Overview

Comprehensive Description

Biology

Often found in outer reef areas. Larvae are encountered in surface waters of 26.3° to 31°C and 26.9 to 35 ppt. Feeds primarily on fishes with smaller quantities of penaeid shrimps and squids. Large schools have been found to migrate over considerable distances along the Atlantic US coast, water temperature permitting. It is an important species for recreational, commercial, and artisanal fisheries throughout its range. Most of the catch is processed into steaks or sold fresh, or sometimes canned and salted. Also prepared smoked and frozen (Ref. 9987). Potentially ciguatoxic in certain areas (Ref. 9710). Sometimes called "Kingfish" (Ref. 13442).
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p. (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Scomberomorus cavalla, like other scombrid fishes, is elongate, compressed and fusiform. It grows to approximately0.9 - 1.7 m (3 - 5.6 feet) in length and weighs as much as 45 kg (99 pounds). Body color is typically dark blue to black dorsally, with iridescent areas of blue and green. The sides are silver to whitish in color. Young specimens are marked laterally with yellow to yellow-orange spots (Berrien and Finan 1977a), which fade as the animal matures. Two dorsal fins are present, separated by a deep notch between them. A series of 7 - 10 finlets (usually 10) lie posterior to the second dorsal fin and to the anal fin on the ventral surface (Collette and Nauen 1983). The lateral line curves sharply towards the abdomen just below the second dorsal fin. The caudal peduncle is thin and has a fleshy keel. The caudal fin is lunate. The entire body, with the exception of the pectoral fins is scaled. The mouth is large and set obliquely, with the maxillary reaching to just below the orbit of eye. The jaw bears 30 triangular teeth on each side (Godcharles and Murphy 1986).
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the western Atlantic from Massachusetts, USA to Santa Catarina State, Brazil. A record exists for St. Paul's rocks (Lubbock and Edwards 1981), however this may represent a vagrant as there have been no records in the last 15 years despite close monitoring (Hazin, Lessa and Fredou pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA to São Paulo, Brazil; as strays to the southern Gulf of Maine
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Canada (Ref. 5951) to Massachusetts, USA to São Paulo, Brazil. Eastern Central Atlantic: St. Paul's Rocks (Ref. 13121).
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p. (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The king mackerel inhabits coastal waters from the Gulf of Maine south to Brazil, including the Gulf of Mexico and the Caribbean (Briggs 1958; Godcharles and Murphy 1986). However, the coastal area between Maine and northern Florida is utilized only during the warmest summer months (Collette and Nauen 1983). Large groups of king mackerels aggregate along the coast of North and South Carolina throughout the spring, summer and fall of the year (Godcharles and Murphy 1986). In southern and southeastern Florida, king mackerel are found year-round. Large groups are also observed during summer months in northern areas of the Gulf of Mexico, from Texas through northwestern Florida. It has been reported (Williams and Taylor 1978 in Godcharles and Murphy 1986) that 2 distinct populations of king mackerel apparently exist and migrate separately in the Gulf of Mexico and the western Atlantic. One population, ranges from North Carolina through southeastern Florida, the other ranges from southeastern Florida throughout the northern Gulf of Mexico. This group returns to southern Florida during winter months. Tagging data from these populations is additionally supported by genetic analyses which suggest at least 2 distinct populations (Williams and Godcharles 1983). A third population, which ranges from the Western Gulf of Mexico through Texas and seasonally into Louisiana, has been investigated (DeVries and Grimes 1997). King mackerel are not typically common inside the India River Lagoon or other inland waterways, except near inlets. However, large groups of king mackerel aggregate in the nearshore and offshore waters off east central Florida from Cape Canaveral, Sebastian, Fort Pierce, and Jupiter Inlets (Godcharles and Murphy 1986).
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Massachusetts, USA to São Paulo, Brazil. Eastern Central Atlantic: St. Paul?s Rocks.
  • Bigelow, H. B. and Schroeder,W. C.,1953; Collette, B. B. and C. E. Nauen, 1983; Lubbock, R. and A. Edwards., 1981.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12 - 18; Dorsal soft rays (total): 15 - 18; Analspines: 0; Analsoft rays: 16 - 20; Vertebrae: 41 - 43
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p. (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1840 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

184 cm TL (male/unsexed; (Ref. 9710)); max. published weight: 45.0 kg (Ref. 168); max. reported age: 14 years (Ref. 4949)
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p. (Ref. 168)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Scomberomorus cavalla lives approximately 10 - 11 years. Growth is variable in this species, with individuals of the same length sometimes differing markedly in age. In one study (Johnson et al. 1983), fishes of approximately the same length were aged from 1 - 8 years old. Johnson et al. (1983) reported that females live longer than males and grow faster after the third year. The oldest female collected was 14 years old and measured 1.4 m (4.6 feet). The oldest male collected was 12 years old and measured 0.98 m (3.2 feet).
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 184 cm TL (male/unsexed); max. weight: 45 kg.
  • Bigelow, H. B. and Schroeder,W. C.,1953; Collette, B. B. and C. E. Nauen, 1983; Lubbock, R. and A. Edwards., 1981.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Interpelvic process small and bifid. Swim bladder absent. Lateral line abruptly curving downward below second dorsal fin. Intestine with 2 folds and 3 limbs. Adults have no black area on the anterior part of the first dorsal fin. Juveniles with bronze spots in 5 or 6 irregular rows. Body entirely covered with scales.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p. (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

King mackerels are potentially confused with both the cero, Scomberomorus regalis, and the Spanish mackerel, S. maculatus. It is easily distinguished from these by its unique lateral line, which curves sharply downward towards the abdomen at the second dorsal fin. King mackerels also grow significantly larger than either the cero or Spanish mackerel.
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is reef-associated and oceanodromous and is often found in outer reef areas. Larvae are encountered in surface waters of 26.3–31°C and 26.9–35 ppt. It feeds primarily on fishes, in particularly clupeids with smaller quantities of penaeid shrimps and squids. It occurs singly or in small groups often in outer reef areas. Large schools have been found to migrate over considerable distances along the Atlantic U.S. coast, water temperature permitting.

In the northwest Atlantic, King Mackerel spawn from May to November, with males maturing between 2–3 years and females between 3–4 years (Beaumariage 1973, Funicane 1986)s. In Puerto Rico, spawning occurs year-round, with a peak from April–August (Figuerola-Fernandez and Torres-Ruiz 2003). In Ceara State, Brazil, spawning occurs from October to March. In the western Gulf of Mexico, spawning is from May to September (McEachran 1980). Longevity can reach 32 years for females and 26 for males (Nobrega and Lessa 2009). Average generation length across the species range has been estimated at nine years (Collette et al. 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Often found in outer reef areas. Larvae are encountered in surface waters of 26.3° to 31°C and 26.9 to 35 ppt.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; oceanodromous (Ref. 51243); marine; depth range 5 - 140 m (Ref. 36484), usually 5 - 15 m (Ref. 40849)
  • Gasparini, J.L. and S.R. Floeter 2001 The shore fishes of Trindade Island, western South Atlantic. J. Nat. Hist. 35:1639-1656. (Ref. 40849)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
  • Willoughby, S., J.D. Neilson and C. Taylor 1999 The depth distribution of exploited reef fish populations off the south and west coasts of Barbados. Proc. Gulf Caribb. Fish Inst. 45:57-68. (Ref. 36484)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1107 specimens in 1 taxon.
Water temperature and chemistry ranges based on 550 samples.

Environmental ranges
  Depth range (m): 0 - 1700
  Temperature range (°C): 4.233 - 27.335
  Nitrate (umol/L): 0.096 - 26.195
  Salinity (PPS): 32.865 - 36.998
  Oxygen (ml/l): 2.706 - 6.156
  Phosphate (umol/l): 0.040 - 1.906
  Silicate (umol/l): 0.756 - 26.748

Graphical representation

Depth range (m): 0 - 1700

Temperature range (°C): 4.233 - 27.335

Nitrate (umol/L): 0.096 - 26.195

Salinity (PPS): 32.865 - 36.998

Oxygen (ml/l): 2.706 - 6.156

Phosphate (umol/l): 0.040 - 1.906

Silicate (umol/l): 0.756 - 26.748
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reef-associated; marine; depth range 120 - 140 m. Often found in outer reef areas. Migrate considerable distances along the Atlantic US coast in, often in large schools, in warm enough waters.
  • Bigelow, H. B. and Schroeder,W. C.,1953; Collette, B. B. and C. E. Nauen, 1983; Lubbock, R. and A. Edwards., 1981.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Often found in outer reef areas. Larvae are encountered in surface waters of 26.3° to 31°C and 26.9 to 35 ppt. Feeds primarily on fishes with smaller quantities of penaeid shrimps and squids. Large schools have been found to migrate over considerable distances along the Atlantic US coast, water temperature permitting. It is an important species for recreational, commercial, and artisanal fisheries throughout its range. Most of the catch is processed into steaks or sold fresh, or sometimes canned and salted. Appears to be present all throughout the year off Louisiana, USA and off the state of Ceará, northeastern Brazil. Migrates over considerable distances along the Atlantic US coast depending on water temperatures. The coastal area from Florida to Massachusetts is inhabited only during the warm months of the year.
  • Collette, B.B. and C.E. Nauen 1983 FAO Species Catalogue. Vol. 2. Scombrids of the world. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. Rome: FAO. FAO Fish. Synop. 125(2):137 p. (Ref. 168)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

King mackerels are pelagic carnivores that feed primarily on crustaceans and estuarine-dependent schooling fishes. Dominant prey types include menhaden (Brevoortia sp.), anchovies (Anchoa sp.) (Godcharles and Murphy 1986), Atlantic thread herring (Opisthnema oglinum) and scaled sardines (Harengula jaguana). King mackerel show a greater preference for invertebrate prey than do Spanish mackerel (Scomberomorus maculatus), a closely related species. Beaumariage (1973) reported that invertebrate prey, particularly squid and shrimp species could comprise as much as 33% of the diet of king mackerel. In east central Florida, Spanish sardines (Sardinella aurita), anchovies (Anchoa spp.), mullet (Mugil spp.), flying fish, drum and jacks constitute the major fish species preyed upon, while squid, nematodes, penaeid shrimp, and isopods are the major invertebrate prey consumed (Godcharles and Murphy 1986).Habitats: Scomberomorus cavalla is primarily found in offshore waters to the edge of the continental shelf. They sometimes occur nearshore in the vicinity of inlets.
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds primarily on fishes with smaller quantities of penaeid shrimps and squids.
  • Bigelow, H. B. and Schroeder,W. C.,1953; Collette, B. B. and C. E. Nauen, 1983; Lubbock, R. and A. Edwards., 1981.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Larvae and juveniles of king mackerel are consumed as prey by species such as the little tunny (Euthynnus alletteratus) and dolphin (Coryphaena hippurus). Larger king mackerel are sought after by the little tunny, bottlenosed dolphins (Tursiops trucatus) (Cato and Prochaska 1976), and various shark species, including the tiger shark (Galeoverdo cuverie), bull shark (Carcharhinus leucas), and dusky shark, (C. obscurus). (Bigelow and Schroeder 1948).
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Caligus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
  • Lin, C.-L. and J.-s. Ho 2002 Two species of siphonostomatoid copepods parasitic on pelagic fishes in Taiwan. J. Fish. Soc. Taiwan 29(4):313-332. (Ref. 48562)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

King mackerels are not abundant inside the IRL, however, they are known to aggregate in large numbers in offshore waters and support a commercial fishery. Locomotion: Though scombrid fishes are known for high performance locomotion, data are limited on the precise mechanisms that enhance their swimming abilities. Thrust is generated with lift-based swimming whereby the narrow caudal peduncle and high, lunate caudal fin produce more than 90% of the thrust, with few significant lateral movements in other areas of the body.It has been hypothesized that the finlets on the posterior dorsal and ventral surfaces of scombrids aid locomotion, and may, in fact, be accessory locomotor structures that act to deflect water longitudinally to the area of the keels, where flow is then accelerated (Walters 1962). A study by Naeun and Lauder (2001) supported this hypothesis and showed that finlets do redirect cross-peduncle flow in the horizontal plane.
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds primarily on fishes with smaller quantities of penaeid shrimps and squids
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male king mackerel mature by 4 years of age after reaching approximately 72 cm (2.4 feet) fork length (FL). Most females mature by 1 year of age, or upon reaching approximately 14 inches FL (Schmidt et al. 1993). Fecundity estimates in king mackerel are best correlated with weight (Finucan et al. unpubl. In: Godcharles and Murphy 1986), with a 0.68 kg, 47cm (1.5 pounds, 1.5 feet) female producing 69,000 eggs, and a 25.6 kg 1,489 mm (56 pounds, 4.9 feet) female producing 12.2 million eggs (Godcharles and Murphy 1986).King mackerel spawn in coastal waters off the Gulf of Mexico and South Atlantic (Dwinnell and Futch 1973) and have an extended spawning season (Beaumariage 1973). Larvae are most commonly collected in surface waters (McEachran et al. 1980) between May and October, peaking in September. Larvae may be collected from northwestern Florida and Texas, as well as from Palm Beach through Cape Canaveral, Florida, Savannah, GA and Cape fear NC. North of Cape Canaveral, larvae were generally found along the 200m depth contour of the continental shelf in the vicinity of the Gulf Stream (Wollam 1970; Burns 1981). Relatively few larvae are collected from either the eastern Gulf of Mexico south of the Yucatan, or from southeastern Florida (Wollam 1970).
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shallow water spawning from May to September, producing planktonic eggs and larvae.
  • Bigelow, H. B. and Schroeder,W. C.,1953; Collette, B. B. and C. E. Nauen, 1983; Lubbock, R. and A. Edwards., 1981.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Growth

Vitellogenic eggs are found in king mackerel from May through October, providing further evidence of a protracted spawning season. Distribution of mean oocyte diameter is bimodal, with the first mode occurring from late May through July. The second mode occurs from late July through August. Spent males, and females lacking vitellogenic eggs are observed from early August through December (Beaumariage 1973).
  • Beaumariage, D.S. 1973. Age, growth, and reproduction of king mackerel, Scomberomorus cavalla, in Florida: Fla. Mar. Res. Publ. 1. 45 pp.
  • Berrien P. and D. Finan. 1977b. Biological and fisheries data on Spanish mackerel, Scomberomorus maculatus (Mitchill). U.S. National MarineFisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep.9. 40 pp.
  • Berrien P. and D. Finan. 197a7. Biological and fisheries data on king mackerel, Scomberomorus cavalla (Cuvier). U.S. National Marine Fisheries Service, Sandy Hook Laboratory, Highlands, NJ. Tech. Ser. Rep. 8. 40 pp.
  • Bigelow, H.B. and W.C. Schroeder. 1948. Fishes of the western north Atlantic (Lancets, cyclostomes, sharks). Sears Foundation for Marine Research, New Haven CT. 546 pp.
  • Briggs, J.C. 1958. A list of Florida fishes and their distribution. Bull. Fla. State Mus. Biol. Sci. 2(8). 318 pp.
  • Burns, K.M. 1981. Seasonal and areal distribution of scombrid larvae in the vicinity of Palm Beach, Florida. M.A. Thesis. University of South Florida. Tampa. 66 pp.
  • Collette, B.B. and C.E. Nauen. 1983. FAO Species Catalog. Vol. 2. Scombridsof the World. An annotated and illustrated catalogue of tunas, mackerels, bonitos and related species known to date. FAO Fish. Synop. 125(2). 137 pp.
  • Collette, B.B., J.L. Russo, and L.A. Zavala-Camin. 1978. Scomberomorus brasiliensis, a new species of Spanish mackerel from the western Atlantic. U.S. NMFS Fish. Bull. 76(1): 273-280.
  • DeVries, D.A. and C.B Grimes. 1997. Spatial and temporal variation in age and growth of king mackerel from the southeastern U.S. and Mexico. Fish. Bull. 95:694-708.
  • Dwinell, S.E. and C.R. Futch. 1973. Spanish and king mackerel larvae andjuveniles in the northeastern Gulf of Mexico, June through October, 1969. Fla.Dep. Nat. Res. Mar. Res. Lab. Leafl. Serv. 4(24). 14 pp.
  • Earll, R.E. 1883. The Spanish mackerel, Cybium maculatum (Mitch.), Ag.; its natural history and artificial propagation, with an account of its origin and development of the fishery. Rep. U.S. Comm. Fish Fish. (1880) pt. 8:395-424.
  • Godcharles, M.F. and M.D. Murphy. 1986. Species Profiles: Life histories and environmental requirements of coastal fishes and invertebrates (South Florida) King mackerel and Spanish mackerel. U.S. Fish and Wildlife Service Biological Reports. 82(11.58). U.S Army Corps of Engineers, TR EL-82-4. 18 pp.
  • Hoese, H.D. 1965. Spawning of marine fishes in the Port Aransas, Texas, area as determined by the distribution of young and larvae. Ph. D. Diss. Univer. Texas, Austin. 144 pp.
  • Johnson, A.G., W.A. Fable Jr., M.L. Williams, and L.E. Barger. 1983. Age, growth and mortality of king mackerel , Scomberomorus cavalla, from the Southeastern United States. U.S. NMFS Fish. Bull. 81(1):97-106.
  • Klima, E.F. 1959. Aspects of the biology and fishery for Spanish mackerel, Scomberomorus maculatus (Mitchell), of southern Florida. Fla. Board Conserv. Mar. Res. Lab. Tech. Ser. 27. 39 pp.
  • McEachran, J.D. , J.H. Finucane and L.S. Hall. 1980. Distribution, seasonalityand abundance of king and Spanish mackerel larvae in the northwestern Gulf of Mexico (Pisces: Scombridae). Northeast Gulf Sci. 4(1):1-16.
  • Muro, I.S.R. 1943. Revisions of Australian species of Scomberomorus. Mem. Queensl. Mus. 12(21):65-69.
  • National Marine Fisheries Service. 2005. Annual commercial landings statistics. http://www.st.nmfs.gov/st1/commercial/index.html
  • Nauen, J.C. and G.V. Lauder. 2001. Locomotion in scombrid fishes: visualization of flow around the caudal peduncle and finlets of the chub mackerel Scomber japonicus. Journal of Experimental Biology. 204:2251- 2263.
  • Naughton, S.P. and C.H. Saloman. 1981. Stomach contents of juveniles of king mackerel (Scombromorus cavalla) and Spanish mackerel (S. maculatus). Northeast Gulf Sci. 5(1):71-74.
  • Powell, D. 1975. Age, growth and reproduction in Florida stocks of Spanish mackerel, Scomberomus, maculatus. Fla. Mar. Res. Publ. 5. 21 pp.
  • Skow,L.C. and M.E. Chittenden Jr. 1981. Difference in hemoglobin phenotypes among Spanish mackerel, Scomberomorus maculatus. Northeast Gulf Sci. 5(1):67-70.
  • Smith, H.M. 1907. The fishes of North Carolina. N.C. Geol. Econ. Surv. 2. 433 pp.
  • Springer, V.G. and K.D. Woodburn, 1960. An ecological study of the fishes of the Tampa Bay area. Fla. Board Conserv. Mar. Res. Lab. Prof. Pap. Ser. 1. 104 pp.
  • Walters, V. 1962. Body form and swimming performance in the scombrid fishes.Am. Zool. 2:143-149.
  • Williams, R.O. and R. G. Taylor. 1978. King mackerel tagging and stockassessment study (unpl.) Completion report to Natl. Marine Fisheries Service,Florida DNR. PL 88-309: Project No. 2-254-r. 70 pp.
  • Williams, R.O. and R. G. Taylor. 1980. The effect of water temperature and winter air temperature on springtime migrations of king mackerel in the vicinity of Tampa Bay, Florida. Fla. Sci. 43(suppl):26. (abstr).
  • Wollam, M.B. 1970. Description and distribution of larvae and early juveniles ofking mackerel, Scomberomorus cavalla (Cuvier), and Spanish mackerel, S.maculatus (Mitchill); (Pisces:Scombridae); in the Western North Atlantic. Fla.Dept. Nat. Res. Lab. Tech. Serv. 61. 35 pp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Scomberomorus cavalla

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTTTATCTAGTATTTGGTGCATGAGCTGGAATAGTTGGCACAGCCCTAAGCCTACTTATCCGAGCTGAACTAAGCCAACCAGGAGCCCTTCTTGGGGAC---GACCAAATCTACAACGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATCATGATCGGGGGGTTTGGAAACTGACTGATTCCCCTAATGATTGGGGCCCCTGACATAGCATTCCCCCGAATGAACAACATGAGTTTTTGACTTCTACCCCCTTCCTTCCTCCTACTCCTGGCCTCTTCTGGAGTTGAAGCCGGGGCTGGCACTGGTTGAACAGTCTATCCCCCTCTCGCCGGAAACTTAGCCCACGCGGGAGCATCCGTTGATTTAACCATCTTTTCCCTCCACTTAGCAGGAATTTCTTCAATCCTGGGAGCAATCAATTTCATCACAACAATTATTAACATAAAACCCCCAGCCATTTCTCAGTACCAAACACCCCTGTTTGTGTGAGCCGTCCTTATTACAGCCGTCCTCCTTCTCCTATCACTACCGGTCCTTGCTGCCGGCATCACAATGCTTCTTACAGACCGAAATTTAAATACAACCTTCTTCGATCCAGCAGGGGGAGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGCCACCCCGAAGTCTATATTCTTATCCTTCCCGGATTCGGAATAATTTCCCACATCGTTGCCTACTACTCTGGTAAAAAAGAACCTTTCGGGTATATGGGTATAGTGTGAGCCATGATGGCCATCGGCCTACTAGGTTTCATTGTTTGAGCCCATCACATGTTTACAGTAGGAATGGATGTAGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Scomberomorus cavalla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Amorim, A.F., Boustany, A., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Fox, W., Fredou, F.L., Graves, J., Viera Hazin, F.H., Juan Jorda, M., Minte Vera, C., Miyabe, N., Nelson, R., Oxenford, H., Teixeira Lessa, R.P. & Pires Ferreira Travassos, P.E.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
The species is under a conservative management regime in the north Atlantic, and recent landings appear stable throughout its range. There may be some local depletions, however the global population is estimated to be stable. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Total catch for this species in the Atlantic is probably underestimated due to reporting of unclassified Scombermorus species captures as well as the probably inadequate reporting for artisanal and recreational catches (Manooch 1979). In the 1980s there was a marked increase in reported landings of all small tuna species combined compared to previous years, reaching a peak of about 139,412 t in 1988. Reported landings for 1989–1995 decreased to approximately 92,637 t, and since then values have oscillated, with a minimum of 69,895 t in 1993 and a maximum of 123,600 t in 2005. Declared catches were 79,228 t in 2006 and 74,087 t in 2007. A preliminary estimate of the total nominal landings of small tunas in 2008 is 55,876 t. The 2008 preliminary catch of small tuna amounted to 55,876 t, of which 3,755 t was King mackerel (STECF 2009). There are more than 10 species of small tunas, but only five of these account for about 88% of the total reported catch by weight. These five species are: Atlantic Bonito (Sarda sarda), Frigate Tuna (Auxis thazard) which may include some catches of Bullet Tuna (Auxis rochei), Little Tunny (Euthynnus alletteratus), King Mackerel (Scomberomorus cavalla), and Atlantic Spanish Mackerel (Scomberomorus maculatus) (ICCAT 2009).

Tagging efforts in the 1970s and 1980s indicated that there are three migratory groups of King Mackerel in United States waters: a western Gulf of Mexico, Eastern Gulf of Mexico, and Atlantic (Johnson et al. 1994, Sheppard et al. 2010). Since there are no genetic differences between the two Gulf of Mexico populations, the species is managed as two migratory stocks: Gulf of Mexico and the southeastern US coast (Gold et al. 2002). Winter migrations occur from both stocks to south Florida where the mixed stock is targeted by a winter fishery. The south US Atlantic stock contributes a significant percentage of landings in the winter mixing zone (Clardy et al. 2008). In the 1980s, this species was considered overfished throughout its US range. The Gulf of Mexico population which has experienced an estimated 2.5-fold increase in spawning stock biomass since the early 1990s displayed a decline in size-at-age for ages 2–7, while the Atlantic population, which has experienced an approximately 45 decline in estimated spawning stock biomass over the same time period, displayed an increase in size-at-age for ages 4–10 (Shepard et al. 2010). Posterior management measures have been effective in rebuilding the stocks to currently healthy levels. The estimated spawning stock biomass (SSB) is currently higher than the SSB maximum sustainable yeild (MSY) and F is lower than FMSY for both the US south Atlantic and Gulf of Mexico stocks (SEDAR 2009, Ortiz 2004). In the U.S., estimates of the SSB for the U.S. South Atlantic stock have declined, ranging from a peak of 12.8 million fish in 1981/82 to 5.9 million in 2001/02. For the Gulf of Mexico stock, the SSB has generally increased from 4 million fish in 1984/85 to 17.2 million in 2006/07 (NFMS SAR 2009). However, this species is considered to have recovered to a healthy level in the U.S.

In northeast Brazil, it is considered near fully exploited (Lessa et al. 2009). Preliminary stock assessment efforts in Trinidad conclude that the stock may be overfished (Hogarth and Martin 2006).

In the U.S., estimates of the SSB for the U.S. South Atlantic stock has declined, ranging from a peak of 12.8 million fish in 1981/82 to 5.9 million in 2001/02. For the Gulf of Mexico stock, the SSB has generally increased from 4 million fish in 1984/85 to 17.2 million in 2006/07 (NFMS SAR 2009).

Between 1976 and 2004, the weight landed in northeastern Brazil (from the state of Piauí to the state of Bahia) rose from 10.9% to 29% (mean=19.4%) of the total catch throughout its entire area of occurrence (Nóbrega and Lessa 2009). The states of Ceará (1,579 t) and Bahia (541 t) contributed the largest volumes in the northeastern region, accounting for 59% and 20.2% of the overall catch, respectively (Nóbrega and Lessa 2009). In northeastern Brazil Lessa et al. (2009) assessed the exploitation status of the stock and estimated a mean annual biomass of 12,742 t for a mean yield of 3,307 t/year, indicating that, despite being underexploited, the stock is near its maximal exploitation limit.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This is a commercial species caught with purse seines, gillnet, hook and line and other methods. It is an important species for recreational, commercial, and artisanal fisheries throughout its range. It is potentially ciguatoxic in certain areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is managed in the U.S. under the Fishery Management Plan for Coastal Migratory Pelagic Resources. The management bodies are the South Atlantic Fishery Management Council (SAFMC) and the Gulf of Mexico Fishery Management Council (GMFMC). The management plan establishes a number of conservation measures that have helped to recuperate king mackerel fisheries including determine quotas, bag limits and trip limits. Drift gill nets were banned in 1989. Size limit in commercial and recreational fisheries is 24 inches fork length (FL).

There are no specific conservation measure in place in Brazil, however there is a restriction on the length of gillnets which may not exceed 2.5 km. This is poorly enforced. The distribution of this species in Brazilian waters may coincide with some marine protected areas where further fishing regulations may apply.

In Trinidad, fishing effort is not controlled. There are regulations to specify the maximum length and depth and minimum mesh size for gillnets (11 cm). Similar regulations are imposed for seines, with maximum dimensions for the nets and minimum mesh size requirements (Martin and Nowlis 2004).

In the Bahamas, fishing for this species is allowed only with hook and line. Each vessel may have a maximum of six poles. Any migratory fishery resource that is caught shall not in total consist of more than six Kingfish, Dolphin, Tuna or Wahoo per vessel and any resource not intended to be used shall not be injured unnecessarily but be returned to the sea alive.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • Food and Agriculture Organization of the United Nations 1992 FAO yearbook 1990. Fishery statistics. Catches and landings. FAO Fish. Ser. (38). FAO Stat. Ser. 70:(105):647 p. (Ref. 4931)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

King mackerel

The king mackerel (Scomberomorus cavalla) is a migratory species of mackerel of the western Atlantic Ocean and Gulf of Mexico. It is an important species to both the commercial and recreational fishing industries.

Description[edit]

The king mackerel is a medium-sized fish, typically encountered from five to 14 kg (30 lb), but is known to exceed 40 kg (90 lb). The entire body is covered with very small, hardly visible, loosely attached scales. The first (spiny) dorsal fin is entirely colorless and is normally folded back into a body groove, as are the pelvic fins. The lateral line starts high on the shoulder, dips abruptly at mid-body and then continues as a wavy horizontal line to the tail. Coloration is olive on the back, fading to silver with a rosy iridescence on the sides, fading to white on the belly. Fish under 5 kg (10 lb) show yellowish-brown spots on the flanks, somewhat smaller than the spots of the Atlantic Spanish mackerel, Scomberomorus maculatus. Its cutting-edged teeth are large, uniform, closely spaced and flattened from side to side. These teeth look very similar to those of the bluefish, Pomatomus saltatrix.

Distribution and habitat[edit]

The king mackerel is a subtropical species of the Atlantic Coast of the Americas. Common in the coastal zone from North Carolina to Brazil, it occurs as far south as Rio de Janeiro, and occasionally as far north as the Gulf of Maine. Nonetheless, a preference for water temperatures in the range of 20 to 29 °C (68 to 84 °F) may limit distribution.

King mackerel commonly occur in depths of 12–45 m (40–150 ft), where the principal fisheries occur. Larger kings (heavier than 9 kg or 20 lb) often occur inshore, in the mouths of inlets and harbors, and occasionally even at the 180 m (590 ft) depths at the edge of the Gulf Stream.

Migration patterns[edit]

A male king mackerel, about 6 kg (13 lb).

At least two migratory groups of king mackerel have been found to exist off the American coast. A Gulf of Mexico group ranges from the Texas coast in summer to the middle-east coast of Florida from November through March. Spawning occurs throughout the summer off the northern Gulf Coast.

An Atlantic group is abundant off North Carolina in spring and fall. This group migrates to southeast Florida, where it spawns from May through August, and slowly returns through summer. Apparently, this group winters in deep water off the Carolinas, as tagging studies have shown they are never found off Florida in winter.

Life history[edit]

Eggs and sperm are shed into the sea and their union is by chance. Depending on size, a female may shed from 50,000 to several million eggs over the spawning season. Fertilized eggs hatch in about 24 hours. The newly hatched larva is about 2.5 mm (0.098 in) long with a large yolk sack. Little is known about king mackerel in their first year of life. Yearling fish typically attain an average weight of 1.4–1.8 kg (3.1–4.0 lb) and a fork length of 60 cm (24 in). At age seven, females average 10 kg (22 lb), males 5 kg (11 lb). King mackerel may attain 40 kg (88 lb), but any over 7 kg (15 lb) is almost certainly a female.

Feeding habits[edit]

King mackerel are voracious, opportunistic carnivores. Their prey depends on their size. Depending on area and season, they favor squid, menhaden and other sardine-like fish (Clupeidae), jacks (Carangidae), cutlassfish (Trichiuridae), weakfish (Sciaenidae), grunts (Haemulidae), striped anchovies (Engraulidae), cigar minnows, threadfin, northern mackerel and (blue runners).

Fisheries[edit]

Commercial capture of king mackerel in tonnes from 1950 to 2009

Fishing gear and methods[edit]

King mackerel are among the most sought-after gamefish throughout their range from North Carolina to Texas. Known throughout the sportfishing world for their blistering runs, the king mackerel matches its distant relative, the wahoo, in speed. They are taken mostly by trolling, using various live and dead baitfish, spoons, jigs and other artificial lures. Commercial gear consists of run-around gill nets. They are also taken commercially by trolling with large planers, heavy tackle and lures similar to those used by sport fishers. Typically when using live bait, two hooks are tied to a strong metal leader. The first may be a treble or single and is hooked through the live bait's nose and/or mouth. The second hook (treble hook) is placed through the top of the fish's back or allowed to swing free. This must be done because king mackerel commonly bite the tail section of a bait fish. When trolling for kings using this method, it is important to make sure the baitfish are swimming properly. Typical tackle includes a conventional or spinning reel capable of holding 340 m (370 yd) of 13 kg (29 lb) test monofilament and a 2 m (6 ft 7 in), 13 kg (29 lb) class rod.

Several organizations have found success in promoting tournament events for this species because of their popularity as a sport fish. The most notable are the Southern Kingfish Association (SKA) and the FLW Outdoors tour. These events are covered in several outdoors publications, both in print and online.

As food[edit]

Processing[edit]

As of 2005, king mackerel are primarily marketed fresh. They may be sold as fillets, steaks, or in the round (whole). Their raw flesh is grayish, due to its high fat content. They are best prepared by broiling, frying, baking or, especially for large "smoker" king, by smoking.

Nutrition[edit]

Main article: Mercury in fish

According to the United States Food and Drug Administration, king mackerel is one of four fishes, along with swordfish, shark, and tilefish, that children and pregnant women should avoid due to high levels of methylmercury found in these fish and the consequent risk of mercury poisoning.[1]

Similar species[edit]

Small king mackerel are similar in appearance to Atlantic Spanish mackerel, Scomberomorus maculatus, and cero mackerel, Scomberomorus regalis, all three species being similar in shape and coloration. They may be distinguished as follows:

The lateral line on Atlantic Spanish mackerel and cero slopes gradually from the top edge of the gill to the tail. In contrast, that of the king mackerel takes an abrupt drop at mid-body (see illustration).

The first (spiny) dorsal fin on Atlantic Spanish mackerel and cero has a prominent black patch. The king mackerel does not. As all three species normally keep the first dorsal folded back in a body groove, this difference is not immediately evident.

Atlantic Spanish mackerel have prominent yellow spots on the flanks at all sizes. In addition to such spots, cero have one or more yellow stripes along the centerline. Young king mackerel have similar, but slightly smaller spots, these fade away on individuals weighing over 5 kg (10 lb), but may still be seen as slightly darker green spots toward the back from some angles of view.

Worldwide, many fish of these three species are quite similar to one or another. Off Mexico, Atlantic Spanish mackerel may be confused with Serra Spanish mackerel, Scomberomorus brasiliensis.

Notes[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!