Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Comprehensive Description

Biology

Occur in a wide variety of habitat, but mostly in still or slow-flowing waters, mainly in streams, rivers and lakes within a short distance of the sea. Can survive in salinities up to 50 ppt. Feed on aquatic and terrestrial insects, and crustaceans. Adults typically migrate downstream into estuaries during high spring tides in autumn to spawn on fringing vegetation. Spawning does not occur beyond the river estuaries, making this species 'only marginally catadromous' (Ref. 46888). Many perish after spawning but some survive another year. Eggs develop out of water for two weeks and hatch upon the arrival of the next spring tide. Newly hatched larvae spend their first 5-6 months at sea before returning to fresh shoals of whitebait during spring. An important component of whitebait fisheries throughout the Southern Hemisphere (Ref. 44894). Utilized fresh and eaten fried (Ref. 9988, 44894).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Oceania: Australia (including Tasmania), Lord Howe Island, New Zealand and the Chatham Islands. South America: Ranges from along the Chilean side of the Andes near Valparaiso to the southern extremity of the island chain southeast of Tierra del Fuego. Also on the eastern side of the Andes in Argentina in isolated lakes (Meliquina, Traful, Nahuel Huapi, Gutierrez, and Pellegrini) which drain into the Atlantic Ocean via the Negro River. It occurs on Falkland Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southwestern Pacific, Oceania and, southern South America: Argentina, Australia, Chatham Islands, Chile, Falkland Islands, Lord Howe Island, New Zealand.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 10 - 12; Analspines: 0; Analsoft rays: 15 - 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 170 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

19.0 cm SL (male/unsexed; (Ref. 44894))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Galaxias maculatus
Catalog Number: USNM 201223
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): R. McDowall
Year Collected: 1965
Locality: New Zealand: Auckland, Lake Waiparera, North Island, New Zealand
  • Paratype: McDowall, R. M. 1967. Breviora. No. 265: 7, fig. 6.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

benthopelagic; catadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0.3 - 3.5
  Temperature range (°C): 14.527 - 15.376
  Nitrate (umol/L): 0.987 - 1.171
  Salinity (PPS): 35.018 - 35.487
  Oxygen (ml/l): 5.610 - 5.750
  Phosphate (umol/l): 0.191 - 0.221
  Silicate (umol/l): 0.906 - 0.958

Graphical representation

Depth range (m): 0.3 - 3.5

Temperature range (°C): 14.527 - 15.376

Nitrate (umol/L): 0.987 - 1.171

Salinity (PPS): 35.018 - 35.487

Oxygen (ml/l): 5.610 - 5.750

Phosphate (umol/l): 0.191 - 0.221

Silicate (umol/l): 0.906 - 0.958
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Catadromous. Migrating from freshwater to the sea to spawn, e.g., European eels. Subdivision of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Camallanus Infection 16. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

For diadromous populations: deposit eggs on dense terrestrial vegetation that is flooded by the high tide. The eggs develop out of water in humid condition during the next 2 weeks. Hatching takes place when a second series of high tides again wash over the eggs. For landlocked population: fish migrate up to the tributary streams during floods. Deposit eggs on the flooded grassy banks and complete their development after the water level subsides. Hatching occurs during subsequent floods.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Galaxias maculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCGCTGATTTTTCTCAACAAACCACAAAGACATTGGCACCCTTTACCTAGTATTTGGTGCTTGAGCCGGTATAGTTGGCACAGCTCTAAGCCTGTTAATTCGGGCAGAGCTAAGCCAGCCAGGTGCTCTTTTAGGTGAC---GACCAGATTTATAATGTAATCGTCACAGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCTATCATGATTGGAGGCTTTGGAAACTGGCTAATTCCACTTATGATTGGGGCTCCGGATATAGCATTTCCCCGTATGAACAACATAAGCTTTTGGCTACTCCCCCCCTCTTTTCTTCTTCTTTTAGCTTCCTCTGGCGTTGAAGCCGGGGCTGGTACGGGCTGAACTGTTTACCCCCCTTTAGCAGGTAATCTTGCTCATGCTGGAGCTTCCGTAGACCTGACTATCTTTTCCCTACACTTAGCAGGGATCTCTTCAATCTTAGGTGCAATTAACTTCATTACCACAATTATTAACATGAAACCACCTGCTATCTCCCAATATCAGACCCCTTTATTTGTATGGGCAGTCTTAATTACTGCCGTCCTTCTTCTTCTTTCTTTACCCGTTCTTGCTGCGGGAATTACGATACTATTGACGGACCGGAACCTAAATACGACTTTCTTCGACCCTGCCGGTGGGGGAGATCCTATTCTGTACCAGCATTTGTTTTGGTTCTTTGGCCACCCCGAAGTTTACATTCTTATTCTTCCGGGATTCGGAATAATCTCTCATATCGTTGCATACTACTCTGGAAAGAAAGAACCTTTTGGTTATATGGGAATAGTATGAGCTATGATAGCGATTGGTCTTCTAGGGTTTATCGTCTGGGCCCACCATATGTTTACTGTGGGAATAGATGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Galaxias maculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes; bait: usually
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common galaxias

The Common Galaxias or the Inanga (Galaxias maculatus), is a species of fish from the galaxiid family that is very widespread in the southern hemisphere. It is a slim narrow fish with a forked tail and as an adult it lives in freshwater rivers and lakes. Common galaxias grows to a length of 40 to 120 mm, but can grow up to 180 mm. The English vernacular names used for the species also include cowfish, jollytail, common jollytail, eel gudgeon, lananga, native trout, pulangi, slippery tarki, spotted minnow and whitebait.

Distribution and habitat[edit]

Common galaxias are one of the most widely distributed freshwater fish in the world and can be found around throughout New Zealand; in coastal streams in south eastern Australia, Tasmania and some parts of south west Western Australia; in Chile (From 35°S to 55S°), Patagonia, Argentina; in the Falkland Islands; and, in some Pacific Islands such as New Caledonia.

Adults are mainly found in still or slow moving water in the lower parts of coastal streams and rivers, or around the edges of lakes and lagoons. They are often found in schools that are not very large. They can tolerate a wide range of natural conditions.

Life history[edit]

Unless within a lake which is landlocked, the common galaxias spawns downstream in rivers and streams amongst vegetation on the banks of the estuary regions during a spring tide mainly in autumn. The eggs remain on the bank (out of the water) until the next spring tide when they hatch into larvae which are swept out to the ocean. For the next 5–6 months the larvae live in the sea and develop into juvenile fish, often referred to as whitebait. When they are about 30 mm in length and 3–4 mm in width they swim up a river on the incoming tide until they reach a suitable habitat where they develop into the adult form. As adults they eat insects, crustaceans, and molluscs. In other words they share the diet of introduced trout. Indeed introduced trout are a major threat to these fish and in areas where introduced Trout has become naturalised galaxias are scarce. Introduced Trout not only compete for food but also readily eat this species. Common galaxias, therefore, are mostly found in stretches of streams and rivers that are not suitable for introduced trout.

This species lives for about twelve months and usually dies after spawning.

In New Zealand, Deretrema philippae (=Limnoderetrema minutum) is known to parasitize the intestine (and possibly gall bladder) of the common galaxias. Similarly, the intestinal parasite Steganoderma szidati has been reported from this species' Argentinian population. These are digenean flatworms (Etchegoin et al. 2002).

Fishing[edit]

The juveniles are caught as whitebait while moving upstream and are much valued as a delicacy leading to their protection with licensing and controlled fishing seasons in order to preserve adult populations. Fishing may be both for recreational and commercial activity depending on the geographic location and size of the populations.

Some jurisdictions permit fishing of the adults but again under regulation or licence in order to preserve the adult population but others ban it altogether unless the fisher belongs to an indigenous people (e.g., New Zealand Māori). For instance, in Tasmania, the adult common galaxias may only be caught using a pole of a specified maximum size (one metre).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!