Overview

Brief Summary

Mojarras, in general, are schooling coastal fishes with extremely protrusible mouths, which they use to capture bottom-dwelling invertebrates. They are abundant in coastal waters, bays, and estuaries in tropical and warm-temperate regions. They are most common over grassy, sandy, or other open bottoms, but not around reefs (Robins and Ray 1986).

Striped Mojarras (Eugerres plumieri) are rather deep-bodied fish, dark olive above and tan to silvery on the sides, often with a metallic sheen. Bold black stripes run along the scale rows (excluding the belly). All fins except for the pectoral fins are dusky in large adults; the pelvic and anal fins are sometimes dark orange. The pectoral fin is transparent. The pelvic spine and the first two (of three) anal spines are pale. The dorsal and anal spines are long and stout. Adults may reach 30 cm in length (maximum known size is 40 cm total length) (Robins and Ray 1986).

Striped Mojarras are found from South Carolina (U.S.A.) and the entire Gulf of Mexico to Brazil, but are apparently absent from the Bahamas and some of the smaller islands of the West Indies. In the Gulf of Mexico, they are found along the west Florida coast north to about the middle of the peninsula and along the coasts of Tamaulipas, Veracruz, and Campeche. They are found in grassy areas and in brackish and coastal fresh waters (in limestone regions). They are often associated with mangrove-lined lagoons and muddy-bottomed coastal areas, often entering brackish and fresh water (Robins and Ray 1986; McEachran and Fechheld 2005).

In a study in Mexico, Aguirre-León and and Diaz-Ruíz (2000) found that the principal food items consumed by Striped Mojarras were ostracods, foraminifers, nematodes, and tanaidacean crustaceans.

In many areas, the Striped Mojarra is of significant commercial and recreational value, although some populations have been declining due to overfishing (Rueda and Santos-Martínez 1999; Rodriguez-Sierra and Jiménez 2002; Aguirre-León and and Diaz-Ruíz).

Deckert and Greenfield (1987) reviewed the taxonomy and nomenclature of the western Atlanic species of Eugerres and the closely related genus Diapterus and Gonzalez-Acosta et al. (2007) provide a more recent taxonomic review of the western Atlantic species of Eugerres. Chen et al. (2007) present a molecular phylogenetic analysis of the relationships among four genera of western Atlantic Gerreidae, including Eugerres plumieri as one of the sampled species.

  • Robins, C. R., and Ray, G. C. (1986). A Field Guide to Atlantic Coast fishes of North America. Boston: Houghton Mifflin.
  • Rueda, M. and Santos-Martínez, A. 1999. Population dynamics of the striped mojarra Eugerres plumieri from the Ciénaga Grande de Santa Marta, Colombia. Fisheries Research 42: 155-166.
  • Rodriguez-Sierra, C.J. and Jiménez, B. 2002. Trace metals in striped mojarra fish (Diapterus plumieri) from Puerto Rico. Marine Pollution Bulletin 44: 1039-1045.
  • Aguirre-León, A. and Diaz-Ruíz, S. 2000. Population structure, gonadal maturity and feeding habits of Eugerres plumieri (Gerreidae) in the Pomatasta fluvial-deltaic system, Mexico. Ciencias Marinas 26 (2): 253-273.
  • Chen, W.-J., Ruiz-Carus, R., and Orti, G. 2007. Relationships among four genera of mojarras (Teleostei : Perciformes : Gerreidae) from the western Atlantic and their tentative placement among percomorph fishes. Journal of Fish Biology 70, supplement B: 202-218.
  • Gonzalez-Acosta, A.F., De la Cruz-Aguero, J., and Castro-Aguirre, J.L. 2007. A review of the marine western Atlantic species of the genus Eugerres (Perciformes : Gerreidae). Bulletin of Marine Science 80 (1): 109-124.
  • Deckert, G.D. and D.W. Greenfield. 1987. A review of the western Atlantic species of the genera Diapterus and Eugerres (Pisces: Gerreidae). Copeia 1987 (1): 182-194.
  • McEachran, J.D. and Fechhelm, J.D. 2005. Fishes of the Gulf of Mexico. Volume 2:Scorpaeniformes to Tetraodontiformes. University of Texas Press, Austin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sara Eckert and Leo Shapiro

Supplier: Sara Eckert

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Inhabits shallow coastal waters and common in brackish waters (Ref. 36880), mostly over mud bottoms in mangrove-lined creeks and lagoons (Ref. 3722); often entering a considerable distance into freshwaters (Ref. 36880). Feeds on aquatic insects, crustaceans, micro-bivalves and detritus (Ref. 36880). Marketed fresh; processed into fishmeal (Ref. 3722).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Brazil north to South Carolina; not reported from northern Gulf of Mexico, Bahamas, or small islands of the West Indies (Robins and Ray 1986). All reported occurrences in fresh water are from Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: South Carolina to western Florida, USA (Ref. 26938) and the entire Gulf of Mexico to Brazil; absent from Bahamas and smaller islands in West Indies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 26 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 400 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

40.0 cm TL (male/unsexed; (Ref. 3722)); max. published weight: 1,020 g (Ref. 4699)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Holotype for Eugerres awlae
Catalog Number: USNM 121721
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Radiograph; Photograph
Collector(s): L. Schultz
Year Collected: 1942
Locality: Venez: Salina Rica, 5 km. N. of Maracaibo (Brackish), Venezuela, South America
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Eugerres awlae
Catalog Number: USNM 121723
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1942
Locality: Venez: Lago Maracaibo 7 km. S. of Maracaibo, Venezuela, South America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Eugerres awlae
Catalog Number: USNM 121722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1942
Locality: Venez: Salina Rica, 5 km. N. of Maracaibo (Brackish), Venezuela, South America
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Brackish and coastal fresh waters (in limestone region), grassy areas (Robins and Ray 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 8.5

Graphical representation

Depth range (m): 1 - 8.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Specimens of 5-45 mm SL from Indian River, Florida, ate mainly planktonic copepods and mosquito larvae. Other food items include polychaetes and ostracods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inhabits shallow coastal waters and common in brackish waters (Ref. 36880), mostly over mud bottoms in mangrove-lined creeks and lagoons (Ref. 3722); often entering a considerable distance into freshwaters (Ref. 36880). Feeds on aquatic insects, crustaceans, micro-bivalves and detritus (Ref. 36880); also on plants and other benthic invertebrates (Ref. 26987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eugerres plumieri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATATAATCTTTGGTGCTTGAGCAGGTATAGTAGGGACGGCCCTCAGCCTGCTGATCCGGGCGGAACTAAGCCAGCCCGGATCCTTACTCGGAGACGACCAAATTTATAATGTGATCGTCACCGCCCACGCCTTTGTAATAATCTTCTTTATAGTTATACCAATTATGATCGGTGGCTTCGGCAACTGGCTGATCCCGCTAATGATCGGGGCCCCTGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTCCTTCCTCCCTCATTCCTTCTTCTCCTAGCCTCTTCAGGAGTCGAAGCGGGGGCCGGAACAGGGTGAACCGTCTATCCCCCTCTGGCAGGCAACCTAGCCCATGCCGGAGCTTCCGTTGACCTAACCATCTTCTCCCTTCACTTAGCAGGGATCTCCTCCATCCTTGGAGCAATCAACTTTATTACAACAATTATTAACATGAAACCTCCAGCAATTACTCAGTACCAAACCCCACTGTTTGTCTGAGCTGTGCTTATTACTGCTGTGCTTCTGCTTCTATCTCTTCCTGTTCTGGCCGCCGGTATCACTATGCTCTTAACCGATCGTAACCTAAACACCACCTTCTTTGACCCTGCAGGAGGAGGAGACCCAATTCTCTACCAGCACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eugerres plumieri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 29
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!