Overview

Comprehensive Description

Biology

Inhabits rocky bottoms and feeds mainly on small fishes and squids. Abundant near oceanic islands (Ref. 9626). Small individuals are taken as by-catch in trawl fisheries (Ref. 5217). Marketed mostly fresh, sometimes frozen. Flesh of good quality.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Bermuda and North Carolina, USA, Gulf of Mexico southward through the Caribbean to Brazil; particularly abundant in the Bahamas and the Antilles
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: Bermuda and North Carolina, USA, Gulf of Mexico southward through the Caribbean to Brazil; particularly abundant in the Bahamas and the Antilles (Anderson, pers. comm.).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 11; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

100.0 cm TL (male/unsexed; (Ref. 9626)); max. published weight: 5,300 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Head small; eye large; snout short. Maxilla covered with small scales; lower jaw slightly projecting. Dorsal and anal fin bases without scales; caudal fin deeply forked. Scale rows on the back running parallel with the lateral line. Back and upper sides deep pink to red; lower sides and belly pink; fins pink except the spinous portion of the dorsal fin; entire caudal fin brilliant red.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 100 - 450 m (Ref. 9626)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 8.5 - 475
  Temperature range (°C): 18.067 - 23.937
  Nitrate (umol/L): 0.499 - 4.289
  Salinity (PPS): 34.963 - 36.510
  Oxygen (ml/l): 4.316 - 4.865
  Phosphate (umol/l): 0.184 - 0.236
  Silicate (umol/l): 1.759 - 2.391

Graphical representation

Depth range (m): 8.5 - 475

Temperature range (°C): 18.067 - 23.937

Nitrate (umol/L): 0.499 - 4.289

Salinity (PPS): 34.963 - 36.510

Oxygen (ml/l): 4.316 - 4.865

Phosphate (umol/l): 0.184 - 0.236

Silicate (umol/l): 1.759 - 2.391
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 100 - 450m.
From 100 to 450 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Etelis oculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCCCTAAGCTTGCTCATTCGAGCAGAACTAAACCAACCAGGCGCACTTCTTGGAGACGACCAAATTTACAACGTAATCGTTACGGCGCATGCATTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGGGGATTTGGAAATTGACTGATCCCACTAATGATTGGGGCCCCCGACATGGCATTCCCCCGAATGAATAATATGAGCTTTTGACTACTTCCTCCCTCTTTCCTTCTCCTCCTTGCCTCATCTGGAGTAGAAGCAGGGGCTGGTACCGGTTGAACAGTGTATCCCCCACTAGCTGGTAACCTCGCACATGCGGGGGCGTCTGTTGACCTAACCATCTTTTCCCTCCACCTCGCAGGGGTTTCCTCAATCCTGGGAGCAATTAATTTTATTACAACCATTGTCAACATGAAACCTCCCGCTATTTCCCAATACCAGACACCTCTGTTTGTCTGAGCTGTACTAATTACGGCTGTTCTCCTGCTCCTCTCTCTCCCAGTACTTGCTGCAGGGATTACAATGCTTCTTACAGACCGAAACTTAAACACCACCTTCTTTGACCCAGCAGGAGGAGGAGACCCAATTCTCTACCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Etelis oculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!