Articles on this page are available in 1 other language: Arabic (15) (learn more)

Overview

Comprehensive Description

Biology

Moderately common in rocky areas and among rubble, often in crevices and shallow caves. Usually lies at rest on the substrate (Ref. 9626). Feeds primarily on small crustaceans, particularly copepods, shrimps and shrimp larvae, crabs and crab larvae as well as polychaetes (Ref. 7510).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: southern Florida and Texas (USA), Bahamas and throughout the Caribbean Sea to Rio de Janeiro, Brazil (Ref. 57756). Eastern Atlantic: St. Helena (?, Randall pers. comm.).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 95 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.5 cm SL (male/unsexed; (Ref. 5288))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

White interspaces between first four dark bars bisected by narrow yellowish brown bars.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 46 m (Ref. 7510)
  • Randall, J.E. 1990 Cirrhitidae. p. 851-852. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 2.   http://www.fishbase.org/references/FBRefSummary.php?id=7510 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 27 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): 3 - 30.5
  Temperature range (°C): 24.203 - 27.684
  Nitrate (umol/L): 0.161 - 1.844
  Salinity (PPS): 35.022 - 36.594
  Oxygen (ml/l): 4.543 - 4.687
  Phosphate (umol/l): 0.046 - 0.176
  Silicate (umol/l): 0.993 - 2.664

Graphical representation

Depth range (m): 3 - 30.5

Temperature range (°C): 24.203 - 27.684

Nitrate (umol/L): 0.161 - 1.844

Salinity (PPS): 35.022 - 36.594

Oxygen (ml/l): 4.543 - 4.687

Phosphate (umol/l): 0.046 - 0.176

Silicate (umol/l): 0.993 - 2.664
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 46m.
From 2 to 46 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Moderately common in rocky areas and among rubble, often in crevices and shallow caves. Usually lies at rest on the substrate (Ref. 9626). Feeds primarily on small crustaceans, particularly copepods, shrimps and shrimp larvae, crabs and crab larvae as well as polychaetes (Ref. 7510). Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblycirrhitus pinos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTGGTATTTGGTGCCTGAGCTGGTATAGTCGGCACAGCTCTTAGCCTTCTTATTCGGGCGGAGCTAAGCCAACCAGGTGCCCTTCTCGGGGACGACCAGATTTACAATGTTATCGTTACTGCGCACGCATTTGTTATAATTTTCTTCATAGTTATGCCAATTATAATTGGAGGCTTCGGGAACTGACTAATTCCTTTAATAATTGGAGCCCCGGACATGGCCTTCCCCCGAATAAATAACATAAGCTTCTGGCTTCTCCCCCCTTCCTTCCTTCTTCTCCTTGCATCTTCTGGCATTGAAGCCGGGGCAGGAACCGGATGGACAGTTTACCCACCTCTAGCGGGCAATCTAGCCCATGCAGGTGCATCAGTTGATCTTACCATCTTCTCGCTACATTTAGCAGGTATCTCCTCTATTTTAGGGGCTATTAACTTTATTACAACTATTATTAATATAAAACCTCCTGCTATTTCCCAATACCAGACCCCTCTGTTCGTATGAGCAGTATTAATTACTGCTGTTCTTCTTCTCCTCTCCCTCCCTGTTCTTGCTGCCGGGATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTCTTCGACCCTGCAGGTGGGGGAGATCCCATTCTTTACCAACACCTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblycirrhitus pinos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amblycirrhitus pinos

The redspotted hawkfish, Amblycirrhitus pinos, is a species of hawkfish found at depths of from 2 to 46 m (6.6 to 151 ft) on tropical reefs in the Western Atlantic. This species can reach a length of 9.5 cm (3.7 in) in standard length. It can also be found in the aquarium trade.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!