Overview

Comprehensive Description

Biology

Inhabits coastal waters, estuaries and lagoons, penetrating into freshwater; usually at depths less than 20 m (Ref. 3713). Feeds on fishes (Gobiidae, Gerreidae, Engraulidae) and crustaceans (shrimps and crabs) (Ref. 35237). Congregates at mouths of passes and rivers during the spawning season, May through September (Ref. 3713). Seasonal movements into freshwater occur but poorly understood (Ref. 3713). Marketed fresh (Ref. 5712). Valued game fish and an excellent food fish (Ref. 26938). The world record for hook and line is a 53-lb., 10 ounce fish caught at Parismina Ranch, Costa Rica (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: South Carolina to Brazil, including eastern Gulf of Mexico, Caribbean coast of Central America, and most of West Indies. Ranges north (to North Carolina and possibly Delaware) of main distribution during warm periods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina, U.S.A., to Brazil.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: southern Florida (USA), southeastern coast of the Gulf of Mexico, most of the Antilles and Caribbean coast of Central and South America extending southward to Rio de Janeiro, Brazil; also North Carolina and Texas, USA (Ref. 7251).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Common snook, Centropomus undecimalis, range from the coastal mid-Atlantic regions of the United States through the Gulf of Mexico and Caribbean to parts of Central and South America. Common snook have been documented as far north as Pamlico Sound, North Carolina and as far south as Rio de Janeiro, Brazil. They are particularly abundant around coastal Florida.

Biogeographic Regions: nearctic (Native ); neotropical (Native ); atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8 - 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Common snook are easily recognized by their elongate body, distinct sloping forehead, concave snout, and protruding lower jaw. They are further characterized by their prominent black lateral line, which is formed by 67 to 72 pored scales, that extends into the caudal fin. Common snook range from 0.14 to 140 cm in length (average 50 cm) and can weigh as much as 23.3 kg. Females are generally larger than males.

Coloration ranges from dark brown to dull gray with a yellow to green tint on the dorsal surface. The lateral surface tends to be silvery, and the ventral surface is generally white. The pectoral fins, pelvic fins, second dorsal fin, and the dorsal lobe of the caudal fin are all bright yellow in color, however, some specimens are considerably darker.

Unlike in other species within the genus Centropomus, the tips of their pelvic fins do not overlap or reach the anus. Common snook have 2 dorsal fins that are well-separated, each with 8 to 9 dorsal spines and 10 dorsal soft rays. The anal fin has 3 spines and 6 soft rays, and the second anal spine does not reach vertical from the caudal base. The pectoral fins have 15 to 16 rays and do not reach vertical from the tip of the pelvic fins.

Range mass: 23.3 (high) kg.

Range length: 0.14 to 140 cm.

Average length: 50.0 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 140 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 1400 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

140 cm TL (male/unsexed; (Ref. 9710)); max. published weight: 24.3 kg (Ref. 4699); max. reported age: 7 years (Ref. 12193)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

See Rivas (1962, Q. J. Florida Acad. Sci. 25:53-64) for a key to the four species of CENTROPOMUS recorded from U.S. waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

67- to 72 pored scales on lateral line to base of caudal fin (Ref. 26938). Black lateral line (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Year-round resident of mangrove-lined bays, estuaries, canals, and lower reaches of creeks and rivers where water temperature is 60 F or above; seldom caught in water deeper than 65 feet (Manooch 1984). Spawns in river mouths and in passes between islands (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 22m.
Recorded at 22 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; amphidromous (Ref. 51243); freshwater; brackish; marine; depth range ? - 22 m (Ref. 26912)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common snook are amphidromous fish, moving between fresh and salt water during their life, but not for the purpose of breeding. They can be found in freshwater, brackish, or marine environments at depths up to 22 m. They commonly associate with underwater structures such as pilings, reefs, or sea grass beds, but they most often prefer mangrove-fringed estuarine habitats. As adults, common snook are generally non-migratory, but often assemble in high salinity regions in order to spawn. Most live in waters of temperatures between 25 and 31°C.

Range depth: 22 (high) m.

Habitat Regions: temperate ; tropical ; saltwater or marine ; freshwater

Aquatic Biomes: reef ; lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 28 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0.3 - 11
  Temperature range (°C): 27.537 - 27.601
  Nitrate (umol/L): 0.447 - 0.997
  Salinity (PPS): 34.217 - 36.211
  Oxygen (ml/l): 4.593 - 4.691
  Phosphate (umol/l): 0.053 - 0.169
  Silicate (umol/l): 1.874 - 2.813

Graphical representation

Depth range (m): 0.3 - 11

Temperature range (°C): 27.537 - 27.601

Nitrate (umol/L): 0.447 - 0.997

Salinity (PPS): 34.217 - 36.211

Oxygen (ml/l): 4.593 - 4.691

Phosphate (umol/l): 0.053 - 0.169

Silicate (umol/l): 1.874 - 2.813
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats freshwater and saltwater species of crustaceans and fishes (Manooch 1984); primarily fishes (Lee et al. 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits coastal waters, estuaries and lagoons, penetrating into freshwater; usually at depths less than 20 m (Ref. 3713). Feeds on fishes (Gobiidae, Gerreidae, Engraulidae) and crustaceans (shrimps and crabs) (Ref. 35237). Congregates at mouths of passes and rivers during the spawning season, May through September (Ref. 3713). Seasonal movements into freshwater occur but poorly understood (Ref. 3713).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Common snook are pelagic feeders. Daily feeding peaks occurrs 2 hours before sunrise and 2 to 3 hours after sunset. Their feeding behavior is affected by the tidal cycle, and feeding activity noticeably increases with an increase in water flow following a period of standing flood or ebb tides

Common snook are voracious predators and opportunistic carnivores. They primarily feed on other pelagic fish, though diet varies with habitat type. Juveniles generally inhabit freshwater habitats, and their diet primarily consists of palaemonid shrimp, microcrustaceans, copepods and mosquitofish. In saltwater environments, common snook have a similiar diet, but they may also prey upon other species of fish such as sheepshead minnows, bay anchovies, and pinfish. In saltwater environments, common snook also consume zooplankton and larger crustaceans.

Animal Foods: fish; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Adult common snook are top predators in their environment, preying on many species of pelagic fish, crustaceans, and copepods. Juveniles are preyed upon by dolphins, birds, and larger fish. In Florida, common snook are often parasitized by myxosporeans: Myxobolus centropomi, Fabespora sp., and Ceratomyxa choleospora.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Common snook are considered top predators in their habitat, and adults do not have any natural predators other than humans. Juveniles are preyed upon by dolphins (Delphinidae and Phocidae), fish-eating birds such as osprey and herons, and larger species of fish.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common snook, like most fish, uses their lateral line system to detect movement and vibrations in the surrounding water. This sense organ allows a fish to orient itself in the water column, avoid collisions with other fish or submerged objects, and sense the presence of other organisms such as predators or potential prey. Common snook are sight-feeders, using their sense of vision in concert with their olfaction and gustatory senses to find prey. They attempt to capture any moving particle in their mouth, where the potential food item is then either ingested or rejected depending on taste and texture. Marine fishes, including common snook, can distinguish amino acids solutions at concentrations to the order of 10^-9 M using their sense of olfaction. Common snook, with their acute senses of vision and olfaction in combination with their lateral line system, are some of the top predators in their habitat.

Perception Channels: visual ; acoustic ; vibrations ; electric

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

The oocytes in follicles of common snook mature in a manner typical of most teleost fishes. The yolk averages 91% of egg mass. Eggs average 0.6 – 0.8 mm in diameter (0.27 mm^3 volume).

Hatchlings measure 1.4 to 1.5 mm in length. Common snook grow slowly in the first month following hatching, but growth rates nearly triple thereafter until the end of the first year. Juveniles can grow as much as 1 mm per day, but this rate slows to about 0.15 mm per day once they reach 2.4 mm in length. Juvenile common snook typically have absorbed their yolk sac by the time they reach 2.2 mm in length (in about 4 days). At 4.0 mm in length, melanophores become visible, and, by 7.0 mm in length, adult pigmentation becomes apparent. Bone ossification begins when juveniles reach roughly 5.0 mm in length, and by 8.6 mm the jaws are completely ossified and lined with teeth.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

It is estimated that common snook can live about 20 years. The oldest captured common snook on the Atlantic coast was an 18-year-old female, while on the Gulf coast the oldest was a 15-year-old female.

Range lifespan

Status: wild:
18 (high) years.

Typical lifespan

Status: wild:
20 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawns May-November (peak May-June); eggs hatch in 24-30 hours at 82-87 F; about 50% of individuals are sexually mature at age 3 (Manooch 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although common snook can occupy both freshwater and marine environments, they must spawn in saltwater, as sperm can only become active in saline conditions. Common snook are often observed congregating at the mouths of rivers, inlets, and canals during times of spawning. Several males often follow a single female during these mass spawning congregations. Common snook spawn in the evening over a period of several days. In Florida, two reproductive peaks are often observed, the first from June to July and the second from August to October. Reproductive peaks often occur during times of increased rainfall, which may be the result of increased phytoplanktonic primary production during rainy periods. If so, spawning activity may related to food availability.

Common snook are protandric hermaphrodites, meaning they change from male to female after maturation. The gonads of common snook contain both male and female sex cells. Female gonads mature directly from mature male gonads shortly after a male has concluded spawning. This transition takes place between the ages of 1 and 7 years. As a result of this process, the majority of small common snook are male and the majority of large individuals are female. In Florida, the ratio of males to females between the ages of 0 and 2 years differs significantly between the east and west coasts of the state. This variation is attributed to protrandry and differences in growth and mortality rates.

Common snook breed seasonally and are often observed congregating at the mouths of rivers, inlets, and canals during times of spawning. In Florida, two reproductive peaks are often observed, the first from June to July and the second from August to October. Spawning often peaks during times of increased rainfall. Common snook practice broadcast spawning.

Breeding interval: Common snook generally breed twice each year.

Breeding season: In Florida, reproduction of common snook peaks in June and July and again from August to October.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protandrous ); sexual ; fertilization (External ); broadcast (group) spawning

Little information is known regarding the parental investment of common snook in their offspring. As broadcast spawners, however, members of this species are unlikely to provide parental care to hatchlings or juveniles.

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropomus undecimalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTCATTTTTGGTGCTTGAGCTGGCATAGTTGGCACCGCACTCAGCCTACTCATTCGAGCGGAACTTAGTCAACCTGGCGCCCTACTAGGAGACGACCAAATTTACAATGTTATTGTCACGGCACACGCCTTCGTAATAATTTTCTTCATAGTGATGCCAATCATAATTGGAGGCTTCGGAAACTGACTCATCCCTCTAATAATTGGAGCTCCAGACATGGCATTTCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCTCCTTCCTTCCTGCTACTTCTAGCCTCCTCTGGAGTAGAAGCCGGTGCCGGAACAGGATGAACAGTTTACCCCCCTCTAGCTGGTAATCTCGCCCACGCCGGAGCATCGGTAGACCTCACCATCTTTTCACTACACTTAGCCGGAATCTCTTCAATTCTTGGAGCTATCAACTTTATCACAACCATTATCAATATAAAACCAGCCTCAACCTCTATATACCAAATTCCCCTATTCGTTTGATCTGTCCTAATTACGGCCGTCCTTCTCCTCCTTTCCCTCCCCGTCCTAGCCGCCGGGATCACAATGCTCCTAACCGACCGAAACTTAAACACCTCATTCTTCGACCCAGCCGGAGGTGGAGACCCCATTCTTTACCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Centropomus undecimalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations of common snook have declined over the last 50 years due to commercial and recreational overfishing as well as habitat degradation and destruction. In 1957, a bill was passed in the Florida legislature which prohibited commercial fishing and the sale of common snook. Passage of this bill helped alleviate commercial fishing pressures on native populations, but habitat loss and water quality degradation may have a continued effect on populations of common snook. In January 1999, the Florida Fish and Wildlife Conservation Commission implemented a slot limit for recreational fisherman in order to protect larger breeding females. Florida fisherman can only harvest common snook between 26 and 34 in (66 to 86 cm) in length. Furthermore, there is a bag limit of 1 or 2 fish per person per day depending on the area. Fishing for common snook is closed between December 15 and January 31 statewide in Florida.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of common snook on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

While commercial fishing of common snook is illegal throughout Texas and Florida, they are prized game fish throughout their known geographic range. They are known as strong fighters when hooked. In 1986, Florida's fisheries and sport fishing enterprises of all game fish were estimated to be worth 5 to 7 billion USD annually. Common snook is prized for its culinary value.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Common snook

"Róbalo" redirects here. For the fish from southern South America, see Eleginopidae.

The common snook (Centropomus undecimalis) is a species of marine fish in the family Centropomidae of the order Perciformes. The common snook is also known as the sergeant fish or robalo. It was originally assigned to the sciaenid genus Sciaena; Sciaena undecimradiatus and Centropomus undecimradiatus are obsolete synonyms for the species.

One of the largest snooks, Centropomus undecimalis grows to a maximum overall length of 140 centimetres (4.6 ft) but common length is 50 centimetres (1.6 ft).[1] Of typical centropomid form, it possesses drab coloration except for a distinctive black lateral line. It can also possess bright yellow pelvic and caudal fins, especially during spawn.[2]

General Ecology[edit]

Reproductive Ecology[edit]

Centropumis undecimalis is a protandric hermaphrodite fish species.[3] The common snook’s spawning season appears to span the months of April to October, with the peak spawning occurring during the months of July and August.[4] Spawning typically occurs in near-shore waters with high salinities.[5] Following the spawning period, the juveniles will then migrate to the brackish waters of the nearby estuarine environments.[5] When these juveniles mature they will then return to the higher salinity waters of the open ocean to join the breeding population.[5]

Habitat Ecology[edit]

The common snook is an estuarine-dependent fish species.[6] Within estuaries, juvenile common snook are most often found inhabiting areas such as coastal wetland ponds, island networks, and creeks.[7] Despite being a euryhaline species of fish, common snook do show a tendency to gravitate towards lower salinity conditions in the early stages of their life.[8] By being able to adapt and thrive in both high and low salinity conditions through osmoregulation, common snook display a high level of habitat plasticity.[9] Common snook are opportunistic predators whose feeding habits indicate that there is a positive relationship between their size and the size size of their prey, meaning that as the snook grows it feeds on larger and larger prey.[10] Common snook have been found to occasionally engage in cannibalistic activities, though this behavior is rare.[11] This usually occurs during the winter months when adult and juvenile common snook are in close proximity to one another within their estuarine habitats.[11] This form of cannibalism where the juveniles are fed on by the adults is referred to as intercohort cannibalism.[11] The adult common snook who do cannibalize juveniles most likely target them due to the fact that the juveniles may be the largest of the available prey, and are therefore more nutritionally efficient to prey upon.[11]

Physiological Ecology[edit]

Common snook, like many species of fish, are very in tune with their environment, meaning that even a slight change in their surroundings can have a significant impact on their behavior. For example, common snook are able to determine when to start and stop spawning based on the temperature and salinity of the water they inhabit, the amount of rainfall in the area and whether or not there is a full moon.[12][13] However, there are some cases in which disturbances in their environment can have very negative effects on the snook population. One example of this is the devastating results of a cold snap. Snook are very susceptible to cold temperatures, with the effects ranging from the complete halt of all feeding at a water temperature of 14.2˚C, to the loss of equilibrium at 12.7 ̊C, to death at a temperature of 12.5 ̊C.[14] Recently, a cold snap in January of 2010 resulted in a 41.88% decline in nominal abundance of the common snook population in Southwest Florida from the previous year and a 96-97% post-cold event decrease in apparent survival estimates.[15]

Distribution and habitat[edit]

Centropomus undecimalis is widespread throughout the tropical waters of the western Atlantic Ocean from the coast of the North Carolina to Brazil including the Gulf of Mexico and the Caribbean Sea.[16] Occurring in shallow coastal waters (up to 20 metres (66 ft) depth), estuaries, and lagoons, the fish often enters fresh water. It is carnivorous, with a diet dominated by smaller fishes, and crustaceans such as shrimps, and occasionally crabs.[17]

Human interest[edit]

Considered an excellent food fish, the common snook is fished commercially and foreign caught fish are sold in the USA. It is also prized as a game fish, being known for their great fighting capabilities.[18]

Three United States Navy submarines have been named for this species, USS Robalo (SS-273) and USS Snook (SS-279) in the Second World War and USS Snook (SSN-592) in the 1950s.

Protection in Florida Gulf Coast[edit]

"At the June 2012 Florida Fish and Wildlife Conservation Commission (FWC) meeting, Commissioners voted to keep the recreational harvest of snook in Gulf of Mexico waters closed through Aug. 31, 2013. This closure will offer the species additional protection after a 2010 cold kill detrimentally affected the population. Snook closed to harvest in Gulf of Mexico and Atlantic waters in January 2010 after a severe cold kill affected snook population number."[19]

This means that all Snook are "Catch and Release" only in the Gulf of Mexico until August 31, 2013. At that time the FWC can choose to open or close Snook harvest for another season. The commercial harvest or sale of Snook is prohibited by the same regulations.

Update: At the June 2013 Florida Fish and Wildlife Conservation Commission (FWC) meeting, Commissioners voted to let the recreational harvest of snook in Gulf of Mexico waters reopen to harvest Sept. 1st. The next stock assessment for snook is scheduled for 2015.[20]

References[edit]

  1. ^ http://www.fishbase.org/summary/345
  2. ^ http://eol.org/pages/205157/details#diagnostic_description
  3. ^ Perera-García, M.A.; Mendoza-Carranza, M.; Contreras-Sánchez, W.M.; Huerta-Ortíz, M.; Pérez-Sánchez, E. (2011). "Reproductive biology of common snook Centropomus undecimalis (Perciformes: Centropomidae) in two tropical habitats". Revista de Biología Tropical 59 (2): 669–681. 
  4. ^ Tucker, J.W.; Campbell, S.W. (1988). "Spawning season of common snook along the east central Florida coast". Florida Scientist 51 (1): 1–6. 
  5. ^ a b c Gracia-Lopez, V.; Rosas-Vazquez, C.; Brito-Perez, R. (2006). "Effects of salinity on physiological conditions in juvenile common snook Centropomus undecimalis". Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 145 (3): 340–345. doi:10.1016/j.cbpa.2006.07.008. 
  6. ^ Taylor, R.G.; Grier, H.J.; Whittington, J.A. (1998). "Spawning rhythms of common snook in Florida". Journal of Fish Biology 53 (3): 502–520. doi:10.1111/j.1095-8649.1998.tb00998.x. 
  7. ^ Stevens, P.W.; Blewett, D.A.; Poulakis, G.R. (2007). "Variable habitat use by juvenile common snook, Centropomus undecimalis (Pisces: Centropomidae): applying a life-history model in a southwest Florida estuary". Bulletin of Marine Science 80 (1): 93–108. 
  8. ^ Peterson, M.S.; Gilmore, G.R. (1991). "Eco-Physiology of Juvenile Snook Centropomus Undecimalis (Bloch): Life-History Implications". Bulletin of Marine Science 48 (1): 46–57. 
  9. ^ Rhody, N.R.; Nassif, N.A.; Main, K.L. (2010). "Sarasota, FL, USA, p. 30. Rhody, N. R., Nassif, N. A., and Main, K. L. 2010. Effects of salinity on growth and survival of common snook Centropomus undecimalis (Bloch, 1792) larvae". Aquaculture Research 41 (9): 357–360. doi:10.1111/j.1365-2109.2010.02511.x. 
  10. ^ Blewett, N.R.; Hensley, R.A.; Stevens, P.W. (2006). "Feeding habits of common snook, Centropomus undecimalis, in Charlotte Harbor, Florida". Gulf and Caribbean Research 18: 1. 
  11. ^ a b c d Adams, A.J.; Wolfe, R.K. (2006). "Cannibalism of juveniles by adult common snook (Centropomus undecimalis)". Gulf of Mexico Science 24 (1/2): 11. 
  12. ^ Peters, K.M.; Matheson Jr., R.E.; Taylor, R.G. (1998). "Reproduction and early life history of common snook, Centropomus undecimalis (Bloch), in Florida". Bulletin of Marine Science 62 (2): 509–529. 
  13. ^ Aliaume, C.; Zerbi, A.; Miller, J.M. (2005). "Juvenile snook species in Puerto Rico estuaries: Distribution, abundance and habitat description". Proc. Gulf Carib. Fish. Institute 47: 499–519. 
  14. ^ Shafland, P.L.; Foote, K.J. (1983). "A lower lethal temperature for fingerling snook (Centropomus undecimalis)". Northeast Gulf Science 6: 175–177. 
  15. ^ Adams, A.J.; Hill, J.E.; Barbour, A.B. (2012). "Effects of a severe cold event on the subtropical, estuarine-dependent common snook, Centropomus undecimalis". Gulf and Caribbean Research 24: 13–21. 
  16. ^ http://eol.org/pages/205157/details#distribution
  17. ^ http://eol.org/pages/205157/details#trophic_strategy
  18. ^ http://eol.org/pages/205157/details#benefits
  19. ^ http://myfwc.com/fishing/saltwater/recreational/snook/
  20. ^ http://myfwc.com/news/news-releases/2013/june/12/snook-season/

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!