Overview

Comprehensive Description

Biology

Oceanic species found in schools (Ref. 2850). Nerito-pelagic (Ref. 58426). Adults feed on planktonic crustaceans, copepods, euphausiids, amphipods, marine worms, and small fishes (Ref. 6885, 35388). Mature individuals move inshore in large schools to spawn (Ref. 2850). In the spring large spawning shoals migrate toward the coasts, males usually arrive first. Often entering brackish and freshwater (Ref. 37812). Semelparous (Ref. 51846). Produces 6,000-12,000 adhesive eggs. Females are valued for their roe, males are utilized as fishmeal. Marketed canned and frozen; eaten fried and dried (Ref. 9988). Possibly to 725 m depth (Ref. 6793).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: This circumboreal-Arctic species ranges from the Beaufort Sea to the Strait of Juan de Fuca in the eastern Pacific Ocean, across southern Arctic Canada, and south in the western Atlantic to Cape Cod, Massachusetts. In the western Pacific, the range extends to Japan and Korea, Sea of Okhotsk (Mecklenburg et al. 2002). Five independent stocks likely in the Bering Sea (Naumenko 1996), 4 or 5 stocks are believed to occur off Newfoundland in the Atlantic Ocean (Carscadden 1981, Nakashima 1992). This species is often associated with the polar ice edge.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Hudson Bay to Gulf of Maine
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar in Northern Hemisphere.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumpolar in the Arctic. North Atlantic: Barents Sea up to Bear Island, in the White and Norwegian seas, off the coast of Greenland up to 74°N and from Hudson Bay in Canada to Gulf of Maine, USA. North Pacific: south to Korea and Juan de Fuca Strait, Canada.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Boreal-Arctic seas, south to the coast of Maine, USA.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Gibbs, R.H., Jr., 1984; Muus, B.J. and J.G. Nielsen, 1999; Pietsch, T.W., K. Amaoka, D.E. Stevenson, E.L. MacDonald, B.K. Urbain and J.A. López, 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 14; Analspines: 0; Analsoft rays: 16 - 23; Vertebrae: 62 - 73
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 11626)); 25.2 cm TL (female); max. published weight: 52.0 g (Ref. 56475); max. reported age: 10 years (Ref. 72498)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 20.0 cm TL; 25.2 cm TL (female).
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Gibbs, R.H., Jr., 1984; Muus, B.J. and J.G. Nielsen, 1999; Pietsch, T.W., K. Amaoka, D.E. Stevenson, E.L. MacDonald, B.K. Urbain and J.A. López, 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Adipose with long base, about 1.5 times as long as the orbit or longer, outer margin only slightly curved (Ref. 6885). Olive green on dorsal surface, merging into silvery on sides and ventral surface (Ref. 6885).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Mallotus villosus
Catalog Number: USNM 108150
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): International Fisheries Commission
Year Collected: 1932
Locality: (Alaska: Alaskan Peninsula Off Semidi Island. Group), Alaska, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in cold, deep waters, an oceanic species which moves instream to spawn.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 300m.
Recorded at 300 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; anadromous (Ref. 46888); freshwater; brackish; marine; depth range 0 - 725 m (Ref. 58426)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 8347 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6610 samples.

Environmental ranges
  Depth range (m): 0 - 890
  Temperature range (°C): -2.072 - 10.205
  Nitrate (umol/L): 0.916 - 34.597
  Salinity (PPS): 28.657 - 34.920
  Oxygen (ml/l): 3.207 - 8.596
  Phosphate (umol/l): 0.354 - 2.965
  Silicate (umol/l): 1.599 - 56.187

Graphical representation

Depth range (m): 0 - 890

Temperature range (°C): -2.072 - 10.205

Nitrate (umol/L): 0.916 - 34.597

Salinity (PPS): 28.657 - 34.920

Oxygen (ml/l): 3.207 - 8.596

Phosphate (umol/l): 0.354 - 2.965

Silicate (umol/l): 1.599 - 56.187
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pelagic; marine; depth range to 300 m. Oceanic species found in schools.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Gibbs, R.H., Jr., 1984; Muus, B.J. and J.G. Nielsen, 1999; Pietsch, T.W., K. Amaoka, D.E. Stevenson, E.L. MacDonald, B.K. Urbain and J.A. López, 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Oceanic species found in schools (Ref. 2850). Nerito-pelagic (Ref. 58426). Feeds on planktonic crustaceans, copepods (especially Calanus (Ref. 5951)), euphausiids, amphipods, marine worms, and small fishes (Ref. 6885, 35388). Fish examined were non-spawning adults (Ref. 6885). It is preyed upon by other fishes, birds and marine mammals; Gadus morhua (Atlantic cod) as their chief predator. Parasites of the species include Eubothrium parvum (cestode), Anisakis sp. And Contracaecum sp. (nematodes) and Glugea sp. (protozoan) (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Planktonic crustaceans, copepods, euphausids, amphipods, marine worms, and small fishes.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Gibbs, R.H., Jr., 1984; Muus, B.J. and J.G. Nielsen, 1999; Pietsch, T.W., K. Amaoka, D.E. Stevenson, E.L. MacDonald, B.K. Urbain and J.A. López, 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

caplin is prey of:
Boreogadus saida
Phoca groenlandica
Phoca

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

caplin preys on:
zooplankton

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

>1,000,000 individuals

Comments: The Barents Sea stock is potentially the largest capelin stock in the world, reaching 6-8 million tons in some years (Gjøsæter 1998, Ushakov and Prozorkevich 2002). Various estimates exist for Northeast Pacific stocks: Wolotira et al. (1977) estimated 190 mt (metric tons) for Norton Sound and the southeast Chukchi Sea; Laevastu and Favorite (1978) estimated 4.3 million tons (of primarily capelin and sand lance Ammodytes hexapterus) in the eastern Bering Sea; Trumble (1973) estimated 250,000-500,000 tons for the entire Northeast Pacific stock (calculated as a proportion of the Atlantic stock) and Wespestad (1987) estimated 500,000 mt for the same region in 1986. Biomass estimates from groundfish surveys conducted in the western, central and eastern Gulf of Alaska in 2003 were 18 mt, 2,258 mt, and 298 mt, respectively (Nelson 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on crustaceans, copepods, euphausians, amphipods and small fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Reproductive strategy: synchronous ovarian organization, determinate fecundity (Ref. 51846). Experimental testing suggests facultative semelparity, with offshore-spawning capelin being absolute semelparous (death of both genders) and beach-spawning capelin being iteroparous irrespective of sex (Ref. 92136).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild) Observations: Animals commonly die after first spawning (Patnaik et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In the spring, large spawning schools migrate toward the coasts; males usually arrive first. Often enters brackish and freshwater. Sexually mature at 2 - 5 years and at length of 15 cm.
  • Bigelow, H.B. and W.C. Schroeder, 1953; Eschmeyer, W.N., E.S. Herald and H. Hammann, 1983; Gibbs, R.H., Jr., 1984; Muus, B.J. and J.G. Nielsen, 1999; Pietsch, T.W., K. Amaoka, D.E. Stevenson, E.L. MacDonald, B.K. Urbain and J.A. López, 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mallotus villosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mallotus villosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 35
Specimens with Barcodes: 68
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mallotus villosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Mallotus villosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCAATTACACGCTGATTTTTCTCAACCAACCACAAAGACATTGGCACCCTTTATCTGATCTTTGGGGCCTGGGCAGGAATAGTAGGGACGGCCTTAAGCCTCCTTATCCGAGCCGAGCTGAGCCAACCTGGCGCTCTTCTGGGAGACGACCAGATTTATAATGTTATCGTCACCGCACACGCTTTTGTTATAATCTTTTTTATAGTAATACCCCTCATGATCGGAGGGTTCGGCAACTGGCTAATTCCTCTTATGATCGGGGCCCCAGACATGGCATTCCCACGCATAAATAACATGAGTTTCTGACTTTTACCTCCCTCTTTCCTTCTCCTCTTAGCCTCCTCTGGGGTAGAAGCAGGAGCCGGTACCGGCTGAACGGTTTACCCGCCACTTGCTGGCAATCTCGCTCACGCGGGGGCTTCCGTAGATTTAACCATCTTCTCCCTTCACCTTGCGGGTATCTCCTCTATTCTAGGGGCCATTAATTTCATTACAACTATTATTAACATGAAACCCCCTGCTATTTCTCAGTACCAAACTCCTTTATTTGTTTGAGCTGTACTAATTACAGCCGTTCTTCTTCTACTGTCCCTTCCTGTCTTAGCCGCTGGAATTACAATGCTTCTCACAGACCGAAATCTAAACACCACTTTCTTTGACCCTGCTGGGGGAGGAGATCCTATTCTATATCAGCATTTATTCTGATTCTTCGGGCACCCCGAAGTCTACATCCTAATTCTCCCCGGATTTGGGATAATCTCTCATATTGTTGCCTACTACTCCGGTAAAAAAGAACCATTCGGGTACATGGGCATGGTCTGAGCTATGATGGCTATCGGCCTTCTCGGATTTATTGTTTGAGCCCATCATATGTTTACTGTAGGCATGGACGTTGACACTCGAGCATACTTTACCTCCGCCACAATAATCATCGCCATTCCTACAGGTGTAAAAGTATTCAGCTGACTAGCAACCCTTCATGGAGGCTCAATCAAATGAGAAACCCCTCTTCTTTGAGCCCTGGGTTTCATTTTCTTATTTACAGTAGGAGGATTAACTGGAATTGTTCTAGCCAACTCGTCCCTAGACATTGTACTTCATGACACCTACTATGTTGTAGCTCATTTCCACTACGTTCTCTCTATGGGGGCTGTCTTCGCAATCATCGCTGGTTTCGTCCATTGATTCCCCTTATTTTCAGGATACACCCTCCACAGCACATGAACCAAAATCCACTTCGGGATTATGTTCTTCGGGGTTAATTTAACCTTCTTCCCTCAGCATTTCCTTGGGCTCGCGGGAATGCCACGACGGTATTCTGACTACCCAGACGCCTACACCCTATGAAACACCGTCTCTTCCATTGGGTCTCTGATCTCCCTGGTGGCTGTAATTATGTTCCTCTTTATCCTCTGAGAAGCATTTGCTGCTAAACGAGAAGTCATGTCTGTTGAGCTAACCGCTACAAACGTGGAATGACTTCATGGCTGCCCTCCTCCTTACCACACATTCGAAGAACCGGCATTTGTTCAAGTTCAAGCCAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread and abundant in arctic waters. Barents Sea stock declined sharply in 1984-1986 and again in 1992-1994. Gulf of Alaska stocks have also undergone large fluctuations since the mid-1970s; current trend is apparently stable. Potential threats include ecosystem shifts caused by climate change, overharvest of some stocks, incidental bycatch in fisheries targeting other species, and contamination of spawning habitat (e.g., from oil spills).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Threats include ecosystem shifts caused by climate change, overharvest of some stocks, incidental bycatch in fisheries that target other species, and contamination of spawning habitat (e.g., oil spills).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Research needs include continued study of response to climatic and environmental changes and the importance of Pacific capelin in marine ecosystems. Baseline information is needed on life history and spawning dynamics. In the North Pacific, research is needed on assessing the importance of capelin in marine food webs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; price category: low; price reliability: reliable: based on ex-vessel price for this species
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Capelin

This article is about the fish. For the plant genus, see Mallotus (plant).

The capelin or caplin, Mallotus villosus, is a small forage fish of the smelt family found in the Atlantic and Arctic oceans. In summer, it grazes on dense swarms of plankton at the edge of the ice shelf. Larger capelin also eat a great deal of krill and other crustaceans. Whales, seals, cod, squid, mackerel, beluga whales and seabirds all prey on capelin, in particular during the spawning season of the capelin while it migrates southwards. Capelin spawn on sandy beaches and sandy bottom at the age of 2–6 years, and have an extremely high mortality rate on the beaches after spawning, for males close to 100% mortality.[clarification needed] Males reach 20 cm in length, while females are up to 25 cm long. They are olive-colored dorsally, shading to silver on sides. Males have a translucent ridge on both sides of their bodies. The ventral aspects of the males iridesce reddish at the time of spawn.

Capelin migration[edit]

Migration of Icelandic capelin
Green shade: Feeding area of adults
Blue shade: Distribution of juveniles
Green arrows: Feeding migrations
Blue arrows: Return migrations
Red shade and Red arrows: Spawning migrations, main spawning grounds and larval drift routes
Puffin with capelin

Capelin in the Barents Sea and around Iceland are stocks that perform extensive seasonal migrations. Barents Sea capelin migrate during winter and early spring to the coast of northern Norway (Finnmark) and the Kola Peninsula (Russia) for spawning. During summer and autumn capelin migrate north- and north-eastward for feeding.[1]

Icelandic capelin move inshore in large schools to spawn and migrate in spring and summer to feed in the plankton-rich oceanic area between Iceland, Greenland, and Jan Mayen. Capelin distribution and migration is linked with ocean currents and water masses. Around Iceland, maturing capelin usually undertake extensive northward feeding migrations in spring and summer and the return migration takes place in September to November. The spawning migration starts from north of Iceland in December to January. In a paper published in 2009, researchers from Iceland recounted their application of an interacting particle model to the capelin stock around Iceland, successfully predicting the spawning migration route for 2008.[2]

Reproduction[edit]

As an r-selected species, capelin have a high reproductive potential and an intrinsic population growth rate.[3] They reproduce by spawning and their main spawning season occurs in spring, but can extend into the summer. The majority of capelin are three or four years old when they spawn.[1] The males migrate directly to the shallow water of fjords, where spawning will take place, while the females remain in deeper water until they are completely mature. Once the females are mature, they will migrate to the spawning grounds and spawn.[4] This process usually takes place at night.[1] After the females have spawned, they immediately leave the grounds and will potentially spawn again in the following years if they survive. The males do not leave the spawning grounds and will potentially spawn more than once throughout the season.[4] Male capelin are considered to be semelparous because they die soon after the spawning season is over.[1]

Fisheries[edit]

Global capture of capelin in tonnes reported by the FAO, 1950–2010[5]

Capelin is an important forage fish, and is essential as the key food of the Atlantic cod. The northeast Atlantic cod and capelin fisheries therefore are managed by a multispecies approach developed by the main resource owners Norway and Russia.

In some years with large quantities of herring in the Barents Sea, capelin seem to be heavily affected. Probably both food competition and herring feeding on capelin larvae lead to collapses in the capelin stock. However, in some years there has been good recruitment of capelin despite a high herring biomass, suggesting that herring are only one factor influencing capelin dynamics.

In the provinces of Quebec (particularly in the Gaspé peninsula) and Newfoundland and Labrador in Canada, it is a regular summertime practice[by whom?] to go to the beach and scoop the capelin up in nets or whatever is available, as the capelin "roll in" in the millions each year at the end of June or in early July.[citation needed]

Commercially, capelin is used for fish meal and oil industry products, but is also appreciated as food. The flesh is agreeable in flavor, resembling herring. Capelin roe ("masago") is considered as a high value product. It is also sometimes mixed with wasabi or green food coloring and wasabi flavor and sold as "wasabi caviar". Often, masago is used as a substitute for tobiko, flying fish roe, due to its similarity and taste although the mouthfeel is different due to the individual eggs being smaller and it is less crunchy than tobiko.

Notes[edit]

  1. ^ a b c d Gjøsæter, H. (1998). "The population biology and exploitation of capelin (Mallotus villosus) in the Barents Sea". Sarsia 83: 453–496. doi:10.1080/00364827.1998.10420445. 
  2. ^ Barbaro, A.; Einarsson, B.; Birnir, B.; Sigurthsson, S.; Valdimarsson, H.; Palsson, O. K.; Sveinbjornsson, S.; Sigurthsson, T. (2009). "Modelling and simulations of the migration of pelagic fish". ICES Journal of Marine Science 66 (5): 826. doi:10.1093/icesjms/fsp067.  edit
  3. ^ "Capelin (Mallotus villosus) distribution and climate: a sea 'canary' for marine ecosystem change". ICES Journal of Marine Science 62 (7): 1524–1530. doi:10.1016/j.icesjms.2005.05.008. 
  4. ^ a b "A review of capelin (Mallotus villosus) in Greenland waters". ICES Journal of Marine Science 59 (5): 890–896. doi:10.1006/jmsc.2002.1242. 
  5. ^ Mallotus villosus (Müller, 1776) FAO, Species Fact Sheet. Retrieved April 2012.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Atlantic and Pacific stocks once considered separate species (Mallotus villosus and M. catervarious Pennant, respectively); now considered one species, M. villosus (McAllister 1963). Systematic relationships in the family Osmeridae are debated, but genus Osmerus generally is considered a close relative of Mallotus (Mecklenburg et al. 2002). Russian literature sometimes refers to a Pacific subspecies, M. v. socialis, not generally recognized (Pahlke 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!