Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Biology

C. carassius varies in size. Some slow-growing populations are known as ‘stunted’.The largest recorded C. carassius was a 9 year-old fish found in a lake in Poland. It was 275mm long.C. carassius lives for 3–10 yearsBoth males and females of the species can reach sexual maturity in the first year.

Biotic interactions
C. carassius readily hybridises with other members of the same genus - Carassius auratus, Carassius gibelio and the common carp, Cyprinus carpio.Hybridisation is probably contributing to the decline of C. carassius in parts of its native range, including in England and France.There is some evidence from England that growth performance is affected in both C. carassius and C. auratus when they co-occur in small ponds.Other factors contributing to declines include habitat loss, lack of pond management and acidification.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

The crucian carp, Carassius carassius, is one of four Carassius species, with at least 6 sub-species, belonging to the carp family Cyprinidae.The fish is native to northern Europe and thrives in shallow waters with dense vegetation. But its numbers are declining because of changes to its habitat and the introduction of related species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Occurs in shallow ponds, lakes rich in vegetation and slow moving rivers. Burrows in mud in the dry season or during winter (Ref. 2163). Usually restricted to densely vegetated backwaters and oxbows of lowland rivers. Can survive at high temperatures and at very low oxygen concentrations during summer and under ice cover (Ref. 59043). Tolerates cold, organic pollutants, and low oxygen levels in the water (Ref. 30578). Feeds all day but mainly at night on plankton, benthic invertebrates, plant materials and detritus. Usually does not occur in waters with rich ichthyofauna and abundant predatory species, but very abundant in the absence of other fish species. Spawns in dense submerged vegetation (Ref. 59043). Marketed fresh and frozen; eaten fried, broiled and baked (Ref. 9988). Live up to about 10 years. There is a gradual but continuing extirpation in many water bodies, especially in Danube drainage and central Europe, possibly to due competition with introduced Carassius gibelio in non-optimal habitats (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

North, Baltic, White, Barents, Black and Caspian Sea basins; Aegean Sea basin only in Maritza drainage; eastward to Kolyma drainage (Siberia); westward to Rhine and eastern drainages of England. Absent from North Sea basin in Sweden and Norway. In Baltic basin north to about 66°N. Widely introduced to Italy, England and France but possibly often confused with C. gibelio.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Baltic sea, Black Sea, Polish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Zeeschelde
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eurasia: North, Baltic, White, Barents, Black and Caspian Sea basins; Aegean Sea basin only in Maritza drainage; eastward to Kolyma drainage (Siberia); westward to Rhine and eastern drainages of England. Absent from North Sea basin in Sweden and Norway. In Baltic basin north to about 66°N. Widely introduced to Italy, England and France but possibly often confused with Carassius gibelio (Ref. 59043). At least one country reports adverse ecological impact after introduction.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3 - 4; Dorsal soft rays (total): 13 - 22; Analspines: 2 - 3; Analsoft rays: 5 - 7; Vertebrae: 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

64.0 cm TL (male/unsexed; (Ref. 6114)); max. published weight: 3,000 g (Ref. 556); max. reported age: 10 years (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 450 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosed from its congeners in Europe by having the following characters: body golden-green shining color; last simple anal and dorsal rays weakly serrated; 23-33 gill rakers; lateral line with 31-36 scales; free edge of dorsal convex; anal fin usually with 6½ branched rays; and peritoneum white (Ref. 59043). Caudal fin with 18-20 rays (Ref. 2196). No barbels. The third dorsal and anal-fin rays are strong and serrated posteriorly.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
Usually restricted to densely vegetated backwaters and oxbows of lowland rivers. Also in small well vegetated lakes and channels. Tolerates high summer temperatures and very low oxygen concentrations in summer and under ice cover. Able to survive in almost completely frozen water or almost-dry habitats by burying itself in mud. Spawns in dense submerged vegetation.

Biology:
Lives about 10 years. Males reproduce for the first time at three years, females at four years in central and eastern Europe, at two years in southern Europe. Spawns in May-July at temperatures above 18°C. Individual females spawn with several males. Males follow ripe females, often with much splashing. Females spawn 3-5 times during a season. Eggs are sticky and are attached to water plants. Omnivorous; feeds all day but mostly at night on plankton, benthic invertebrates, plant material and detritus. Seems to be a weak competitor, usually absent from waters with rich ichthyofauna and abundant predatory species. Very abundant in the absence of other fish species. High-bodied, fast-growing individuals in habitats with predatory fish, more elongate in habitats without predatory fish.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 117 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 10

Graphical representation

Depth range (m): 1 - 10
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish; depth range 5 - ? m (Ref. 2163)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on insect larvae and plankton (Ref. 30578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Turbidity of the Skin (Freshwater fish). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

SVC. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skin Flukes. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

False Fungal Infection (Epistylis sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Distribution ecology

C. carassius is a cryptic, mainly benthic, freshwater fish.It is native to northern Europe and ranges from southeast England to Asia.It has been introduced to over ten countries, including Turkey, Ethiopia, Thailand, Sri Lanka and the Philippines.

Habitat
Carassius carassius lives in both still waters and watercourses.It is characteristic of shallow water bodies with submerged vegetation as well as river floodplain pools and backwaters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females spawn multiple times during the spawning period (Ref. 88808). Reproduction in May-June in shallow water with dense vegetation, eggs 130000-250000/female adhere to plants, hatch after 4-8 days (Ref. 2163). Individual female spawn with several males. Males follow ripe females, often with much splashing. Eggs are sticky and are attached to water plants (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carassius carassius

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1701-06|NC_006291|Carassius carassius| ACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGTACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACCGCTTTA---AGCCTCCTCATCCGAGCTGAACTTAGTCAACCCGGATCACTTCTAGGTGAT---GACCAAATTTACAATGTAATTGTTACCGCCCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCTATCCTCATTGGAGGATTCGGAAACTGACTTGTACCCCTGATA---ATCGGAGCCCCAGACATGGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCCCCATCATTCCTGTTACTACTAGCTTCCTCTGGTGTTGAAGCCGGAGCTGGCACCGGATGGACAGTATACCCCCCTCTTGCAGGAAACCTGGCCCACGCAGGAGCATCAGTAGACCTA---ACAATTTTCTCACTACATTTAGCAGGTGTTTCATCAATCCTGGGGGCAATCAACTTCATTACTACAACCATTAACATAAAACCTCCAGCCATTTCCCAATACCAAACACCCCTATTTGTTTGATCCGTACTTGTAACCGCCGTCCTCCTTCTCCTATCACTACCTGTTCTAGCTGCC---GGTATTACAATGCTTTTAACAGATCGAAATCTTAACACCACATTCTTTGATCCCGCAGGCGGGGGAGACCCAATTCTCTATCAACACTTATTCTGATTCTTTGGTCACCCAGAAGTTTACATTTTAATCCTTCCAGGATTTGGAATTATTTCTCACGTTGTAGCCTATTATTCAGGTAAAAAA---GAACCATTTGGTTATATAGGAATAGTATGAGCCATAATGGCCATTGGCCTCCTAGGGTTCATTGTATGAGCCCACCATATGTTTACTGTCGGAATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Carassius carassius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Species: 19
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
Wide distribution but gradual and continuing extirpation in many water bodies, especially in Danube drainage and central Europe, for unknown reasons. Suspected to be due to competition with introduced C. gibelio in non-optimal habitats.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A recent study in England demonstrated that C. carassius was absent in 4 out of 5 ponds where the species was previously found.In England, Carassius carassius is now recognised at local, county, and national levels for conservation concern, with the species designated as a Biodiversity Action Priority (BAP) species for the county of Norfolk.

Management
Initiatives to aid conservation of the species focus on pond management by:
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Introduced C. gibelio.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; aquarium: commercial; bait: occasionally
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Crucian carp

The crucian carp (Carassius carassius) is a member of the common carp family Cyprinidae.

It is a European species, and its wide range spans from England to Russia; it is found as far north as the Arctic Circle in the Scandinavian countries, and the southern extremities defined by central France and the Black Sea.[2] Its habitat occurs in lakes, ponds, and slow-moving rivers. It has been established that the fish is native to England and not introduced.[3]

The crucian is a medium-sized cyprinid, typically 15 cm in body length,[4] and rarely exceeds in weight over 1.5 kilograms (3.3 pounds),[citation needed]. But a maximum total length of 64.0 cm is reported for a male,[5] and the heaviest published weighed 3 kilograms.[4]

They are broadly described as having a body of "golden-green shining color",[6] but a more precise source states that young fish are golden-bronze[7] but darken with maturity,[7] until they gain a dark green back, deep bronze upper flanks, and gold on the lower flanks and belly,[7] and reddish[citation needed]or orange[8] fins,[9] although other colour variations exist. One distinguishing characteristic is a convexly rounded fin, as opposed to goldfish (or C. gibelio) hybrids which have concave fins.[8][10]

The variation in shape of a crucian carp can be very high. When cohabiting waters where predatory such as pike or perch fish are present, there occurs an induced change in the morphology of the population, from a sleeker to a deeper bodied form,[11] into almost perfect disc shape with well-rounded fins, making it difficult for predators to swallow the crucian carp.[12]

The crucian carp is also a type species (generic term) for the entire genus, so this has led to the confusion that this is the sames species as those that are native to East Asia.

There are also reported to be interbred hybrids between the crucian and goldfish (domestic or feral),[8] and a researcher found in laboratory conditions that such cross-breeding are possible, producing viable young.[8] Although the hybrids his researcher produced were sterile or virtually so, genetic contamination into the native population has been leveled as a cocern,[8] and even if they don't breed further down the line, the F1 hybrids exhibit hybrid vigour or heterosis, being much more adept at finding food and evading predators than either of their parents, and thus could pose a threat to the native carp population.[8]

Contents

Sports fishing

In Britain, leisurely or competitive catching of this fish by rod and tackle belong in the coarse fishing category. The British rod-caught record for largest crucian is four pounds, nine ounces, (2.085 kg) landed by Martin Bowler in 2003, tied by Joshua Blavins in 2011.[13] There have been various bids for a breakage of this record since, but they were rejeted as not "true" crucians" but rather, e.g. a "brown goldfish variant"[10] (i.e., hybrid born between the non-native goldfish or gibelo species and the British crucian). In the Netherlands, a typical crucian specimen of 54 cm, weighing 3 kg has been caught and photographed.[14]

Relation to goldfish

Prussian carp Carassius gibelio as comparison

Many sources will state that the goldfish (Carassius auratus auratus) is a cultivated breed of crucian carp taken from the wild. Since "crucian carp" is the name of the genus this is not strictly wrong, but certainly ambiguous and misleading. Genetic research has show goldfish is actually derives from the Prussian carp Carassius gibelio.

Aside from confusion in nomenclature, there is the practical issue of distinguishing true crassian carp from goldfish hybrids in, e.g., competitive coarse fishing. The following is based on a similar table of guidelines constructed by the Farnham Angling Society[15]:

Crucian carp (C. crassius)Goldfish (C. gibelio)
a) snout well roundeda) more pointed snout
b) Always golden bronzeb) often has a grey/greenish color
c) 33 + scales along lateral line (33;[7] 31-36 scales[6])c) 31 or less scales on lateral line (27-31[7])
d) Juveniles have a black spot at the base of the tail, which disappear with age. ("transient dark marking on the caudal peduncle"[8])d) This tail spot is never present.
e) The leading ray of the dorsal fin is weake) The leading ray of the dorsal fin is strong
f) The dorsal fin is higher for longer and convex in shape[6] and has 15 or less branched raysf) The dorsal fin is concave in shape and has 15 or more branched rays
g) caudal fin bluntly lobed[7]g) caudal fin deeply forked and sharp[7])

[citation needed]

Use

These carp are also occasionally kept as freshwater aquarium fish, as well as in water gardens, although they are not commonly available commercially, mainly because they are not in particularly high demand due to the presence of more colourful fish such as the koi or orfe.

It has been suggested that this is a heavily farmed fish worldwide; FAO's newest statistics from 2008 (pub. 2011) shows total production C. Crassius at 1,957,337 tonnes, worth US$2,135,857,000, ranked 9th in worldwide in aquaculture, including marine fish and crustaceans,[16] however this statistics treats the Asian C. gibelio carp as a subspecies of the European crucian carp[17],, and it is evident that the greater bulk of this number is from the Asian fish farmed in China.[17]

In terms of freshwater catches of C. Crassius (read Carassius spp.), FAO's 2006 satistics show 5.53 thousand tons harvested, which ranked 13th worldwide among freshwater fishes caught. The breakdown was Kazakhstan 2.2, Japan 1.12, Serbia 0.84, Moldova 0.19, Uzbekistan 0.19, Poland 0.13.[16] In these figures, the tonnage from European countries may represent C. Crassius in some part.

In Poland, crucian (Polish: karaś) is considered the best-tasting pan fish, and traditionally served with sour cream (karasie w śmietanie).[18] In Russia, this particular species is called Russian: Золотой карась meaning "golden crucian", and is one of the fish used in a borscht recipe called borshch c karasej[19] (Russian: Борщ с карасе́й)or borshch c karasyami Russian: Борщ с карася́ми).

References

  1. ^ J. Freyhof & M. Kottelat (1996). "Carassius carassius". IUCN Red List of Threatened Species. Version 3.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/3849. Retrieved October 15, 2011. 
  2. ^ Holopaien et al., 1997b
  3. ^ Smartt 2007, citing Wheeler 1972, 2000, Copp etal. 2005
  4. ^ a b Muus, B.J. and P. Dahlström 1968 Süßwasserfische. BLV Verlagsgesellschaft, München. 224 p. 224. Fishbase Ref.556
  5. ^ Koli, L. 1990 Suomen kalat. [Fishes of Finland]. Werner Söderström Osakeyhtiö. Helsinki. 357 p. (in Finnish). Fishbase Ref. 6114
  6. ^ a b c Kottelat, M. and J. Freyhof 2007 Handbook of European freshwater fishes. Publications Kottelat, Cornol, Switzerland. 646 p.; Fisbhbase Ref. 59043
  7. ^ a b c d e f g Wellby, Girdler & Welcomme 2010,p.49, also color photograph is consulted
  8. ^ a b c d e f g Smartt 2007
  9. ^ Wellby, Girdler & Welcomme 2010,p.49, photographed
  10. ^ a b FAS 2010 (website)
  11. ^ Richard & Farrell Brauner, citing Brönmarker and Milner, 1992; and Holopaien et al., 1997b,
  12. ^ Nilsson, P. Anders; Brönmark, Christer; Petterson, Lars B. (1995). "Benefits of a predator-induced morphology in crucian carp". Oecologia 104 (3): 291–296. JSTOR 4221109. 
  13. ^ British Records (rod-caught) Fish Committe 2011(website)
  14. ^ http://www.visserslatijn.nl/specimenhunting/index.html
  15. ^ FAS 2010
  16. ^ a b 海の幸の会 2012
  17. ^ a b FAO 2012
  18. ^ Strybel & Strybel 2005,p.384
  19. ^ Molokhovet︠s︡ 1998
(angling)
(Fishing industry)
(culinary)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Crucian Carp

The Crucian Carp (Carassius carassius) is a member of the family Cyprinidae, which includes many other fish such as the common carp, or the smaller minnows. They inhabit lakes, ponds, and slow-moving rivers throughout Europe and Asia. The crucian is a medium-sized cyprinid, which rarely exceeds a weight of over 3.3 pounds (1.5 kg). They usually have a dark green back, golden sides, and reddish fins, although other colour variations exist.

They are often caught as a sport fish: the British rod-caught record for largest crucian is four pounds, nine ounces, caught by Martin Bowler in a lake in southern England in 2003. There have been various bids for a breakage of this record since, but they have been passed off as the specimens have not been said to have been "true" crucians, but hybrids between the carp and one of its relatives, such as the goldfish, which are not native to the British Isles. In the Netherlands a typical crucian specimen of 54 cm, weighing 3 kg has been caught and photographed.[1] Hybrids often exhibit hybrid vigour or heterosis, being much more adept at finding food and evading predators than either of their parents, and thus pose somewhat of a threat to the native carp population, and to other native aquatic animals.

These carp are also occasionally kept as freshwater aquarium fish, as well as in water gardens, although they are not commonly available commercially, mainly because they are not in particularly high demand due to the presence of more colourful fish such as the koi or orfe. However, they are one of the most important aquaculture species. In 2005 they were the species with the 10th highest production, globally (FAO 2005).

The variation in shape of a Crucian carp can be very high. The fish get an almost perfect disc shape with well rounded fins. If no predators like pike or perch are present, the Crucian carp will grow in length rather than height and the fish will be more slender looking. The growth in height will make it difficult for predators to swallow the crucian carp.[2]

In April 2011, Peter Rolfe (A.K.A. "The Crucian Crusader") set up a UK based website dedicated to the crucian, Carassius carassius, at www.crucians.org. The site provides a database of information and gathers together ideas and experiences, building up a really reliable resource for anglers, naturalists, conservationists, scientists, land-owners, fish farmers and dealers - in fact anyone who's interested in the species.


Contents

Relation to Goldfish

Many sources will claim that Crucian carp are the wild form of the goldfish (Carassius auratus auratus), the wild form of the goldfish is actually the Prussian carp Carassius gibelio , or sometimes Carassius auratus gibelio with gibelio identified as a subspecies of C. auratus. While they are certainly closely related, they are different species which can be identified by the following characteristics:

  • C. auratus has a more pointed snout while the snout of C. carassius is well rounded.
  • The wild form of the Goldfish C. auratus gibelio or C. gibelio often has a grey/greenish color, while crucian carps are always golden bronze.
  • Juvenile crucian carp (and tench) have a black spot on the base of the tail which disappears with age. In C. auratus this tail spot is never present.
  • C. auratus have fewer than 31 scales along the lateral line while crucian carp have 33 scales or more.[citation needed]

Use

Although the crucian carp (鯽魚) can be raised as pets, it is also farmed and commonly used in Chinese cuisine. Despite being reputedly bony, the fish is easy to raise and relatively cheap and are often deep fried as part of a worker's meal.

There are many extensive and luxurious preparations for this fish in Chinese cuisine. For example, it can be found in the Shanghainese dish congshao jiyu (蔥燒鯽魚, lit. scallion cooked crucian carp), which requires long hours for preparation since the fish needs to be soaked in vinegar, and then deep-fried, stewed for a long prolonged period, and cooled to make the fish tender enough to consume together with all its bones.[3] Also, crucian carp is used to make soup with tofu, which the Chinese believe to benefit women in the postpartum period.

Pictures

References

  1. ^ http://www.visserslatijn.nl/specimenhunting/index.html
  2. ^ Nilsson,P.A.;Brönmark,C:Petterson,L.B. - 2004- Benefits of a predator-induced morphology in crucian carp - Oecologia - Springer Berlin / Heidelberg ISSN 0029-8549 (Print) 1432-1939 (Online) - Issue Volume 104, Number 3 / November, 1995 - Pages 291-296
  3. ^ Lee, Jesse (2008), 上海味兒, 旗林文化, ISBN 978-986-6655-14-2 

FAO 2005 - FAO Fishstats.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Crucian carp

The Crucian Carp (Carassius carassius) is a member of the family Cyprinidae, which includes many other fish such as the common carp, or the smaller minnows. They inhabit lakes, ponds, and slow-moving rivers throughout Europe and Asia. The crucian is a medium-sized cyprinid, which rarely exceeds a weight of over 3.3 pounds (1.5 kg). They usually have a dark green back, golden sides, and reddish fins, although other colour variations exist.

They are often caught as a sport fish: the British rod-caught record for largest crucian is four pounds, nine ounces, caught by Martin Bowler in a lake in southern England in 2003. There have been various bids for a breakage of this record since, but they have been passed off as the specimens have not been said to have been "true" crucians, but hybrids between the carp and one of its relatives, such as the goldfish, which are not native to the British Isles. In the Netherlands a typical crucian specimen of 54 cm, weighing 3 kg has been caught and photographed[1]. Hybrids often exhibit hybrid vigour or heterosis, being much more adept at finding food and evading predators than either of their parents, and thus pose somewhat of a threat to the native carp population, and to other native aquatic animals.

These carp are also occasionally kept as freshwater aquarium fish, as well as in water gardens, although they are not commonly available commercially, mainly because they are not in particularly high demand due to the presence of more colourful fish such as the koi or orfe. However, they are one of the most important aquaculture species. In 2005 they were the species with the 10th highest production, globally (FAO 2005).

The variation in shape of a Crucian carp can be very high. The fish get an almost perfect disc shape with well rounded fins. If no predators like pike or perch are present, the Crucian carp will grow in length rather than height and the fish will be more slender looking. The growth in height will make it difficult for predators to swallow the crucian carp.[2]

Contents

Relation to Goldfish

Many sources will claim that Crucian carp are the wild form of the goldfish (Carassius auratus auratus), the wild form of the goldfish is actually the Prussian carp Carassius gibelio , or sometimes Carassius auratus gibelio with gibelio identified as a subspecies of C. auratus. While they are certainly closely related, they are different species which can be identified by the following characteristics:

  • C. auratus has a more pointed snout while the snout of C. carassius is well rounded.
  • The wild form of the Goldfish C. auratus gibelio or C. gibelio often has a grey/greenish color, while crucian carps are always golden bronze.
  • Juvenile crucian carp (and tench) have a black spot on the base of the tail which disappears with age. In C. auratus this tail spot is never present.
  • C. auratus have fewer than 31 scales along the lateral line while crucian carp have 33 scales or more.

Use

Although the crucian carp (鯽魚) can be raised as pets, it is also farmed and commonly used in Chinese cuisine. Despite being reputedly bony, the fish is easy to raise and relatively cheap and are often deep fried as part of a worker's meal.

There are many extensive and luxurious preparations for this fish in Chinese cuisine. For example, it can be found in the Shanghainese dish congshao jiyu (蔥燒鯽魚, lit. scallion cooked crucian carp), which requires long hours for preparation since the fish needs to be soaked in vinegar, and then deep-fried, stewed for a long prolonged period, and cooled to make the fish tender enough to consume together with all its bones. [3] Also, crucian carp is used to make soup with tofu, which is believed by Chinese to benefit woman in postpartum period.

Pictures

References

FAO 2005 - FAO Fishstats.

  1. ^ http://www.visserslatijn.nl/specimenhunting/index.html
  2. ^ Nilsson,P.A.;Brönmark,C:Petterson,L.B. - 2004- Benefits of a predator-induced morphology in crucian carp - Oecologia - Springer Berlin / Heidelberg ISSN 0029-8549 (Print) 1432-1939 (Online) - Issue Volume 104, Number 3 / November, 1995 - Pages 291-296
  3. ^ Lee, Jesse (2008), 上海味兒, 旗林文化, ISBN 978-986-6655-14-2 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!