Overview

Comprehensive Description

Biology

Found mostly inshore: chiefly in bays, inlets and estuaries, sometimes in low salinities. Older individuals tend to move out to sea in winter and back in the spring. Forms compact schools much preyed upon by larger fishes, common dolphins and birds. Feeds on plankton. Spawns in inlets, bays and also estuaries, probably throughout the year but mainly in late spring to early autumn and especially about November to February. The eggs are ellipsoidal. Utilized as fish paste.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southwest Pacific: Australia (from Queensland at about Cape Capricorn south to southern Tasmania; entire southern coast of Australia, except for Great Australian Bight, and north to Shark Bay, Western Australia), including Lord Howe Island and Norfolk Island; and New Zealand (most of the North Island and all but the southeast coast of the South Island).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 18; Analspines: 0; Analsoft rays: 17 - 19; Vertebrae: 40 - 48
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 140 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 33832)); max. reported age: 6 years (Ref. 6390)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Hardly differs from the European anchovy (E. encrasicolus) and can be identified from that description. For most of its range it is the only anchovy present, but in the extreme north it may overlap with species of Encrasicholina or Stolephorus, which have small needle-like scutes before the pelvic fins; species of Thryssa have compressed bodies and a keel of scutes along the belly.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; brackish; marine; depth range 31 - 70 m (Ref. 58489)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 290 specimens in 1 taxon.
Water temperature and chemistry ranges based on 31 samples.

Environmental ranges
  Depth range (m): 0.5 - 291.5
  Temperature range (°C): 11.538 - 25.737
  Nitrate (umol/L): 0.150 - 6.885
  Salinity (PPS): 34.663 - 36.031
  Oxygen (ml/l): 4.107 - 5.990
  Phosphate (umol/l): 0.150 - 0.504
  Silicate (umol/l): 1.170 - 5.767

Graphical representation

Depth range (m): 0.5 - 291.5

Temperature range (°C): 11.538 - 25.737

Nitrate (umol/L): 0.150 - 6.885

Salinity (PPS): 34.663 - 36.031

Oxygen (ml/l): 4.107 - 5.990

Phosphate (umol/l): 0.150 - 0.504

Silicate (umol/l): 1.170 - 5.767
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 65m.
Recorded at 65 meters.

Habitat: pelagic. Found mostly inshore: chiefly in bays, inlets and estuaries, sometimes in low salinities. Older individuals tend to move out to sea in winter and back in the spring. Forms compact schools much preyed upon by larger fishes, common dolphins and birds. Feeds on plankton. Spawns in inlets, bays and also estuaries, probably throughout the year but mainly in late spring to early autumn and especially about November to February. The eggs are ellipsoidal. Utilized as fish paste.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occur mostly inshore: chiefly in bays, inlets and estuaries, sometimes in lowered salinities, but older fishes tending to move out to sea in winter and back in the spring. Form compact schools. Larval and juvenile anchovy inhabit bays, inlets and brackish estuaries (Ref. 189, 26499).
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Spawns in inlets, bays and estuaries.
  • Whitehead, P.J.P., G.J. Nelson and T. Wongratana 1988 FAO Species Catalogue. Vol. 7. Clupeoid fishes of the world (Suborder Clupeoidei). An annotated and illustrated catalogue of the herrings, sardines, pilchards, sprats, shads, anchovies and wolf-herrings. FAO Fish. Synop. 125(7/2):305-579. Rome: FAO. (Ref. 189)   http://www.fishbase.org/references/FBRefSummary.php?id=189&speccode=4 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Engraulis australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATATNTTATTTTCGGTNCCTGAGCAGGAATGGTAGGGACAGCACTTAGCCTCCTTATTCGAGCAGAACTAAGCCAACCAGGAGCACTTCTGGGGGACGATCAAATTTATAACGTAATCGTTACTGCTCACGCATTCGTAATAATCTTTTTTATGGTAATGCCCATCCTAATCGGTGGGTTCGGGAATTGACTTATTCCTCTTATACTAGGGGCCCCAGACATGGCATTCCCCCGAATGAACAATATGAGCTTTTGACTCCTTCCCCCTTCTTTCCTTCTCCTATTAGCATCATCTGGTGTTGAAGCAGGAGCCGGGACAGGATGAACAGTCTACCCCCCTCTATCAGGAAACCTCGCCCACGCCGGAGCGTCAGTAGATTTAACAATCTTCTCTCTCCACTTGGCAGGGATTTCATCAATCCTAGGTGCCATTAATTTCATTACTACCATCATTAATATGAAACCACCTGCTATTTCACAATACCAGACACCTCTATTTGTCTGAGCTGTATTAATCACGGCAGTACTTTTACTTCTTTCACTACCCGTTCTAGCTGCTGGGATTACTATGCTTCTCACANACCGAAACCTAAATACTACTTTCTTCNACCCAGCGGGGGGAGGAGACCCAATTCTTTATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Engraulis australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; bait: usually; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Australian anchovy

The Australian anchovy, Engraulis australis, is an anchovy of the family Engraulidae, found off south-east Australia, and around New Zealand.

The Australian anchovy feeds on plankton.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!