Overview

Comprehensive Description

Biology

Occur mainly in freshwater in large rivers, reservoirs, lakes, swamps, temporary floodwater pools, etc., but adults also found in brackish or saline water of estuaries or bays, preferring quieter open waters. Juveniles are found in great abundance well upstream from brackish water (Ref. 39041). Very young individuals apparently never enter brackish water (Ref. 38947). Larvae are most abundant in surface waters both day and night (Ref. 4639). A herbivorous filter-feeder almost entirely. Breed near the surface in freshwater from late winter (mid-March) through most of the summer (at least to about mid-August). The adhesive eggs sink. Used to some extent as fertilizer and cattle food (Ref. 188).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Dorosoma cepedianum thrives in rivers, streams, reservoirs and lakes in the mid to eastern region of the United States and the middle and south of Canada around the Great Lakes. It can also be found all the way down to central Mexico and Florida.

(Murdy et al. 1997)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Northwest Atlantic: North America and Gulf of Mexico drainage (S.E. South Dakota and central Minnesota, Great Lakes drainage, i.e. in Lake Erie, southern parts of Lakes Huron and Michigan, Lake Ontario basin; not Lake Superior; southernmost New York southward to the Mississippi system and to Gulf southward to Río Pánuco, Mexico. 50°N to 45°N
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: St. Lawrence-Great Lakes, Mississippi River, Atlantic, and Gulf drainages from Quebec to North Dakota and New Mexico, south to central Florida and Mexico; introduced outside native range; common (Page and Burr 1991). Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Atlantic: North America and Gulf of Mexico drainage (southeast South Dakota and central Minnesota, Great Lakes drainage, i.e. in Lake Erie, southern parts of Lakes Huron and Michigan, Lake Ontario basin; not Lake Superior; southernmost New York southward to the Mississippi system and to Gulf southward to Río Pánuco, Mexico.
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

D. cepedianum grows to be about nine to fourteen inches long as an adult, and only four inches long as a juvenile. Usually, the adult eventually grows to be about two pounds.

D. cepedianum juvenile has a different appearance than the adult. The juvenile has a dark spot on its shoulder, but this marking fades as the fish grows. The adult's body is oblong shaped and is laterally compressed. It is usually silvery blue dorsally, silver on the sides, and dusky white ventrally. The last ray of the dorsal fin rays is long and thin; it resembles a whip. Its caudal fin has a deep fork in it. Its head is rounded and blunt on the front and its mouth is subterminal. Like many fish, there are no teeth. This fish has no lateral line.

(Konrad 2001)

Average mass: 1089 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 15; Analspines: 0; Analsoft rays: 25 - 36; Vertebrae: 47 - 51
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 35 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 520 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

57.0 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 1,980 g (Ref. 40637); max. reported age: 10 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body moderately deep; belly with 17 to 20 - 10 to 14 scutes. Mouth small; lower jaw short. Last dorsal fin ray long, about equal to distance from snout tip to mid-pectoral fin or beyond; anal fin long. Scales small, somewhat irregular. A dark spot behind gill opening. Gill rakers fine and numerous (Ref. 188). Branchiostegal rays 6 (Ref. 4639). Silvery to brassy, with a bluish back. Stomach thick-walled, gizzard-like (Ref. 7251).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Dorosoma cepedianum
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Jordan
Year Collected: 1882
Locality: Galveston, Texas., Galveston County, Texas, United States, Gulf of Mexico, Atlantic
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

This is mostly a freshwater fish, usually living in lakes, ponds, rivers, streams, and reservoirs. However, it lives in the Chesapeake Bay, and there it is anadromous, meaning it lives in both salty and freshwaters. In the bay, it spends most of the time in the salty lower region, and migrates up the bay to the freshwater regions to breed in the spring. This fish prefers brakish, not densely vegetated areas of deep waters to live as adults, and juveniles live in the more clear and shallower waters when they are calm. The lakes that D. cepedianum occupy are mostly soft-bottomed with a lot of mud and sediment. The ideal temperature for gizzard shad to live in is between 50 and 70 degrees F, or 10 and 21 degrees C. If the temperature drops to around 2 or 3 degrees C, D. cepedianum will die.

(Konrad 2001, Lippson 1997)

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Occur mainly in freshwater in large rivers, reservoirs, lakes, swamps, temporary floodwater pools, etc., but adults also found in brackish or saline water of estuaries or bays, preferring quieter open waters. Juveniles are found in great abundance well upstream from brackish water.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.2 - 18.5

Graphical representation

Depth range (m): 0.2 - 18.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Medium to large rivers, reservoirs, lakes, swamps, bays, sloughs, and similar quiet open waters, from clear to very silty; an open water species; often ascends creeks and small rivers that have well-developed pools; commonly enters brackish water (Page and Burr 1991). Juveniles occur in quiet surface waters, adults in deeper water or near bottom (Sublette et al. 1990). Spawns in shallow water usually over sandy/rocky substrates; eggs scattered, adhere to objects (Sublette et al. 1990). May ascend smaller streams or ditches to spawn. Has spawned in 1 m of water over sandy rocky bar in Lake Erie (Becker 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-neritic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range ? - 33 m (Ref. 39020)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

An adult D. cepedianum is primarily an omnivore. It is a filter feeder using the 190 rakers on the first gill arch's lower limb. It feeds mostly on phytoplankton and zooplankton, such as perphyton, chrysophyta, and rotifera. Since this fish filters the surrounding water and sediment for food, it also ingests and digests detritus. The substance on the freshwater bed is known as ausfwulchs assemblage, which is what gizzard shad feed on. Sediment and sand are also ingested by the gizzard shad that helps it to digest food in its muscular gizzard.

(Klingel 1990, Konrad 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found mainly in large rivers, reservoirs (Ref. 10294, 46977), lakes, swamps, temporary floodwater pools, etc., but adults also found in brackish or saline water of estuaries or bays, preferring quieter open waters. Filter-feeding, almost entirely herbivorous; the food is strained by the numerous fine gillrakers. Shifts from particulate to filter feeding at about 2.5 cm SL (Ref. 46977). Juveniles feed primarily on copepods and cladocerans while adults eat phytoplankton and zooplankton (Ref. 10294).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Juveniles are nonvisual planktivores, taking protozoans, small crustaceans, Chlorophyta, and Chrysophyta (Sublette et al. 1990). Adults primarily bottom filter-feeding detritivores; eat large quantities of material from aufwuchs assemblage, especially from littoral areas; also takes phytoplankton in open water (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Aeromonosis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Travels in schools. Important source of food for piscivorous fishes and for certain waterfowl (e.g., mergansers) (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Temperature range for spawning: 10°C-28.9°C (Ref. 39042), usually most active above 18°C (Ref. 862, 3742).
  • Whitehead, P.J.P. 1985 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (suborder Clupeioidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/1):1-303. Rome: FAO. (Ref. 188)   http://www.fishbase.org/references/FBRefSummary.php?id=188&speccode=24 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
10.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

D. cepedianum reproduces like many fish and even mammals do: one female mates with many males to ensure fertilization. The female is prolific. She mates randomly and does not stay around to care for her young. Gizzard shad reproduce during spawning season, which is in the spring between late April and early August. They mate nocturnally. Also, they prefer to spawn over sandy and rocky substrates so the eggs will have a surface to adhere to once they are laid. Furthermore, the temperature of the water should be around 21 degrees Celsius for optimum breeding conditions. The fish will spawn in shallow water, usually less than 1.2 meters deep. After mating, up to 400,000 eggs are released in the shallow, clear, and calm waters of the freshwater environment. The D. cepedianum incubation period is two to four days, depending on the water temperature and environmental conditions. The young hatch in the larval stage, develop into the juvenile stage, and then on to the adult stage. The young reach sexual maurity after one year. Breeding is random, so there is no social system to D. cepedianum spawning.

(Klingel 1990, SCBASS Federation 2001)

Average age at sexual or reproductive maturity (male)

Sex: male:
730 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
730 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns at night, spring to summer. Eggs hatch in about 2-4 days. Sexually mature usually in 2-3 years. Life span generally about 4-6 years; few survive beyond age III (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dorosoma cepedianum

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1785-06|NC_008107|Dorosoma cepedianum| ACACGTTGATTTTTCTCAACCAATCATAAAGATATTGGCACCCTTTATCTAGTATTCGGTGCCTGAGCGGGGATAGTAGGGACCGCCCTA---AGCCTCCTAATTCGAGCAGAATTAAGCCAACCTGGGGCGCTTCTTGGAGAC---GACCAGATCTACAATGTTATCGTTACGGCACATGCCTTCGTAATGATTTTCTTCATAGTAATACCAATCCTGATTGGAGGATTTGGAAACTGGCTCGTCCCCCTAATG---ATCGGAGCACCCGATATGGCATTCCCACGAATGAATAATATGAGCTTTTGACTCCTGCCGCCTTCTTTCCTTCTTCTTCTAGCTTCCTCAGGGGTGGAAGCCGGAGCAGGGACAGGATGAACAGTGTACCCCCCTCTATCGGGCAATCTGGCTCACGCCGGAGCATCCGTAGACCTG---ACTATTTTTTCACTTCATCTTGCGGGTATCTCATCAATTCTTGGGGCAATTAATTTTATTACCACAATTATTAACATGAAGCCCCCCGCAATCTCACAATACCAGACGCCCCTATTTGTCTGATCTGTCCTTGTGACTGCCGTCCTCCTTCTCCTCTCTCTCCCAGTTCTGGCCGCC---GGAATTACTATACTACTTACGGACCGAAATCTAAACACAACTTTCTTTGACCCCGCAGGTGGAGGAGACCCCATCCTGTACCAGCACCTATTCTGATTCTTTGGTCACCCAGAAGTCTATATTCTTATTCTCCCAGGCTTCGGAATGATTTCTCACATCGTAGCCTACTACGCCGGGAAAAAA---GAACCTTTTGGTTACATAGGAATGGTCTGAGCAATAATGGCCATCGGGCTGCTAGGCTTCATCGTTTGAGCCCACCACATGTTTACGGTGGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dorosoma cepedianum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Species: 27
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Gizzard shad are currently not in any need of special protections.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Generally, D. cepedianum is viewed as a trash fish that is simply a nuisance. Not many sports fish eat the adult gizzard shad. Actually, the only fishes that do eat this fish are catfish and striped bass. The young shad is usually in competition with the valuable sports fishes that co-exist in the same habitat. In fact, one study shows that D. cepedianum eats young crappie (a more valuable fish) in Texan reservoirs. This factor decreases the gizzard shad's usefulness to humans.

(Drenner 1990, Konrad 2001, SCBASS Federation 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Humans use D. cepedianum as bait to catch larger fish. This fish is sold as a basic live or cut bait. Also, larger pelagic sport fishes eat gizzard shad, which keeps the human sportfishing industry up.

(Bonds 1998, SCBASS 2001)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; bait: usually; price category: Utilized as bait fish.; price reliability: low
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American gizzard shad

The American gizzard shad, Dorosoma cepedianum, is a fish of the herring family Clupeidae native to fresh and salt waters of eastern North America.

Like other gizzard shads, the body is deep somewhat forward of the middle. It is a grayish or silvery blue above, becoming silver on the sides and white below. The dorsal fin has 10-12 rays; in adults, the last ray is very long, extending beyond the rest of the fin. The caudal fin is deeply forked. They can reach a length of 22.5 inches (57 cm), and weigh up to 4.37 lbs (1980 grams).

American gizzard shad begin life feeding on zooplankton, using their teeth to catch them. At about 1 inch in length, they lose the teeth, become deeper-bodied, develop the muscular gizzard, and become filter feeders, consuming both small invertebrates and phytoplankton, as well as some sand for the gizzard.

They live in a variety of open waters, both clear and silty, including rivers, swamps, lakes, and bays, typically near the surface. They avoid fast-moving water, But have been witnessed in large schools near, and under, dams, warm water outlets, and turbine outflows.

Native range extends from the Great Lakes and St. Lawrence River area west to eastern South Dakota and central New Mexico, as well as to the Gulf of Mexico, where it has been found as far south as Rio Panuco in Mexico.

The specific epithet cepedianum honors French naturalist Bernard Germain de Lacépède (1756-1825).

Forage Fish Controversy

Gizzard shad are a preferred food of the largemouth bass, an economically important sport fish, and they reproduce rapidly. For this reason, it is widely believed that bass fishing is best where gizzard shad are abundant. Indeed, the smaller threadfin shad is a key player in Southern lakes that produce "trophy" bass. However, the practice of introducing gizzard shad to improve bass fishing is controversial.

Gizzard shad do provide large bass with a steady supply of quality food. They grow faster than bluegill and are easier for bass to swallow, so large bass (approx. five pounds or larger) benefit from shad introduction. Also, by providing bass with alternate prey, they reduce predatory pressure on young bluegill.

However, in public lakes with heavy fishing pressure, gizzard shad are of questionable value. They grow quickly and can easily grow too large for most bass to swallow, so their value as a forage fish is limited. They also compete with hatchling bass for food, reducing their survival rate and preventing many from growing to "replace" the legal-size bass kept by fishermen. If sufficient food is available (e.g., a healthy bluegill population), bass do not grow any faster in the presence of shad.

Although bluegill enjoy reduced predatory pressure in the presence of gizzard shad, their young also compete with shad for food. As a result, they grow more slowly; it takes four years for a hatchling bluegill to reach six inches in length when gizzard shad are present, compared with three years in the absence of shad.

Gizzard shad contribute to eutrophication, both by fertilizing algae with their copious feces and by preying on "grazing" zooplankton that normally feed on algae.

In spite of the possible benefits to trophy-size bass, gizzard shad generally have a negative effect on sport fish. Most wildlife management agencies try to prevent their spread. Using them as live bait is illegal in most public lakes, and deliberately introducing any fish into a public body of water is illegal as well.

References

  • William F. Sigler and John W. Sigler, Fishes of Utah (University of Utah Press, 1996), pp. 59–62
  • Froese, Rainer, and Daniel Pauly, eds. (2006). "Dorosoma cepedianum" in FishBase. October 2006 version.
  • Doug Keller, "The Truth about Shad." Outdoor Indiana, May/June 2006, pp. 37–39.
  • "Stocking Gizzard Shad for Trophy Bass," Kedric Nutt. Retrieved 3/14/2008.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!