, T. Iwamoto, N. Scialabba. 1990. FAO species catalogue vol. 10: Gadiform Fishes of the World. Rome, Italy: Publishing and Multimedia service, FAO. Accessed October 14, 2012 at http://www.fao.org/docrep/009/t0243e/t0243e00.htm.
  • Tyus, H. 2012. Ecology and Conservation of Fishes. Boca Raton, FL: CRC press.
  • Wootton, R. 1990. Ecology of Teleost Fishes. 29 W. 35th street, New York NY: Chapman and Hall.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Southeastern Greenland and northern Newfoundland to New Jersey; also in eastern North Atlantic (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Newfoundland to New Jersey
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northwest Atlantic: New Jersey to the Strait of Belle Isle and on the Grand Banks of Newfoundland. Rare at the southern tip of Greenland. Northeast Atlantic: off Iceland, in the northern North Sea, and along the coast of Scandinavia to the Murmansk Coast and at Spitzbergen.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northwest Atlantic: from New Jersey to the Strait of Belle Isle and on the Grand Banks of Newfoundland. Rare at the southern tip of Greenland. Northeast Atlantic: off Iceland, in the northern North Sea, and along the coast of Scandinavia to the Murmansk Coast and at Spitzbergen.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Cusk are variable in color, with their primary dorsal coloration ranging from dark grey to a rusty or greenish brown, fading through the sides to a pale white or gray ventrally. Their vertical fins have dark margins edged in white. Adults are typically more dully-colored than juveniles, who may have six transverse yellow bands. Cusk have one long dorsal fin, one anal fin, short pectoral fins, and rounded caudal fins, as well as a chin barbel. They are easily distinguished from other members of the family Gadidae by their single dorsal fin and characteristically rounded caudal fin. Most cusk grow to be less than 100 cm in length (average 50-95 cm), with an average weight of 12 kg (maximum recorded weight 30 kg). There are no polymorphic forms or documented seasonal variations, and populations on both sides of the Atlantic are remarkably similar in size and weight, differing only slightly in color.

Range mass: 30 (high) kg.

Average mass: 12 kg.

Range length: 110 (high) cm.

Average length: 60 cm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Shackell, N., K. Frank, D. Brickman. 2005. Range Contraction May Not Always Predict Core Areas: An Example from Marine Fish. Ecological Applications, 15/4: 1440-1449.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 93 - 103; Analsoft rays: 62 - 75; Vertebrae: 64 - 67
  • Whitehead, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) 1986 Fishes of the North-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vols. I-III:1473 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 9988)); max. published weight: 30.0 kg (Ref. 9988); max. reported age: 20 years (Ref. 1371)
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
  • Frimodt, C. 1995 Multilingual illustrated guide to the world's commercial coldwater fish. Fishing News Books, Osney Mead, Oxford, England. 215 p. (Ref. 9988)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 120.0 cm TL (male/unsexed); max.weight: 30 kg .
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Barbel on present on chin, none on snout, its length equal to eye diameter. Color is variable; dorsally dark red-brown or green brown to yellow shading into pale color on belly. Young specimens may have six transverse yellow bands on sides. Vertical fins with dark margin rimmed with white.
  • Whitehead, P.J.P., M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) 1986 Fishes of the North-eastern Atlantic and the Mediterranean. UNESCO, Paris. Vols. I-III:1473 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Cusk are benthic fish, inhabiting rough-bottom areas in the cooler waters of the North Atlantic. Cusk are most often located over rocky, mud, or gravel bottoms and can be found over seamounts and knolls; they are rarely ever found over flat, sandy bottoms. A deep-water fish, cusk seldomly occur in water more shallow than 20-30 meters and are most commonly found at depths of 150-450 meters in the northeast Atlantic and from 18-149 meters in the northwest Atlantic. They can be found in waters as deep as 1,000 meters and in water temperatures from 0-10°C.

Range depth: 20 to 1000 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found to depths of 20- 1000 m over rough, rocky or gravel bottoms.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; oceanodromous (Ref. 51243); marine; depth range 18 - 1000 m (Ref. 1371), usually 18 - 549 m (Ref. 1371)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5863 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5017 samples.

Environmental ranges
  Depth range (m): -9 - 25000
  Temperature range (°C): 0.485 - 13.162
  Nitrate (umol/L): 1.462 - 26.300
  Salinity (PPS): 31.182 - 35.412
  Oxygen (ml/l): 3.589 - 7.373
  Phosphate (umol/l): 0.353 - 1.829
  Silicate (umol/l): 1.629 - 17.288

Graphical representation

Depth range (m): -9 - 25000

Temperature range (°C): 0.485 - 13.162

Nitrate (umol/L): 1.462 - 26.300

Salinity (PPS): 31.182 - 35.412

Oxygen (ml/l): 3.589 - 7.373

Phosphate (umol/l): 0.353 - 1.829

Silicate (umol/l): 1.629 - 17.288
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The tusk fish is an offshore demersal species usually found at depths between 100 and 400 m, often on hard rocky ground.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 20 - 1000m.
From 20 to 1000 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Demersal; marine. Depth range: 20-1000 m. Found in small shoals on rough, rock, gravel, or pebble bottoms. Generally keeps far from the shore near the bottom, mostly between 150 and 450 m in the northeastern Atlantic, and between 18 and 550 m in the northwestern Atlantic. Occurs at a temperature range of 0°-10° C. Solitary or in small groups.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cusks are carnivorous foragers of small fishes, crabs and other crustaceans, mollusks, starfishes, and other small, soft-bodied, benthic invertebrates. Some examples of prey items include gurnard (Family Triglidae), pea crabs (Pinnotheres pisum), caridean shrimp (Crangon crangon), and margarita snails (Margarites pupillus). They are likely opportunistic scavengers as well, scavenging freshly dead organisms, if found.

Animal Foods: fish; carrion ; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Scavenger )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sluggish. Seldom found on smooth, clean sand. Generally keeps far from shore. Forms small aggregations, but mostly solitary. Feeds on fish and invertebrates (Ref. 1371).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on crustaceans and shellfishes, benthic fishes (flatfishes and gurnard) and even on starfishes.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Cusk are predators, consuming creatures that are either omnivores, detriovores, herbivores, filter feeders, or other small opportunistic carnivores. While they are not the preferred prey for any particular species, they are nonetheless occasional prey for many benthic predators and pelagic diving predators. They may be hosts to a variety of parasites, including roundworms, flatworms, and copepods.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The primary predators of adult cusk are humans; these fish share nearly identical habitats with Atlantic cod, a staple of the world's fishing industry. In 1987, an estimated 46,254 metric tons of cusk were caught as accidental bycatch and subsequently consumed; landings, as well as size of fish caught, have steadily decreased over the years (about 74 metric tons in U.S. waters in 2004), likely a sign of overall population decreases. Besides humans, cusk are preyed upon by sand sharks, dogfish, thorny skates, harbor seals, tuna, and porpoises. They rely on their slow movement and cryptic coloration to avoid detection by the roving predators they encounter. Additionally, the rocky substrate they inhabit allows them to seek cover in inaccessible crags if they feel threatened.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Brosme brosme (Cusk) preys on:
Crangon
Pandalidae
Decapoda
Gammaridae
Hyperiidae
Caprellidae
Isopoda
Cancer
Brachyura
Polychaeta
Ophiuroidea
Ostreoida
Bivalvia
Urophycis regia
Urophycis tenuis
Urophycis chuss

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Brosme brosme (Cusk) is prey of:
Gadidae
Hemitripterus americanus
Leucoraja erinacea
Leucoraja ocellata
Scophthalmus aquosus
Paralichthys dentatus
Hippoglossus hippoglossus
Squalus acanthias
Lophius americanus

Based on studies in:
USA, Northeastern US contintental shelf (Coastal)

This list may not be complete but is based on published studies.
  • Link J (2002) Does food web theory work for marine ecosystems? Mar Ecol Prog Ser 230:1–9
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Cusk rarely communicate with each other, and when they do it is most likely in order to locate a mate. Little is known of how this communication occurs, but it likely involves chemical signaling by females. Cusk live in deep water with little to no ambient light; their eyes are large and upturned for predator and prey detection. They have a sensory barbel on their chins that can detect vibrations, guide them over terrain, and may serve in a chemosensory capacity. They have moderately well-developed hearing and pressure sensitivity (through the lateral line system), and hunt primarily by sight, smell, or barbel detection.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: pheromones ; vibrations

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet

Feeds on crustaceans, shellfishes, starfishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Females release up to 2 million buoyant eggs at a time during spawning season. Eggs hatch into planktonic young, which remain in coastal, shallow-water environments until they grow to a length of about 5 centimeters, becoming benthic thereafter. These fish have a relatively slow growth rate, reaching 22 centimeters on average by age 6 and gaining about 10 centimeters per year thereafter. Sexual maturity is achieved at about 50 centimeters in length (8-10 years of age).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in shallower waters between 40-400 m, usually 100 to 200 m. Most important spawning grounds are located between Scotland and Iceland, from 200 to 500 m depth. In the Gulf of Maine, spawning grounds can be found in shallower waters (>50 m). Some individuals even spawn close inshore in Cape Cod, Provincetown Harbor and the Isles of Shoals (Ref. 1371).
  • Svetovidov, A.N. 1986 Gadidae. p. 680-710. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. UNESCO, Paris. vol. 2. (Ref. 3663)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Cusk can live for up to 20 years in the wild. As benthic fish that use primitive gas bladders for buoyancy, removal to the surface, with its related rapid change in pressure, is often immediately fatal. Commercial fishing is generally considered to be the greatest limiting factor in cusk longevity, as they are often by-catch of Atlantic halibut, cod, pollock, and haddock.

Typical lifespan

Status: wild:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little is known about cusk mating systems, but they are assumed to be similar to that of its relative, Atlantic cod (Gadus morhua). While Atlantic cod are generally more active than cusk, they do not have rigorous courtship behaviors. A male will court a female with fin displays and "grunting," after which the female will allow the male to invert himself beneath her, where fertilization of the egg clutch occurs. Cusk are solitary outside of breeding season and are assumed to be polygynous. Spawning occurs once a year between April and July and there are spawning grounds throughout this species' range, with some notable areas between Scotland and Iceland, along the edges of the Shetland and Faeroe Islands, in the northern North Sea, and in the Gulf of Maine.

Mating System: polygynous

Breeding occurs once yearly, between April and July. Up to 2 million eggs are released and fertilized in a clutch and sexual maturity is reached at 8-10 years.

Breeding interval: Cusk breed once yearly.

Breeding season: Breeding season is from April through July.

Range number of offspring: 2 million (high) .

Range gestation period: 8 to 23 days.

Average gestation period: 15 days.

Range age at sexual or reproductive maturity (female): 8 to 10 years.

Range age at sexual or reproductive maturity (male): 8 to 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

There is no parental investment by either sex following egg fertilization.

Parental Investment: no parental involvement

  • Cohen, D., T. Inada, T. Iwamoto, N. Scialabba. 1990. FAO species catalogue vol. 10: Gadiform Fishes of the World. Rome, Italy: Publishing and Multimedia service, FAO. Accessed October 14, 2012 at http://www.fao.org/docrep/009/t0243e/t0243e00.htm.
  • Matthews, J. 1927. Fisheries of the North Atlantic. Economic Geography, 3/1: 1-22.
  • Nelson, J. 1994. Fishes of the World. Toronto: John Wiley and Sons.
  • Shackell, N., K. Frank, D. Brickman. 2005. Range Contraction May Not Always Predict Core Areas: An Example from Marine Fish. Ecological Applications, 15/4: 1440-1449.
  • Tyus, H. 2012. Ecology and Conservation of Fishes. Boca Raton, FL: CRC press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in shallower waters between 40-400 m, usually 100 to 200 m. Most important spawning grounds are located between Scotland and Iceland, from 200 to 500 m. depth. In the Gulf of Maine, spawning grounds can be found in shallower waters. Some individuals even spawn close inshore in Cape Cod, Provincetown Harbor and the Isles of Shoals.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Cohen, D. M., T. Inada, T. Iwamoto and N. Scialabba, 1990; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Brosme brosme

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTTCTCATTCGAGCAGAGCTAAGTCAACCTGGCGCACTCCTTGGTGACGATCAAATTTATAATGTAATCGTTACAGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTCGGAAACTGACTAATCCCCTTAATAATCGGCGCCCCCGATATAGCCTTCCCTCGTATGAATAATATAAGCTTCTGACTTCTCCCGCCATCTTTCTTGCTCCTTCTAGCATCCTCCGGAGTAGAAGCGGGCGCCGGTACGGGGTGAACAGTCTATCCCCCTTTAGCAGGCAACCTTGCTCACGCTGGAGCCTCTGTTGATCTCACTATTTTCTCCCTTCACCTAGCAGGAATCTCATCAATTCTTGGAGCAATTAATTTTATTACTACTATTATTAACATAAAACCCCCAGCCATCTCACAGTACCAAACACCCCTATTTGTCTGAGCTGTCCTAATTACAGCCGTACTGCTTCTTCTCTCACTTCCCGTCTTAGCGGCCGGTATCACAATACTCCTGACTGACCGAAATCTTAATACTTCCTTCTTTGATCCTGCTGGAGGAGGAGACCCCATTCTATATCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Brosme brosme

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Cusk are considered to be a threatened species by the Committee on the Status of Endangered Wildlife Species in Canada and a species of concern by the U.S. National Marine Fisheries service. Cusk have not yet been assessed by the IUCN. It is not considered a threatened species by CITES. Due to its decreasing population and usefulness as a food source it is garnering additional attention.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: In Canada, fishing, unrestricted until 1999, is now capped but remains a source of mortality (COSEWIC, May 2003, http://www.cosewic.gc.ca/htmlDocuments/Detailed_Species_Assessment_e.htm).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative impacts of cusk on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cusk are a food item for humans. Because cusk and Atlantic cod are so similar in taste and appearance, they are often handled the same once caught and have the same pound for pound selling weight. This makes cusk both a valuable economic resource for fisheries and an important source of food for many individuals.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: highly commercial; gamefish: yes; price category: low; price reliability: reliable: based on ex-vessel price for this species
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cusk (fish)

Brosme for sale at the fish market in Bergen, Norway, in 2012

The cusk or tusk, Brosme brosme, is a North Atlantic cod-like fish in the ling family Lotidae. It is the only species in the genus Brosme.[1] Other common names include brismak, brosmius, torsk and moonfish.[2]

Description[edit]

It is easily distinguished at a glance from other cod-like fish as it has only one dorsal fin. Also characteristic is the nature of the dorsal, caudal, and anal fins, they are continuous at the base but separated by very deep notches so that they are obviously distinct. Moreover, the caudal fin is evenly rounded. It is variable in color, from slate to reddish brown above, and paling to gray on the lower sides and underneath. Older fish are usually plain colored, while the young often have transverse yellow bands on the sides. The maximum length is about 4 ft (120 cm) and top weight about 45 lb (20 kg). The IGFA world record stands at 37 lb 14 oz (17,20 kg), caught by Anders Jonasson outside Sørøya in northern Norway.

Distribution and habitat[edit]

It is distributed on both sides of the North Atlantic, mostly in moderately deep water. On the North American coast, it is regularly found southward to Cape Cod and occasionally off New Jersey. Its maximum range covers most of the North Atlantic, including the waters around Iceland and the Norwegian coast.[1] It is also found on the Mid-Atlantic Ridge.[3]

Cusk show little genetic differentiation over large distances, except where populations are surrounded by deep-water areas, namely on the Mid-Atlantic Ridge and the Rockall Bank. This suggests deep-water areas are barriers for adult movements, and, though they have pelagic eggs and larvae, dispersal during early life stages is not effective over long distances, either.[3]

It is normally found in water deeper than 60 ft (20 m), and practically always is taken over rough bottoms where rocks, ledges, or gravel are common. Good fishing areas are usually much more limited than is the case with cod, haddock, or pollock. It is an offshore fish and rarely is one taken in a harbor.

Habits[edit]

It spawns in the spring and summer, usually between April and early July. A medium-sized female has been known to produce more than two million buoyant eggs. The young live near the surface until they are about 2 in (5 cm) long, and then seek out rocky ocean floors in deep water.

Food[edit]

It is strictly a bottom-dwelling species, and is sluggish and a rather weak swimmer. It eats crustaceans and other soft bodied invertebrates and mollusks.

Fishing technique[edit]

US government photo

Cusk are primarily fished on the North American North Atlantic coastal shelf near the American state of Maine and the Canadian Maritimes.

In the Gulf of Maine, cusk are chiefly taken on hook and line. Line trawls account for most of the commercial catch off the New England coast, and most of them are caught during the winter and spring. The commercial catch individuals run between 1 and 2 feet long (30–60 cm), and average about 5 pounds (2 kg). It is an excellent food fish. It is marketed as fresh or frozen fillets; a part of the catch is smoked.

Global annual cusk catches in 1950-2003 from FAO statistics. The highest catch was 55,000 tonnes in 1980.

Conservation status[edit]

Fisheries and Oceans Canada (DFO) considers this species endangered based on a 2012 Committee on the Status of Endangered Wildlife in Canada assessment.[4] The status report identified that catches of cusk in the DFO summer bottom trawl survey had declined by roughly 90% from 1970 to the late 1990s.[5] A landings limit of 1000 mt was put in place in 1999 in the 4X North American Fisheries Organization area and was further restricted to 750 t and expanded to include the 4VWX5Z NAFO areas in 2003. Cusk are still commonly caught as bycatch in the longline and lobster fisheries and can be found in supermarkets in Atlantic Canada despite its threatened status.

Cusk is a US National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the Endangered Species Act(ESA).

References[edit]

  1. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2006). "Brosme brosme" in FishBase. May 2006 version.
  2. ^ Cusk Fish and seafood fact sheets. Agriculture and Agri-Food Canada
  3. ^ a b Knutsen, H.; Jorde, P. E.; Sannaes, H.; Hoelzel, R. A.; Bergstad, O. A.; Stefanni, S.; Johansen, T.; Stenseth, N. C. (2009). "Bathymetric barriers promoting genetic structure in the deepwater demersal fish tusk (Brosme brosme)". Molecular Ecology 18 (15): 3151–3162. doi:10.1111/j.1365-294X.2009.04253.x. PMID 19549108.  edit
  4. ^ [1] COSEWIC Species Database: Cusk. [COSEWIC]]
  5. ^ SARA registry report on Cusk (PDF) - Fisheries and Oceans Canada report on the state of cusk fisheries
  • E. C. Raney "Cusk." The Wise Fishermen's Encyclopedia (1951)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!