Articles on this page are available in 1 other language: Spanish (5) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit vegetated and brushy stream margins and pools of creeks and small to medium rivers, and rocky and vegetated margins of lakes (Ref. 5723). Most commonly found in clear, silt-free rocky streams (Ref. 5723). They feed on small crustaceans, insects and fish (Ref. 30578). An introduced species in Europe which avoids swift waters and occurs in a wide variety of slow-flowing to stagnant waters such as large rivers, lakes, ponds, canals and backwaters (Ref. 59043).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Rock bass are native to the Great Lakes region, the Mississippi Valley, and certain streams on the east side of the Alleghany Mountains. They were imported into Germany and other European countries in 1883.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Native range encompasses St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins, including most of the northeastern United States and adjacent southern Canada; south to Missouri, northern Alabama, and northern Georgia, west to Saskatchewan and the eastern Dakotas. Introduced in many places on Atlantic slope south to Roanoke River, Virginia, and west of native range in Missouri, Arkansas, northeastern Oklahoma, southeastern Kansas, and some western states (Lee et al. 1980, Page and Burr 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Native range encompasses St. Lawrence-Great Lakes, Hudson Bay (Red River), and Mississippi River basins, including most of the northeastern United States and adjacent southern Canada; south to Missouri, northern Alabama, and northern Georgia, west to Saskatchewan and the eastern Dakotas. Introduced in many places on Atlantic slope south to Roanoke River, Virginia, and west of native range in Missouri, Arkansas, northeastern Oklahoma, southeastern Kansas, and some western states (Lee et al. 1980, Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America: St. Lawrence River-Great Lakes, Hudson Bay (Red River), and Mississippi River basins from Quebec to Saskatchewan in Canada, and south to northern Georgia, northern Alabama and Missouri (native only to Meramec River) in the USA (Ref. 5723). Introduced to Europe (Ref. 59043).
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North America; introduced in Europe.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Adult rock-bass usually weigh between 1/2 and 3/4 pounds, occasionally reaching 1 pound, and they have been recorded to weigh 3 pounds. The young grow slowly, averaging 2 inches in length during the first six months. Their dorsal fin is much larger than the anal, with 11 spines and 10 rays; the anal fin has 6 spines and 10 rays. Adults are olive-green on the top, greenish-silvery on the sides and white on the belly. Young are often blotched with black, while adults have a dark spot at the base of each scale, forming stripes. (Bowers, 1903).

Range mass: 0 to 1300 g.

Average mass: 0 g.

Other Physical Features: bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 10 - 13; Dorsal soft rays (total): 11 - 13; Anal spines: 5 - 7; Analsoft rays: 9 - 11; Vertebrae: 29 - 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 22 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 430 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

43.0 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 1,360 g (Ref. 4699); max. reported age: 18 years (Ref. 72462)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Page, L.M. and B.M. Burr 1991 A field guide to freshwater fishes of North America north of Mexico. Houghton Mifflin Company, Boston. 432 p. (Ref. 5723)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Rock bass occupy large lakes, reservoirs, and ponds in the midwest and Mississippi Valley, and they are also found in streams east of the Alleghany Mountains. Rock bass, in the winter months, can be found under ice, yet they can stand a summer temperature as high as 88 degrees F. Though sometimes found in muddy bayous and in waters with decaying vegetation, rock bass thrive best in clear, pure waters well stocked with aquatic plants and small crustacea. (Bowers, 1903).

Aquatic Biomes: lakes and ponds; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes pools and brushy margins in creeks and small to medium rivers (Page and Burr 2011). This bass prefers small, cool, weedy lakes or littoral regions of larger lakes, and streams with typically rocky, always silt-free substrates, permanent flow, low turbidity, and extensive cover (Lee et al. 1980). Spawning occurs in shallow water in shallow depressions made by males in areas as diverse as swamps and gravel shoals; nests may be close together (Scott and Crossman 1973).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Habitat includes pools and brushy margins in creeks and small to medium rivers (Page and Burr 2011). This bass prefers small, cool, weedy lakes or littoral regions of larger lakes, and streams with typically rocky, always silt-free substrates, permanent flow, low turbidity, and extensive cover (Lee et al. 1980). Spawning occurs in shallow water in shallow depressions made by males in areas as diverse as swamps and gravel shoals; nests may be close together (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; pH range: 7.0; dH range: 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 168 specimens in 2 taxa.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0.1 - 11
  Temperature range (°C): 7.970 - 7.970
  Nitrate (umol/L): 4.522 - 4.522
  Salinity (PPS): 32.029 - 32.029
  Oxygen (ml/l): 6.960 - 6.960
  Phosphate (umol/l): 0.673 - 0.673
  Silicate (umol/l): 3.669 - 3.669

Graphical representation

Depth range (m): 0.1 - 11
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The main source of food of this species is aquatic plants. They also feed on small crayfish, minnows, tadpoles, worms, and insects. The food of the young consists of minute animals, mainly crustacea and insects, and also vegetation. Some rock bass become cannibalistic in early life, with the larger eating the smaller. (Bergman, 1942).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits vegetated and brushy stream margins and pools of creeks and small to medium rivers, and rocky and vegetated margins of lakes. Most commonly found in clear, silt-free rocky streams. Feeds on small crustaceans, insects and fish (Ref. 30578).
  • George, E.L. and W.F. Hadley 1979 Food and habitat partitioning between rock bass (Ambloplites rupestris) and smallmouth bass (Micropterus dolomieui) young of the year. Trans. Am. Fish. Soc. 108(3):253-261. (Ref. 30609)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Major foods are crayfish, aquatic and terrestrial insects, and fishes (Manooch 1984). Young eat cladocerans, chironomid and neuropteran larvae, and terrestrial insects. Adults take aquatic insects, crustaceans, mollusks, and small fishes (Sublette et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Ambloplites rupestris (Ambloplites rupestris rock bass juv.) is prey of:
Perca flavescens
Hirundinidae
Micropterus salmoides
Ambloplites rupestris
Pomoxis nigromaculatus
Diacyclops thomasi
Mesocyclops edax

Based on studies in:
USA: Wisconsin, Little Rock Lake (Lake or pond)

This list may not be complete but is based on published studies.
  • Martinez ND (1991) Artifacts or attributes? Effects of resolution on the Little Rock Lake food web. Ecol Monogr 61:367–392
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

  • Martinez ND (1991) Artifacts or attributes? Effects of resolution on the Little Rock Lake food web. Ecol Monogr 61:367–392
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but likely exceeds 1,000,000. This bass is common in much of its range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Adults often aggregate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

The males care about the eggs for about 14 days (Ref. 93240) as well as the young (Ref. 2060). In Europe where it is introduced, males fan and defend the nests, which are shallow depressions in sand or gravel bottom along shallow shores. A male may spawn with several females in one nest and guard the nest until larvae leave the nest (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average lifespan

Status: captivity:
7.0 years.

Average lifespan

Status: captivity:
12.0 years.

Average lifespan

Status: wild:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 18 years Observations: Mortality rate increases with age have been reported for wild populations (Patnaik et al. 1994).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Spawning occurs in spring and early summer, requiring a temperature above 10 degrees celsius. Males make nests in the sand or gravel at a depth of about 1.8 meters. The male cleans the gravel with his caudal fin and tail until every particle is bright. The nest is usually 30 cm in diameter. In the act of spawning, the male and female cross the nest, their stomachs close together, the male a little behind the female, and simultaneously void the eggs and eject the milt. The real act of spawning takes a minute or less. After the female lays the eggs, the male guards the nest. The female may lay 2000 to 10,000 eggs depending on her size. The hatching period takes from one to three weeks. Upon emerging, the young rise in a school and hover over the nest for several days before scattering. The male continues to guard the young during this period. They become sexually mature between 3 and 5 years of age. (Bowers, 1903; Bergman, 1942).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in late spring and early summer; eggs hatch in 3-4 days at 20-21 C; sexually mature at age II-IV (Becker 1983, Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambloplites rupestris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGGGCCGGAATAGTGGGCACAGCCCTAAGCCTACTAATTCGAGCAGAACTTAGCCAACCGGGCGCCCTCCTAGGAGACGACCAGATTTATAATGTAATTGTAACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTCGGCAACTGACTAGTGCCACTAATGATCGGTGCCCCTGACATAGCTTTCCCCCGAATAAATAATATGAGCTTTTGACTCCTCCCCCCCTCTTTCCTCCACCTACTCGCCTCTTCCGGAGTTGAGGCTGGGGCAGGGACTGGATGGACCGTTTACCCTCCTTTAGCCGGCAACCTANCCCACGCAGGTGCATCTGTCGACCTAACCATCTTCTCCCTTCATCTTGCCGGGGTCTCTTCAATTCTAGGGGCCATTAACTTTATTACCACCATTATTAACATAAAACCTCCCGCCATCTCTCAGTACCAAACCCCCCTCTTTGTATGATCAGTTCTAATCACTGCCGTGCTACTTTTACTTTCCCTACCAGTCCTCGCTGCGGGTATTACAATACTCCTAACAGACCGAAATCTAAATACCACATTTTTTGACCCGGCGGGGGGAGGTGACCCCATTCTCTACCAGCACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ambloplites rupestris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

There are 9 genera and 30 species in the bass and sunfish family. Rock bass are one of the most abundant fish in the United States. Their adaptability to extreme temperatures has made their introduction to new areas easier than most other fishes. They have been successfully introduced into the western states of California, Washington and Utah. They have also been transplanted into England, France, Germany, and Finland. The artificial breeding of rock bass, by taking and impregnating the eggs, has not been successful. The eggs can only be stripped with great difficulty, and it is necessary to kill the male to obtain the milt. Also, obtaining the eggs and milt at the same time is difficult. Interruption or handling, even during spawning, prevents the discharge of eggs or milt. Artificial ponds for bass are very common in the midwest and southern states. The water must be at least 6-10 feet deep. (Bowers, 1903).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern in view of the large range extent, large population size, absence of significant declines, and lack of major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in streams and lakes in eastern and central North America; common; no major threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a very large number of occurrences (subpopulations).

Total adult population size is unknown but likely exceeds 1,000,000. This bass is common in much of its range.

Trend over the past 10 years or three generations is uncertain but probably relatively stable.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major threats are known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: No major threats are known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Currently, this species is of relatively low conservation concern and does not require significant additional protection or major management, monitoring, or research actions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

All bass are fine game fishes, with tournaments being held regularly. Because there are so many bass fisherman their abundance is vital. The indirect value of bass fishing in rural districts, in the expenses of visiting sportsman is immense. Bass fisherman spend billions of dollars each year on guides, accommodations, gas, outdoor clothing, meals, tackle, bait, boats, motors, and permits. Their contribution to the economy is more than sportsmen spend on football and baseball combined. It is estimated that 85 percent of licensed anglers fish for bass. (Bauer, 1955)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; gamefish: yes; aquarium: public aquariums
  • International Game Fish Association 1991 World record game fishes. International Game Fish Association, Florida, USA. (Ref. 4699)
  • Nigrelli, R.F. 1959 Longevity of fishes in captivity, with special reference to those kept in the New York Aquarium. p. 212-230. In G.E.W. Wolstehnolmen and M. O'Connor (eds.) Ciba Foundation Colloquium on Ageing: the life span of animals. Vol. 5., Churchill, London. (Ref. 273)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rock bass

The rock bass (Ambloplites rupestris, Ambloplites constellatus), also known as the rock perch, goggle-eye, red eye, is a species of freshwater fish in the sunfish family (Centrarchidae) of order Perciformes. They are similar in appearance to smallmouth bass, but are usually quite a bit smaller. The average rock bass is between 6 and 10 in, and they rarely weigh over a pound. Rock bass are native to the St Lawrence River and Great Lakes system, the upper and middle Mississippi River basin in North America from Québec to Saskatchewan in the north down to Missouri and Arkansas, and throughout the eastern U.S. from New York through Kentucky and Tennessee to the northern portions of Alabama and Georgia and Florida in the south. While fairly good eating cooked fresh, rock bass are generally not regarded by most anglers as a food fish of the quality of bluegill or perch. Fishing with live bait such as nightcrawlers is the most effective method to catch rock bass, although they are often caught with lures while fishing for bass. A. rupestris, the largest and most common of the Ambloplites species, has reached a maximum recorded length of 43 cm (17 in), and a maximum recorded weight of 1.4 kg (3.0 lb).[1] It can live as long as 10 years. These fish have the ability to rapidly change their color to match their surroundings. This chameleon-like trait allows them to thrive throughout their wide range.

Rock bass

The rock bass prefers clear, rocky, and vegetated stream pools and lake margins. Rocky banks of northeastern lakes and reservoirs are a common habitat for rock bass. It is carnivorous, and its diet consists of smaller fish, insects, and crustaceans.

Rock bass can be surprisingly unflustered by the presence of human activity, living under lakeside docks and near swimming areas.

Ambloplites constellatus, a species of rock bass from the Ozark upland of Arkansas, and Ambloplites ariommus are true rock bass, but regarded as separate species.

A. rupestris is sometimes called the redeye or redeye bass in Canada, but this name refers more properly to Micropterus coosae, a distinct species of centrarchid native to parts of the American South. Rafinesque originally assigned the rock bass to Bodianus, a genus of marine wrasses (family Labridae).

In the aquarium[edit]

Rock bass can be kept in aquarium as small as 29 gallons for one however they prefer tanks closer to 55 gallon. Rock bass are similar in disposition to central American cichlids. They can be kept with yellow perch, bluegill, pumpkinseed, green sunfish, smallmouth and largemouth bass not large enough to fit your rock bass in their mouth, convict cichlids, Jack Dempsey Cichlid, Green Terrors, and other fish similar to your rock bass in demeanor. Do not keep your rock bass with fish big enough to fit your fish in its mouth or small enough for your fish to swallow. Aquariums should be decorated with plenty of rockwork and several plants may be appreciated.[citation needed]

References[edit]

  • ITIS: Ambloplites rupestris
  • Ellis, Jack (1993). The Sunfishes-A Fly Fishing Journey of Discovery. Bennington, VT: Abenaki Publishers, Inc. ISBN 0-936644-17-6. 
  • Rice, F. Philip (1964). America's Favorite Fishing-A Complete Guide to Angling for Panfish. New York: Harper Row. 
  • Rice, F. Philip (1984). Panfishing. New York: Stackpole Books. ISBN 0-943822-25-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Ambloplites cavifrons and A. ariommus formerly were included in this species.

Roe et al. (2008) noted that morphological, mitochondrial, and allozyme characters do not allow discrimination between A. rupestris and A. ariommus within the Interior Highlands; this may indicate that A. ariommus never occurred west of the Mississippi River, or it could indicate that if A. ariommus occurred in these drainages, it has now become introgressed with A. rupestris (Roe et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!