Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Feeds on fishes (Ref. 5213).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Natal in South Africa to northern Madagascar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific (scattered localities).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Anal spines: 0; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 4108))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits deep waters and feeds on fishes (Ref. 5213). At present, there is no special fishery for this species (Ref. 3461).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Light to dark brown above, lighter below; pectorals and median fins pigmented as adjacent areas on body, anal fin darker distally, soft dorsal and caudal with interradial membranes lightly pigmented or unpigmented (Ref. 4108).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

bathydemersal; marine; depth range 200 - 600 m (Ref. 4108)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 98.7552 - 645
  Temperature range (°C): 10.401 - 11.948
  Nitrate (umol/L): 15.221 - 18.010
  Salinity (PPS): 34.925 - 35.067
  Oxygen (ml/l): 4.349 - 4.372
  Phosphate (umol/l): 1.172 - 1.353
  Silicate (umol/l): 9.148 - 15.325

Graphical representation

Depth range (m): 98.7552 - 645

Temperature range (°C): 10.401 - 11.948

Nitrate (umol/L): 15.221 - 18.010

Salinity (PPS): 34.925 - 35.067

Oxygen (ml/l): 4.349 - 4.372

Phosphate (umol/l): 1.172 - 1.353

Silicate (umol/l): 9.148 - 15.325
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 200 - 600m.
From 200 to 600 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lophiodes insidiator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACTTAATCTTTGGTGCTTGAGCCGGAATAGTAGGCACCGCCCTCAGCCTACTCATTCGGGCTGAACTAAGCCAACCTGGCGCCCTCCTGGGGGATGACCAGATTTATAATGTAATTGTTACTGCCCACGCCTTCGTAATAATTTTCTTCATAGTTATGCCTATTATAATCGGGGGCTTCGGAAACTGACTTATCCCCCTGATAATCGGGGCTCCGGATATGGCTTTCCCTCGAATGAATAACATGAGCTTCTGGCTTCTCCCCCCCTCCTTTCTTCTACTCCTTGCTTCTTCTGGCGTAGAAGCGGGAGCTGGAACTGGGTGGACAGTATACCCCCCCTTAGCAGGCAACCTTGCACACGCTGGTGCCTCTGTAGACTTAACCATTTTTTCCCTCCACCTGGCTGGAATCTCATCGATCCTCGGTGCTATCAACTTTATTACAACAATTATTAACATGAAACCCCCGACTATCTCACAGTATCAAACCCCCCTATTTGTGTGAGCTGTACTAATTACGGCAGTCCTTCTCCTTCTATCCCTACCAGTGCTTGCCGCTGGCATTACGATGCTTCTAACAGACCGAAACTTAAACACCACTTTCTTTGACCCTACGGGAGGGGGGGACCCCATTCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lophiodes insidiator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!