Overview

Comprehensive Description

Description: This type shares the characteristic markings of larval and transitional Sparisoma. Recruits become distinct from S. viride early as melanophores extend onto the base of the central caudal fin rays and divide the light bar on the tail. The melanophores extending into the caudal bar extend further below the midline than above (vs. equal above and below in S. chrysopterum/rubripinne). Small juveniles tend to have dark patches along the lateral midline mostly below the level of the lateral line and do not develop an obvious white tail bar. Some individuals develop a marked bicolor pattern of light above the lateral line and dark below. Later juveniles are variably mottled with some light striping and spotting and are only identified by process of exclusion (or DNA sequence analysis). Individuals from Noronha in Brazil show a pattern of reduced body markings and intensified black markings on the fins.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Mostly found in seagrass beds in shallow, protected waters. Feeds primarily on epiphytes and seagrass blades, leaving crescent bite marks. Darts into seagrass when frightened (Ref. 9710).
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found from Florida, Bermuda, Bahamas, eastern Gulf of Mexico, including the Antilles, and Central America to Santa Catarina, Brazil, including Atol das Rocas and Archipelago de Fernando de Noronha (Smith 1997, Carvalho-Filho 1999, Smith-Vaniz et al. 1999, Moura et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda, Florida (USA), Bahamas, and eastern Gulf of Mexico through central America to Santa Catarina, Brazil (Ref. 57756).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 7251))
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Diagnosis: The larvae of all Sparisoma may well be identical, and DNA sequencing is required to identify species. Transitional recruits develop the basic markings probably shared by all members of the genus, but small juveniles of Sparisoma acquire distinct patterns that separate most, if not all, regional species. The DNA sequence of the juvenile specimen from Noronha in Brazil confirms that it is S. radians (Bernardi et al 2005), even though it displays a peculiar pattern of markings. S. atomarium may be indistinguishable from S. radians when juvenile specimens are found in the same habitat.

Creative Commons Attribution 3.0 (CC BY 3.0)

© www.coralreeffish.com by Benjamin Victor

Source: CORALREEFFISH.COM

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Front of upper jaw has horizontal canine-like tusks. 2 scales between bases of pelvic fins (Ref. 26938). Drab-phase fish are olivaceous to yellowish brow, finely speckled with pale dots, many are conjoined; base and axil of pectoral fins broadly blue-green. Terminal-phase males are greenish brown with faint pale dots, some scales with reddish edges; irregular orange-red markings on opercle; a blackish bar at pectoral base; a broad blackish border posteriorly on caudal fin (Ref. 13442).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Sparisoma radians
Catalog Number: USNM 35173
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Key West, Monroe County, Florida, United States, Florida Keys, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Sparisoma radians
Catalog Number: USNM 41734
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Edwards
Locality: Green Turtle Cay (Bahamas), Bahama Islands, Bahamas, Bahamian Archipelago, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Sparisoma radians
Catalog Number: USNM 35174
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Key West, Monroe County, Florida, United States, Florida Keys, Atlantic
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in small schools, forming probable harems. Juveniles and adults inhabit sea grass beds, mangrove areas, and shallow waters to depths of 12 m among soft corals and macro algae, rarely on coral reefs (Humann and DeLoach 2002). In the Brazilian coast, it is more common in tropical and subtropical reefs, and algal beds.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 12 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 48 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 0.3 - 45
  Temperature range (°C): 26.181 - 28.035
  Nitrate (umol/L): 0.161 - 2.722
  Salinity (PPS): 34.447 - 37.096
  Oxygen (ml/l): 4.480 - 4.706
  Phosphate (umol/l): 0.006 - 0.344
  Silicate (umol/l): 1.497 - 4.423

Graphical representation

Depth range (m): 0.3 - 45

Temperature range (°C): 26.181 - 28.035

Nitrate (umol/L): 0.161 - 2.722

Salinity (PPS): 34.447 - 37.096

Oxygen (ml/l): 4.480 - 4.706

Phosphate (umol/l): 0.006 - 0.344

Silicate (umol/l): 1.497 - 4.423
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 12m.
From 1 to 12 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

As an adult, it lives among seagrasses and feeds on them. When alarmed, S. radians follows an escape pattern of darting rapidly away and suddenly coming to rest motionless in the seagrass, where it assumes a mottled color pattern that makes it difficult to detect (Ref. 35209). Feeds primarily on epiphytes and seagrass blades, leaving crescent bite marks. Herbivore (Ref. 57616).
  • Randall, J.E. 1967 Food habits of reef fishes of the West Indies. Stud. Trop. Oceanogr. Miami 5:665-847.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sparisoma radians

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTTGTATTTGGTGCCTGGGCCGGGATAGTAGGGACTGCTTTAAGCCTTCTCATCCGAGCCGAATTAAGCCAACCCGGGGCCCTTCTTGGGGACGACCAGATTTATAATGTAATTGTTACTGCTCATGCATTCGTAATAATCTTTTTTATGGTTATGCCAATTATGATTGGAGGTTTTGGGAACTGACTTATCCCTCTCATGATCGGAGCACCAGACATGGCATTCCCACGAATAAATAATATGAGCTTCTGACTCCTACCGCCTTCCTTCCTTCTACTACTTGCCTCTTCCGGTGTTGAAGCAGGGGCAGGGACAGGATGAACTGTTTACCCCCCACTAGCAGGGAACCTTGCACACGCGGGGGCATCCGTGGACCTAACGATCTTTTCTCTTCACCTTGCAGGGATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACTATTATCAACATGAAACCCCCCGCTATTTCCCAATATCAAACACCTCTGTTTGTCTGAGCTGTATTAATTACAGCCGTGCTTCTTCTACTTTCCCTACCCGTTCTCGCTGCAGGCATTACAATGCTTCTCACAGACCGAAATCTTAACACTACATTCTTTGATCCGGCAGGTGGAGGAGACCCCATTCTTTACCAGCACTTGTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sparisoma radians

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Bertoncini, A.A., Sampaio, C.L.S., Padovani-Ferreira, B., Rocha, L.A., Ferreira, C.E., Francini-Filho, R., Moura, R., Gaspar, A.L. & Feitosa, C.

Reviewer/s
McIlwain, J. & Craig, M.T.

Contributor/s

Justification
This species is widespread in the western tropical Atlantic, and common throughout its range. There are no major threats to this species. It is listed Least Concern.

History
  • 2010
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is considered common throughout its range.

Densities in shallow rocky reefs in southeastern Brazil obtained with underwater visual census (UVC) are in the order of 0.8 to 0.11 individuals /40 m2 (Floeter et al. 2007), 0.66/40 m2 in the Baixo-sul baiano in northeastern Brazil, and lower densities in its southern limit in Santa Catarina are 0.42/40 m2 (A. Bertoncini and S. Sampaio pers comm. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species. This species is not targeted by fisheries, and it is rare in the ornamental trade or artisanal fishery in Brazilian waters.

Parrotfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reefs, while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. Although the majority of the parrotfishes occur in mixed habitat (primarily inhabiting seagrass beds, mangroves, and rocky reefs) approximately 78% of these mixed habitat species are experiencing greater than 30% loss of coral reef area and habitat quality across their distributions. Of those species that occur exclusively in coral reef habitat, more than 80% are experiencing a greater than 30% of coral reef loss and degradation across their distributions. However, more research is needed to understand the long-term effects of habitat loss and degradation on these species populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that depend on live coral reefs for food and shelter especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats. Furthermore, coral reef loss and declining habitat conditions are particularly worrying for some corallivorous excavating parrotfishes that play major roles in reef dynamics and sedimentation (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species distribution includes several Marine Protected Areas within its range. The quota for this species is 1000 individuals/company/year in Brazil for aquarium trade export.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of potential interest; aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!