Overview

Comprehensive Description

Biology

Adults inhabit reef, weed, and rubble areas on shallow coral reefs (Ref. 43248, 48637), commonly found in seagrasses (Ref. 58881). Major food items include amphipods, polychaetes and molluscs (Ref. 58881). Oviparous (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Kenya
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa to Fiji, north to the Ryukyu Islands, south to New South Wales (Australia). Recently recorded from Tonga (Ref. 53797).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 27 - 30; Analspines: 0; Analsoft rays: 26 - 29
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max. size

12.0 cm TL (male/unsexed; (Ref. 43248))
  • Hutchins, J.B. 2001 Monacanthidae. Filefishes (leatherjackets). p. 3929-3947. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome.   http://www.fishbase.org/references/FBRefSummary.php?id=43248 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 22 specimens in 1 taxon.
Water temperature and chemistry ranges based on 17 samples.

Environmental ranges
  Depth range (m): 0.61 - 23
  Temperature range (°C): 27.630 - 28.973
  Nitrate (umol/L): 0.049 - 0.288
  Salinity (PPS): 33.532 - 34.788
  Oxygen (ml/l): 4.509 - 4.591
  Phosphate (umol/l): 0.085 - 0.226
  Silicate (umol/l): 0.882 - 1.579

Graphical representation

Depth range (m): 0.61 - 23

Temperature range (°C): 27.630 - 28.973

Nitrate (umol/L): 0.049 - 0.288

Salinity (PPS): 33.532 - 34.788

Oxygen (ml/l): 4.509 - 4.591

Phosphate (umol/l): 0.085 - 0.226

Silicate (umol/l): 0.882 - 1.579
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 2 - 15 m (Ref. 48637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Adults inhabit sand and seagrass areas of protected lagoon reefs (Ref. 37816). Larval forms occur in mangrove waters (Ref. 43081). Major food items include amphipods, seaweeds, seagrasses, polychaetes and molluscs (Ref. 58881).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acreichthys tomentosus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC6299-09|NC_011950|Acreichthys tomentosus| ACCCGTTGACTCTTTTCAACCAATCACAAAGATATCGGCACCCTTTATATGATTTTTGGTGCCTGAGCCGGAATAGTAGGAACTGCCTTG---AGCCTTCTAATCCGAGCAGAACTAAGCCAGCCCGGCGCTCTTCTTGGAGAC---GACCAGATTTATAATGTAATCGTAACAGCTCATGCTTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTTGGAAACTGACTGATCCCCCTAATA---ATCGGAGCCCCTGACATAGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTTCTTCCTCCATCCTTCTTGCTCTTACTTGCATCCTCAGGGGTCGAAGCTGGGGCCGGTACCGGATGAACTGTTTACCCTCCCCTTGCAGGCAATCTCGCACATGCAGGAGCATCTGTAGACCTG---ACAATTTTTTCACTCCACTTGGCTGGTATTTCTTCAATTTTAGGTGCTATTAATTTTATTACCACCATTATTAACATGAAGCCTCCCGCTATTTCTCAATATCAAACACCCTTATTTGTATGAGCTGTTCTTATTACCGCCGTTCTACTTCTACTCTCACTACCCGTTCTCGCCGCA---GGAATCACTATACTTTTAACCGATCGAAATTTAAATACTACATTCTTTGACCCCGCAGGAGGAGGTGACCCCATTCTGTACCAACACTTATTCTGATTCTTTGGACACCCTGAAGTGTATATTCTTATTTTACCGGGCTTTGGGATGATTTCGCATATTGTAGCATACTACTCAGGTAAAAAA---GAACCTTTCGGTTACATGGGCATGGTGTGAGCAATAATGGCCATTGGCCTCCTTGGTTTTATTGTCTGAGCTCACCACATGTTTACAGTGGGCATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acreichthys tomentosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!