Overview

Comprehensive Description

Biology

Inhabit clear to turbid water in shallow as well as deep water (Ref. 4787). Juveniles are found in inshore coral reefs (Ref. 5222). They feed in water to more than 100 m depth (Ref. 27275). It has been suggested that juveniles mimic the herbivorous damselfish Neopomacentrus sindensis, presumably to get closer to their unsuspecting prey (Ref. 5222, 9710). Feed on small fishes and crabs. Probably spawn during restricted periods and form aggregations when doing so (Ref. 27352). Eggs and early larvae are probably pelagic (Ref. 6390).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

General
Epinephelus mulitnotatus is a western Indian Ocean species that is distributed along mainland East Africa and in the island states (Maldives, Mauritius, Seychelles, Madagascar), Persian Gulf and Gulf of Oman and most of the Western Australia coast.

Epinephelus mulitnotatus is not listed in Australia’s Northern Territory Museum records (Barry Russell pers. comm. 30th January 2007)

Genetic sub-populations
Shark Bay, Ningaloo, Pilbara and Broome locations in western Australia recognised as separate stocks from genetic studies which supports the current approach of four separate fisheries management plans for this species (Stephenson et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian Ocean: Persian Gulf to southern Mozambique and eastward to Western Australia. Not known from the Red Sea.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Northern Territory (Australia), north to southern Japan, south to Shark Bay (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 5222)); max. published weight: 9,000 g (Ref. 3132)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Juveniles found in inshore coral reefs, and adults are more common in deeper water. Feeds on small fishes and crabs. It has been suggested that juveniles mimic the herbivorous damselfish @Neopomacentrus sindensis@, presumably to get closer to their unsuspecting prey.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Color is dark purplish gray with scattered irregular whitish spots and blotches which are faint or absent in preserved fish.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Epinephelus mulitnotatus is a reef-associated species found on drop-offs and banks throughout the Seychelles from 10 m to over 100 m (Robinson, pers. comm. 2007), and from deep rocky reefs at 20 to 110 m depths in Western Australia (Stephenson et al. 2001).

Reproduction
Spawning aggregations of Epinephelus mulitnotatus are reported during peak reproductive months (Wheeler and Ommanney 1953, Robinson et al. 2004) and probably non-aggregating spawning at other times (derived from Robinson pers. comm. 2007).

Reproductive seasonality is 12 months, with peak of 3 to 4 months (Aug. to Oct.) when spawning aggregations occur (Robinson et al., in review).

Sex change parameters (sex ratio fished and unfished, size of sex change, type of hermphroditism, etc.): M:F – 1:2.1 (lightly fished, Seychelles, Farquar atoll, Robinson et al. in review).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 100 m (Ref. 4319)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 301 specimens in 1 taxon.
Water temperature and chemistry ranges based on 196 samples.

Environmental ranges
  Depth range (m): 1 - 118
  Temperature range (°C): 23.306 - 28.199
  Nitrate (umol/L): 0.164 - 6.383
  Salinity (PPS): 34.364 - 35.116
  Oxygen (ml/l): 3.725 - 4.701
  Phosphate (umol/l): 0.152 - 0.557
  Silicate (umol/l): 3.229 - 9.429

Graphical representation

Depth range (m): 1 - 118

Temperature range (°C): 23.306 - 28.199

Nitrate (umol/L): 0.164 - 6.383

Salinity (PPS): 34.364 - 35.116

Oxygen (ml/l): 3.725 - 4.701

Phosphate (umol/l): 0.152 - 0.557

Silicate (umol/l): 3.229 - 9.429
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 100m.
From 1 to 100 meters.

Habitat: reef-associated. blotched rockcod.  Peters, 1876 Attains 100 cm. Indian Ocean from southern Mozambique to Pakistan and the Persian Gulf, including Aldabra, Seychelles, Comores, Madagascar, Mauritius and Reunion.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabit clear to turbid water in shallow as well as deep water (Ref. 4787). Juveniles are found in inshore coral reefs (Ref. 5222). They feed in water to more than 100 m depth (Ref. 27275). It has been suggested that juveniles mimic the herbivorous damselfish Neopomacentrus sindensis, presumably to get closer to their unsuspecting prey (Ref. 5222, 9710). Feed on small fishes and crabs. Probably spawn during restricted periods and form aggregations when doing so (Ref. 27352). Eggs and early larvae are probably pelagic (Ref. 6390). Rankin's rock cod feed in water to more than 100 m depth (Ref. 27275). Probably make frequent use of shelters, suggesting an 'ambush' method of feeding (Ref. 6390).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Rock cod are protogynous hermaphrodites.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Epinephelus multinotatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCTGAGCTGAGCCAGCCAGGGGCCCTACTTGGCGACGATCAAATCTATAACGTAATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTTGTACCACTTATAGTCGGCGCCCCAGACATGGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCCCCATCCTTCCTGCTTCTCCTGGCTTCCTCTGGAGTAGAGGCTGGTGCTGGAACTGGCTGAACGGTCTACCCCCCTCTAGCCGGCAACCTGGCCCACGCAGGAGCATCTGTAGACTTAACCATCTTCTCACTTCACTTAGCGGGGGTCTCATCAATTCTAGGAGCAATTAACTTCATTACAACCATTGTCAATATAAAACCCCCAGCCATCTCGCAGTATCAAACACCTTTATTCGTCTGAGCTGTACTAATCACAGCAGTTCTGCTGCTCTTGTCCCTCCCCGTGCTCGCCGCCGGCATTACAATACTTTTAACAGATCGAAACCTCAACACCACTTTCTTTGACCCAGCCGGAGGGGGAGATCCGATTCTCTACCAGCACTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epinephelus multinotatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Samoilys, M., Rocha, L. & Choat, J.H.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
In some parts of its range, there have been declines in Epinephelus multinotatus due to overfishing, (e.g., declining catch rates up to 50 % in fisheries where it is a target species in Seychelles), but it is very widespread and so it is unlikely to have declined as much as 30 % over its whole range and is therefore listed as Least Concern. It is likely to be an uncommon grouper in much of its range. Fisheries management in place only in Seychelles and Western Australia. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
General
Epinephelus mulitnotatus has three separate sub-populations in the Indian Ocean as recognised by Heemstra and Randall (1993) based on differences in colour pattern and scale counts:

1) Western Indian Ocean
2) Persian Gulf and Gulf of Oman
3) Western Australia

Within Western Australia, there are also three separate sub-populations which are all managed individually.

Fisheries dependent
Epinephelus mulitnotatus is relatively abundant in the Seychelles and recorded as the most common of the three groupers taken in the demersal handline fisheries (Mees 1992, MRAG 1996). Populations on the granitic islands are now overfished (Jan Robinson pers. comm. 2007).

Very limited national deeper (>30m) water fisheries occurring in East Africa, though hook and line, seine, traps and trawl are listed for taking groupers in Tanzanian waters. Some illegal foreign fishing vessels trawling the shelf area beyond territorial waters may be taking this species (Samoilys 2004).

E. multinotatus is the most common of the three groupers taken by the whaler and schooner fisheries in Seychelles (Robinson pers comm. 2007).

E. multinotatus is listed as occurring in catches from 2000, 2002, and 2003 from commercial hook and line vessels in Mozambique (Sean Fennessy pers. comm. 2007).

E. multinotatus taken in small-scale artisanal fishery around Réunion, as one of 19 Epinephelus species. Total catches are estimated weights provided by fishers (not very reliable) in mt and have declined from around 20 to 45 mt in 1998 to 2002, to 3 mt in 2004 to 2005, though no effort data are provided (Dominique Miossec, IFREMER, La Réunion, pers comm. January 2007).

Fisheries independent
Densities in shallow strata (<20 m) range from 0 to 0.51 fish/1,000 m², with higher densities found in the Amirantes Isles (Pears 2005).

Possibly uncommon in mainland East Africa - not seen in underwater surveys (to ~20 m depth) along the Kenyan coast (Samoilys 1988, pers. obs), or in southern Tanzania’s Mnazi Bay Ruvuma Estuary Marine Park (Obura 2004), though this may reflect its deeper range.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
General
Overfishing is the greatest threat to Epinephelus multinotatus.

Fisheries dependent
Overfishing of Epinephelus multinotatus is reported from the Mahé plateau, Seychelles by the local whaler and schooner fisheries, though fishing pressure reputedly light in the outer islands and atolls (Robinson pers comm. 2007). Growth overfishing is reported from the trawl fishery in Western Australia (Stephenson et al. 2001). Epinephelus multinotatus is taken in multispecies demersal fisheries in north Western Australia – taken by a trawl fishery in Pilbara region, and by trap and line fisheries in the Broome region, W. Australia (Stephenson et al. 2001). Epinephelus multinotatus is the most heavily fished grouper in Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Fisheries regulations are reasonably well enforced in Seychelles, and increased protection of spawning aggregations for Epinephelus multinotatus and other grouper species is currently under discussion (Robinson et al. in review).

Fisheries management is well established in Western Australia through five separate commercial fishing zones for a mixed demersal fishery which includes E. multinotatus. The management plans are under review considering concerns of growth overfishing. Ningaloo Marine Park which is closed to commercial fishing provides protection to this species (Stephenson et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!