Overview

Comprehensive Description

Biology

Inhabit oceanic and coastal areas, but mainly on the continental shelf (Ref. 1371). Although often classified as demersal, the distribution and behavior suggest a largely pelagic existence (Ref. 1371). Adults live in large schools in waters overlying the continental shelf and slope except during the spawning season when they are found several hundred miles seaward (Ref. 1371). A nocturnal feeder (Ref. 6885) that feed on a variety of fishes and invertebrates (Ref. 1371). Important prey for sea lions and small cetaceans (Ref. 2850); also prey of dogfish (Ref. 11384).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: hake (English), Merluza (Espanol)
 
Merluccius productus (Ayres, 1855)

Pacific hake,     North-Pacific hake



Elongate, compressed, tapering to a narrow tail base; head relatively short (24.7-28.9% of SL) and flattened, with a V shape crest on top; large eyes and mouth, lower jaw slightly projecting; jaw teeth long, strong and pointed, in 2 irregular rows; teeth on center but not sides of roof of mouth; 18-23 gill rakers; 2 separate dorsal fins, the 1st  shorter and triangular (I, 9-12), the 2nd  with a long base and partly divided by a notch, 39-44 rays; anal fin similar to 2nd  dorsal fin, 39-44; well developed, non filamentous pelvic fins, 7 rays, situated before the pectorals; tail fin short, slightly forked; scales small, 125-144 on the lateral line.


Silvery above, whitish below.

Size: 91cm.

Habitat: pelagic.

Depth: 12-1400 m.

Oregon to and throughout the Gulf of California; the Revillagigedos

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, FAO fishing area 77, North East Pacific, North Pacific, San Francisco
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: northern Vancouver Island, Canada to northern part of the Gulf of California. A record from the Gulf of Alaska is doubtful.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The geographic range of this species in the eastern Pacific extends from Oregon to the Gulf of California. It is found also in Revillagigedo islands, and possibly into southern Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern North Pacific: Asia to Alaska and to Gulf of California (possiblu further south).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 12 (S) - 1400 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 48 - 56; Analspines: 0; Analsoft rays: 40 - 43
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 91.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 910 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

91.0 cm TL (male/unsexed; (Ref. 1371)); max. published weight: 1,190 g (Ref. 4883); max. reported age: 16 years (Ref. 56527)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Head rather short. Pectoral fin tips usually reaching to or beyond the origin of anal fin. Caudal fin always concave. Color silvery on back grading to whitish ventrally.
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; brackish; marine; depth range 0 - 1000 m (Ref. 9316), usually ? - 229 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a pelagic fish that inhabits oceanic and coastal areas, but is mainly found on the continental shelf and although often classified as demersal, the distribution and behavior suggest a largely pelagic existence. Adults live in large schools in waters overlying the continental shelf and slope, except during the spawning season when they are found several hundred miles seaward. It is found at depths from 12-1400 m. This species is a nocturnal feeder that preys on a variety of fishes and invertebrates (Cohen et al. 1990).

Growth is relatively fast, especially during the first four years and can live up to 15 years. It begins to mature at three years of age and most individuals are mature by four years and at about 35 to 42 cm total length.

This fish is a pelagic spawner, females laying, depending on their size, 80,000 to 500,000 eggs. Spawning occurs mainly in deep waters off southern California and Baja California in the winter and spring (from January to April or June). This hake migrates northward to southern Oregon in the summer and autumn (from July to September), and begins to return by December. The northward migration is accompanied by movement towards the shore and into shallower water, while the southward migration is accompanied by movement into deeper water and seaward (FAO-FIGIS, 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4591 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2139 samples.

Environmental ranges
  Depth range (m): 3 - 3014.5
  Temperature range (°C): 1.634 - 22.948
  Nitrate (umol/L): 2.687 - 44.916
  Salinity (PPS): 32.561 - 35.311
  Oxygen (ml/l): 0.303 - 5.506
  Phosphate (umol/l): 0.885 - 3.485
  Silicate (umol/l): 7.399 - 169.201

Graphical representation

Depth range (m): 3 - 3014.5

Temperature range (°C): 1.634 - 22.948

Nitrate (umol/L): 2.687 - 44.916

Salinity (PPS): 32.561 - 35.311

Oxygen (ml/l): 0.303 - 5.506

Phosphate (umol/l): 0.885 - 3.485

Silicate (umol/l): 7.399 - 169.201
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 1000m.
Recorded at 1000 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Near Surface, Mid Water, Near Bottom, Water column only

Habitat: Water column

FishBase Habitat: Bathypelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Merluccius productus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGCACCCTCTATCTCGTATTTGGTGCTTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATCCGAGCAGAACTTAGTCAACCAGGCGCACTCCTGGGCGACGATCAAATTTATAACGTAATCGTCACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCGTTAATAATTGGGGGCTTTGGAAACTGACTCGTCCCCCTAATGATCGGAGCCCCCGACATAGCCTTCCCCCGAATAAATAACATAAGCTTCTGACTTCTCCCTCCATCTTTCCTGCTCCTTCTAGCATCTTCCGGAGTAGAAGCCGGGGCCGGGACAGGTTGAACAGTATATCCCCCTCTCGCAAGCAATCTTGCCCACGCTGGCGCCAGCGTGGACCTCACTATTTTCTCACTTCACTTAGCAGGCGTTTCCTCAATTCTGGGAGCAATTAATTTTATTACTACTATTATCAATATGAAGCCCCCTGCAATCTCACAATACCAGACACCCCTCTTTGTTTGATCCGTACTTATTACAGCTGTTCTTCTCCTACTCTCCCTGCCCGTCTTAGCCGCCGGCATCACAATACTACTAACTGACCGAAACCTCAACACCTCCTTCTTTGACCCCGCCGGAGGGGGAGACCCCATCCTATACCAGCACTTATTCTGATTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Merluccius productus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Iwamoto, T., Eschmeyer, W., Alvarado, J., Bussing, W.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Justification
This species has a wide distribution, no major threats, and occurs in Marine Protected Areas. Therefore, it is listed as Least Concern. Monitoring for this species should be carried out.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No population data is available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
The species is a valuable commercial fish, and has been highly exploited.
This is a highly commercial species used for fishmeal. The harvesting of this species is mainly in the USA, from 100,000 to 500,000 t. Since the inception of the USSR, (hake fisheries totaled 133,667 t in 1966) this species has been an important constituent of distant-water fisheries. Most of the US harvest was used for fish meal and pet food, while the Soviet harvest was frozen for human consumption as soon as they were caught (this hake tends to become soft and less palatable from two to four hours after being caught). The harvest reported to the FAO in 1995 totaled 177,117 t (all taken by the USA and almost exclusively from area 67, northeast Pacific). Since 1966, the harvests have had substantial decreases, in 1980 (57,086 t) and in 1991-92 (31,413 and 56,231 t). The total catch reported for this species to the FAO for 1999 was 217,000 t. The countries with the largest harvests were the USA (216,889 t) and Mexico (111 t).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In California the species has management plans. This species' distribution includes a number of Marine Protected Areas in the Pacific region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

North Pacific hake

The North Pacific hake, Pacific hake, or Pacific whiting, Merluccius productus, is a merluccid hake of the genus Merluccius, found in the north east Pacific Ocean from northern Vancouver Island to the northern part of the Gulf of California.

Contents

Description

Its length is about 3 ft (90 cm) and they live up to 15 years. Coloration is metallic silver-gray with black speckling and pure silvery white on the belly. North Pacific hake have two dorsal fins and a truncate caudal fin. Their pectoral fin tips usually reach to or beyond the origin of anal fin. The caudal fin is always concave.

Reproduction

The North Pacific hake spawns from January to June. North Pacific hake may spawn more than once per season, so absolute fecundity is difficult to determine. Historically, inshore female Pacific hake matured at 15 inches (37 cm) and 4 to 5 years of age. Currently, length at 50% maturity for females in the Port Susan North Pacific hake population is approximately 8.5 inches (21.5 cm), compared to 11.7 inches (29.8 cm) in the 1980s. Females mature at 3 to 4 years of age and 13.4 to 15.75 inches (34-40 cm) and nearly all males are mature by age 3 and as small as 11 inches (28 cm).

Ecology

They occur from the surface to depths of 1,000 m (3,300 ft). North Pacific hake are nocturnal feeders that undergo diel vertical migrations off the bottom in order to feed on a variety of fishes and invertebrates. Its diet includes shrimp, plankton and smaller fishes. They are an important prey item for sea lions, small cetaceans, and dogfish sharks.

There are three recognized stocks of Pacific hake: a highly migratory offshore (or coastal) stock that ranges from southern California to Queen Charlotte Sound, a central-south Puget Sound stock, and a Strait of Georgia (SOG) stock. The offshore North Pacific hake stock spawned off south-central California to Baja California in the winter months of January and February during the 1960s, 1970s and 1980s.[1][2] In spring and summer adults migrated northward to feed to as far as central Vancouver Island (and as far as Queen Charlotte Sound in some years). In the fall, adults migrated southward toward spawning grounds. Since the early 1990s a percentage of the offshore stock has remained off the west coast of Canada year round and some Pacific hake have been observed spawning off the west coast of Vancouver Island.[2] Resident Pacific hake in Puget Sound spawn in Port Susan and Dabob Bay from February through April. The SOG resident stock aggregates to spawn in the deep basins of the south-central Strait of Georgia where peak spawning occurs from March to May.

Fisheries

Pacific whiting supports one of the most important commercial fisheries off the West Coast of the United States. There are three recognized stocks of Pacific whiting: a highly migratory offshore (or coastal) stock that ranges from southern Baja California to Queen Charlotte Sound, a central-south Puget Sound stock, and a Strait of Georgia stock. The latter two stocks are managed by state and local management agencies, but the offshore, or coastal, fishery in U.S. waters is managed by the Pacific Fishery Management Council (PFMC) through its Pacific Coast Groundfish Fishery Management Plan (FMP).

Originally approved in 1982, the Groundfish FMP now manages over 90 different species through a number of measures, including harvest guidelines, quotas, trip and landing limits, area restrictions, seasonal closures, and gear restrictions (like minimum mesh size for nets). Annual quotas are the primary management tool used to limit the catch of whiting. Pacific whiting was declared overfished by the U.S. government in 2002. The stock was declared rebuilt and no longer depleted in 2004. The coast-wide (U.S. and Canada) Pacific whiting stock is assessed annually by a joint technical team of scientists from both countries.

In 2003, the United States and Canada signed an agreement that allocates a set percentage of the Pacific whiting catch to American and Canadian fishermen over the next decade and established a process for the review of science and the development of management recommendations. Beginning in late 2007, management of Pacific whiting and related science activities will be coordinated under the provisions of this international treaty with Canada.

The Marine Stewardship Council (www.MSC.org) certified the midwater Pacific Hake (whiting) fishery as sustainable on 21 October, 2009.

The local and state-managed Puget Sound and Strait of Georgia stocks are "species of concern" - species that NOAA Fisheries Service has concerns about regarding population status and threats but has insufficient information to indicate a need to list the species under the Endangered Species Act. There has been no directed commercial fishery for this stock since 1991.

Conservation

Overharvesting is the main threat to North Pacific hake. The National Marine Fisheries Service received a petition to list the North Pacific hake under the Endangered Species Act (ESA). The petition was denied on 24 November 2000 (65 FR 70514) but concerns and uncertainties remained. During the review for ESA listing, the Georgia Basin distinct population segment was identified to include both the Puget Sound and Strait of Georgia stocks. The Georgia Basin DPS of the North Pacific hake (called Pacific hake by NMFS) was made a U.S. National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the Endangered Species Act.

The expanding range of the Humboldt squid is also a cause for concern. Humboldt squid are voracious predators of hake and can substantially reduce their populations.[3]

References

  1. ^ Methot and Dorn 1995.
  2. ^ a b McFarlane et al. 2000.
  3. ^ Zeidberg, Louis D.; Robison, Bruce H. (2007), "Invasive range expansion by the Humboldt squid, Dosidicus gigas, in the eastern North Pacific", PNAS 104 (31): 12948–12950, doi:10.1073/pnas.0702043104, PMC 1937572, PMID 17646649

Further reading

  • McFarlane, G. A.; King, J. R. & Beamish, R. J. (2000), "Have there been recent changes in climate? Ask the fish", Progr. Oceanogr. 47 (2–4): 147–169, doi:10.1016/S0079-6611(00)00034-3.
  • Methot, R. D. & Dorn, M. W. (1995), "Biology and fisheries of North Pacific hake (Merluccius productus)", in Alheit, J. & Pitcher, T. J., Hake: Biology, fisheries and markets, London: Chapman & Hall, pp. 389–414.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!