Overview

Comprehensive Description

Biology

Occur in coastal waters, frequently in rocky reefs and occasionally over sandy bottoms (Ref. 9114); often near kelp beds. Juveniles form schools in littoral pools (Ref. 9114). Feed on crustaceans, mollusks and bryozoans. Pelagic spawner (Ref. 56049). Marketed fresh (Ref. 9114).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: sargo (English), burro (Espanol), sargo (Espanol)
 
Anisotremus davidsonii (Steindachner, 1876)


Sargo,     Xanthic sargo



Body deep, compressed, back high; head short, blunt; mouth small, low, ~ horizontal, lips fleshy; inside mouth not red; teeth in bands on jaws, outer ones larger, conical, none on center roof of mouth; a pair of conspicuous pores plus a central groove under the chin; preopercle finely serrated; dorsal continuous but deeply notched, 4th  spine longest, XI-XII, 14-16; anal III, 9-11, 2nd  spine long but not greatly so;  pectoral fins relatively short, not, reaching origin of anal; tail forked; scales moderate to large, rough, over entire body and head except front of snout, lips and chin, on membranes between dorsal and anal soft rays; rear lines of scales oblique rows above lateral line; lateral-line scales 54-62.



Overall silvery with yellowish tinge; a prominent blackish bar on side at level of outer part of pectoral fin; upper margin of operculum black; black spot on outer pectoral base; juveniles have 2-3 blackish stripes on the side and lack a spot at the tail fin base.



Size: attains 60 cm, but common to 30 cm.

Habitat: found on rocky, weed-covered reefs, sometimes forming schools.

Depth: 5-61 m.

Central California to central Baja, the Gulf of California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Central Pacific: Santa Cruz in central California, USA to southern Baja California, Mexico; isolated population in the Gulf of California.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is endemic to the Eastern Pacific, and is found from central California to central Baja, and the northwestern and eastern Gulf of California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 5 (S) - 61 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Size

Length max (cm): 60.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 580 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

58.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 15 years (Ref. 56049)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 40 m (Ref. 2850), usually ? - 8 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This demersal species occurs in coastal waters, frequently in rocky reefs and occasionally over sandy substrate (McKay and Schneider, 1995), often near kelp beds. Juveniles form schools in littoral pools (McKay and Schneider, 1995).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 3 - 10
  Temperature range (°C): 20.583 - 20.583
  Nitrate (umol/L): 0.441 - 0.441
  Salinity (PPS): 34.246 - 34.246
  Oxygen (ml/l): 5.165 - 5.165
  Phosphate (umol/l): 0.472 - 0.472
  Silicate (umol/l): 4.140 - 4.140

Graphical representation

Depth range (m): 3 - 10
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 40m.
Recorded at 40 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Near Bottom, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Reef only, Rocks, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, sponges/seasquirts/bryozoa
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner (Ref. 56049).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anisotremus davidsonii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTCGGTGCTTGGGCTGGGATAGTAGGGACAGCCCTGAGCCTGCTCATCCGAGCAGAACTCAGTCAACCGGGCGCCCTCCTCGGAGACGACCAGATTTATAATGTAATTGTTACTGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATCCTAATCGGAGGATTCGGAAACTGACTTGTTCCTCTTATGATCGGGGCCCCCGACATGGCATTCCCCCGAATAAACAACATGAGCTTCTGGCTCCTCCCACCCTCCTTCCTCCTCCTCCTTGCCTCTTCAGGCGTAGAGGCCGGAGCCGGTACTGGATGGACAGTCTATCCTCCTTTAGCCGGAAACTTAGCTCATGCTGGGGCATCCGTTGACCTAACAATTTTCTCCCTCCACTTAGCAGGTGTCTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATTAACATGAAACCCCCTGCCATCTCCCAGTACCAGACTCCGCTATTTGTATGATCCGTCCTGGTCACAGCCGTTCTTCTCCTACTTTCTCTTCCAGTTCTTGCAGCCGGCATTACAATGCTCCTCACAGATCGAAATCTAAACACCACCTTCTTCGATCCTGCTGGAGGAGGAGACCCCATTCTCTACCAGCACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Anisotremus davidsonii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G., Robertson, R., Lea, B.

Reviewer/s
Carpenter, K., Polidoro, B., Livingstone, S. (Global Marine Species Assessment Team)

Contributor/s

Justification
This species is widespread in the Eastern Pacific, and common in at least part of its range. There are no known major threats to this species, and no current indication of population decline. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is moderately common in southern California.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species. However, this species is an important sport fish (Riedel et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation measures for this species. However, this species distribution falls partially into a number of Marine Protected Areas in the Eastern Pacific region (WDPA 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!