Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits rubble substrates in channels between sheltered inner reefs or in deep sandy lagoons around coral patches (Ref. 48637). Generally uncommon species (Ref. 9710) that inhabits coral reefs and flat bottoms in coastal areas. Feeds on benthic invertebrates.
  • Matsuura, K. 2001 Ostraciidae. Boxfishes. p. 3948-3951. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9806)   http://www.fishbase.org/references/FBRefSummary.php?id=9806&speccode=6399 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa to Indonesia, north to southern Japan, south to northern Australia.
  • Matsuura, K. 2001 Ostraciidae. Boxfishes. p. 3948-3951. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9806)   http://www.fishbase.org/references/FBRefSummary.php?id=9806&speccode=6399 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 9; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 350 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

35.0 cm TL (male/unsexed; (Ref. 9806))
  • Matsuura, K. 2001 Ostraciidae. Boxfishes. p. 3948-3951. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9806)   http://www.fishbase.org/references/FBRefSummary.php?id=9806&speccode=6399 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Has a large protuberance on the snout.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 35 - 50m.
From 35 to 50 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 35 - 50 m (Ref. 9806)
  • Matsuura, K. 2001 Ostraciidae. Boxfishes. p. 3948-3951. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9806)   http://www.fishbase.org/references/FBRefSummary.php?id=9806&speccode=6399 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 49 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 18 - 71
  Temperature range (°C): 24.821 - 28.342
  Nitrate (umol/L): 0.172 - 2.763
  Salinity (PPS): 34.492 - 35.116
  Oxygen (ml/l): 4.107 - 4.693
  Phosphate (umol/l): 0.152 - 0.316
  Silicate (umol/l): 3.271 - 5.767

Graphical representation

Depth range (m): 18 - 71

Temperature range (°C): 24.821 - 28.342

Nitrate (umol/L): 0.172 - 2.763

Salinity (PPS): 34.492 - 35.116

Oxygen (ml/l): 4.107 - 4.693

Phosphate (umol/l): 0.152 - 0.316

Silicate (umol/l): 3.271 - 5.767
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Generally uncommon species (Ref. 9710) that inhabits coral reefs and flat bottoms in coastal areas. Feeds on benthic invertebrates.
  • Matsuura, K. 2001 Ostraciidae. Boxfishes. p. 3948-3951. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9806)   http://www.fishbase.org/references/FBRefSummary.php?id=9806&speccode=6399 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ostracion rhinorhynchos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTATTTAGTATTTGGTGCTTGAGCCNGTATAGTGGGAACGGCCCTAAGCCTACTTATCCGAGCAGAACTAAGCCAACCAGGCGCTCTTCTTGGGGACGATCAAATTTATAATGTAATCGTAACAGCACATGCATTTGTAATAATCTTCTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAACTGACTAGTACCTCTAATAATTGGAGCCCCTGATATAGCATTTCCCCGAATAAATAACATAAGCTTCTGGCTCCTTCCCCCTTCCTTCCTCCTCCTCCTAGCCTCTTCAGGAGTTGAAGCAGGTGCTGGAACTGGATGAACAGTCTATCCCCCCTTAGCAGGTAACCTGGCACATGCAGGAGCATCTGTAGATCTAACCATCTTTTCTCTCCACCTAGCAGGTGTTTCCTCAATTTTAGGGGCTATTAATTTCATTACCACAATTATTAACATAAAACCCCCAGCTATCTCCCAATATCAAACCCCTCTATTTGTGTGGGCAGTACTGATTACCGCTGTCCTCCTCCTTCTATCACTGCCAGTTCTTGCTGCTGGTATTACAATACTTCTAACAGACCGAAACCTAAACACCACATTCTTTGACCCGGCAGGGGGTGGGGACCCAATCCTTTATCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ostracion rhinorhynchos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: potential
  • Matsuura, K. 2001 Ostraciidae. Boxfishes. p. 3948-3951. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9806)   http://www.fishbase.org/references/FBRefSummary.php?id=9806&speccode=6399 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Ostracion rhinorhynchos

Ostracion rhinorhynchos is a species of boxfish commonly known as the horn-nosed boxfish[1] or trunkfish.[2] It was first described by Pieter Bleeker in 1851. It is found in the Indo-West Pacific, where it inhabits coral reefs and eats benthic invertebrates.[1]

References[edit]

  1. ^ a b "Ostracion rhinorhynchos". Fishbase. Retrieved 2013-06-19. 
  2. ^ "Ostracion rhinorhynchos". Encyclopedia of Life. Retrieved 2013-06-19. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!