Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Summary

"Epinephelus bleekeri is identified by the lack of spots in the bluish lower half of the caudal fin compared to the upper half. In great demand in the market, this fish is obtained through both capture of natural populations and populations raised through aquaculture."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Occurs on shallow banks, but is not known from well-developed coral reefs (Ref. 27253). Benthic (Ref. 75154). In Hong Kong live fish markets (Ref. 27253). Usually taken by trawling in 30-45 m or by hand-lining over rocky banks; not found from coral reefs (Ref. 11441).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

General
Epinephelus bleekeri is an Indo-West Pacific species ranging from the Persian Gulf to Taiwan, Indonesia and the northern coast of Australia. Currently it is not known from Japan, but it may occur there. It has not been found at any islands of Micronesia or Polynesia (Heemstra and Randall 1993).

Specific
Australia (Northern Territory, Western Australia), Bahrain, Brunei Darussalam, Cambodia, China (Fujian, Guangdong), Hong Kong, India (Andhra Pradesh, Karaikal, Kerala, Mahé, Pondicherry, Tamil Nadu, Yanam), Indonesia (Java, Kalimantan, Moluccas, Sulawesi, Sumatra), Iraq, Iran, Kuwait, Malaysia (Peninsular Malaysia, Sabah, Sarawak), Oman, Pakistan, Philippines, Qatar, Saudi Arabia, Singapore, Sri Lanka, Taiwan, Thailand, United Arab Emirates, and Viet Nam.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"E. bleekeri is an Indo-West Pacific species occurring from the Persian Gulf to Taiwan, Indonesia and the northern coast of Australia. E. bleekeri was reported from Bahrain, Iran, India, Thailand, Cambodia, Indonesia, Borneo, Philippines, China, Hong Kong, Taiwan, and Australia. Range: Tropical; 32°N - 17°S, 48°E - 136°E"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Persian Gulf to Taiwan, Indonesia and the northern coast of Australia. Not known from Japan, but may occur here. It has not been found at any islands of Micronesia nor Polynesia.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Persian Gulf (Arabian Gulf) east to Philippines, north to Taiwan, south to Northern Territory (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

"Dorsal fin with 11 spines and 16 to 18 rays, third to fifth spines longest, the interspinous membranes incised. Anal fin with 3 spines and 8 or 9 (rarely 9) rays. Pectoral-fin rays 17 to 19 pectoral-fin length contained 1.6 to 2.1 times in head length. Pelvic-fin length contained 1.9 to 2.5 times in head length. Caudal fin truncate. Color of body at ground is reddish brown above and pale below. Upper part of head and body also reddish brown. Pelvic and anal fins and upper half of caudal fin with orange to orange red spots. Lower half of caudal fin and outer edge of anal fin purple brown."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 11; Dorsal soft rays (total): 16 - 18; Analspines: 3; Analsoft rays: 8 - 9
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Max reported length is 76 cm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 760 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

76.0 cm TL (male/unsexed; (Ref. 2852))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnostic

"A medium sized fish with an elongate and laterally compressed body. Body depth contained 3.0 to 3.5 times in standard length (for fish 11 to 52 cm standard length). Head length contained 2.4 to 2.7 times in standard length, interorbital area flat to slightly convex. Preopercle angle with 2 to 9 enlarged serrae, adults with a notch above preopercle angle, but no enlarged spinules on latter. Upper edge of operculum straight and 3 flat spines, maxilla scaly, reaching to or beyond vertical at rear edge of eye. Midlateral part of lower jaw with 2 rows of subequal teeth. Teeth of outer row longer, those of inner rows shortera and depressible. Canines at front of jaws. Gill rakers 9 to 11 on upper limb, 16 to 18 on lower limb, 25 to 28 total. Scales ctenoid, adults with a few small auxiliary scales. Juveniles (less than 11 cm standard length) with 7 faint dark bars dorsally on body, the first two on nape, the last on caudal peduncle, all bars more or less demarcated by small dark spots, no dark spots on head or fins."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic

"Caudal fin subtruncate, truncate or emarginate. Pectoral fins rather short, as long as or shorter than postorbital part of spine. Last dorsal fin spine considerably shorter than third dorsal fin. Middle opercular spine about equidistant from lower and upper spines. Teeth on middle side of lower ja in 2 rows, upper part of head and body, pelvic and anal fins, upper half of caudal fin covered with orange to orange red spots. - (From Talwar and Kacker, 1984)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Recognized by the bluish lower half of the caudal fin and the lack of spots there compared to the upper half (Ref. 48635).
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
General
Epinephelus bleekeri is a demersal species that occurs on shallow banks (30 to 104 m), but is not known from well-developed coral reefs (Randall 1995).

Fisheries-dependent
It is usually taken by trawling in 30 to 45 m or by hand-lining over rocky banks. Its maximum size is reported at 76.0 cm TL (Chan 1968). Epinephelus bleekeriis of minor commercial importance to fisheries. Wild caught juveniles are also utilized for aquaculture for live fish market in Hong Kong (Lee and Sadovy 1998, Donaldson et al. 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Habitat

"Occurs on shallow banks, but is not known from well-developed coral reefs. These demersal marine fish are usually found at a depth range of 30 - 104 m"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 30 - 104 m (Ref. 5222)
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 30 - 93
  Temperature range (°C): 24.821 - 27.608
  Nitrate (umol/L): 0.429 - 2.763
  Salinity (PPS): 32.901 - 35.018
  Oxygen (ml/l): 3.735 - 4.302
  Phosphate (umol/l): 0.269 - 0.285
  Silicate (umol/l): 4.953 - 8.653

Graphical representation

Depth range (m): 30 - 93

Temperature range (°C): 24.821 - 27.608

Nitrate (umol/L): 0.429 - 2.763

Salinity (PPS): 32.901 - 35.018

Oxygen (ml/l): 3.735 - 4.302

Phosphate (umol/l): 0.269 - 0.285

Silicate (umol/l): 4.953 - 8.653
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 30 - 104m.
From 30 to 104 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

"Secondary consumer. Prey - Benthic crusteceans, small fishes"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

"Monogenea, Digenea, zoonotic metacercariae members"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Diseases

"Zoonotic metacercariae species - Heterophyopsis continua and Procerovum varium, were reported from wild and cultured specimens of E. bleekeri at Vietnam. Fish Lymphocystis disease (FLD) caused due to iridovirus was reported from Guangdong Province, China (Haifa, 2001). Parasites reported from E. bleekeri at different locations include: 1. Venmathi Maran et al., 2009 reported Caligus rotundigenitalis Yü, 1933 of the parasite group Copepoda in Malaysia. 2. Vinoth et al., 2010 reported Caligus epidemicus of the parasite group Copepoda from India. 3. Velasquez, 1959 reported Neidhartia mcintoshi n. sp. and Prosorhynchus macintoshi (Velásquez, 1959) (as Prosorhynchus mcintoshi) of the parasite group Digenea in Philippine. 4. Leong (2001) reported Benedenia lutjani (Whittington and Kearn, 1993), Benedenia sp. (Diesing, 1858), Megalocotyloides convolute, Megalocotyloides epinepheli (Bychowsky and Nagibina, 1976), Neobenedenia girellae (Hargis, 1955), Neobenedenia sp. (Yamaguti, 1963), Pseudorhabdosynochus coioidesis Bu, Leong, Wong, Woo e Foo, 1999, Pseudorhabdosynochus epinepheli Yamaguti,1958, and Pseudorhabdosynochus lanteuensis of the parasite group Monogenea in Thailand. 5. Hamid (2001) reported Diplectanum penangi Liang and Leong, 1991, Pseudorhabdosynochus latesi Tripathi, 1955 and Pseudorhabdosynochus monosquamodiscusi (Balasuriya and Leong, 1995) of the parasite group Monogenea in Thailand."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Prosorhynchus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Prosorhynchus Disease (metacercaria). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

"Epinephelus bleekeri is widespread, but apparently no longer abundant in large parts of its range."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

This fish is an open water/substratum spawner. Fertilisation is external.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

Govindaraju and Jayasankar (2004) have studied the taxonomic relationship among grouper species revealed by RAPD fingerprinting from southeast and southwest coast of India. E. bleekeri was found to be most distantly related to E. malabaricus and E. diacanthus. E. chlorostigma and E. bleekeri were also found to share a very close genetic relationship.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Statistics of barcoding coverage: Epinephelus bleekeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Epinephelus bleekeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTTATCTTGTATTTGGTGCCTGAGCCGGTATAGTAGGAACCGCCCTCAGCCTGCTTATTCGAGCTGAGCTGAGCCAACCAGGCGCCCTACTTGGCGACGATCAGATTTATAACGTAATTGTTACAGCACATGCTTTCGTGATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTCATTCCACTTATAATTGGCGCCCCAGACATGGCGTTCCCTCGAATAAACAATATAAGCTTCTGACTTCTCCCCCCATCCTTCCTACTTCTCCTAGCCTCCTCCGGAGTAGAAGCTGGTGCTGGAACTGGTTGAACGGTCTACCCGCCTCTAGCCGGAAACCTAGCCCACGCAGGCGCATCCGTAGACTTAACCATCTTCTCTCTACATCTAGCAGGAATTTCATCAATTCTAGGGGCAATCAACTTTATTACTACCATTATTAACATAAAACCCCCAGCTATCTCTCAATATCAAACACCTTTATTCGTATGAGCTGTTTTAATTACAGCAGTCCTACTACTCTTGTCTCTTCCCGTTCTTGCCGCCGGTATTACAATACTTCTGACAGATCGTAATCTTAATACTACTTTCTTTGACCCAGCTGGAGGGGGAGACCCAATTCTCTACCAGCACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Russell, B., Samoilys, M., Cornish, A. & Carpenter, K.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Epinephelus bleekeri is a widespread species, locally abundant in some areas. However, it is highly sought after as adults as food and also as fingerlings/juveniles for grow-out. Unrestricted exploitation has led to widespread local declines in the availability of fingerlings/juveniles for growout. The continuation of this practice may lead to further declines and this species should be closely monitored. From the trade in wild fingerlings/juveniles, a population decline throughout much of its range is inferred that may be close to meeting Criterion A4d.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Red List Category & Criteria: Near Threatened ver 3.1 Year Published: 2008 Assessor/s: Russell, B., Samoilys, M., Cornish, A. & Carpenter, K. Reviewer/s: Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
General
Epinephelus bleekeri is widespread, but apparently no longer abundant in large parts of its range.

Fisheries-dependent data
In Hong Kong, declines are common to all medium-bodied groupers, including this species. There are inferred declines in the abundance of wild-caught fingerlings/juveniles for grow-out according to Hong Kong mariculturists. In southern China, fingerlings are near extirpated (Sadovy 2000). These declines suggest a reduction in the adult population in source areas throughout Southeast Asia (Min pers. comm. 2007). The species is still common in the markets of the Persian Gulf.

A minor part of the Western Ausrtalia trap fishery. A total of 55 kg caught in Onslow, Western Australia (1986 to 1987) and 46 kg in 1987 to 1988 (Moran et al. 1987).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population decreasing.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
General
Perhaps the greatest threat to Epinephelus bleekeri is overfishing.

Fisheries-dependent
Epinephelus bleekeri is subject to commercial trawling of adults, including India (James et al. 1996) and in trap fishery in Western Australia (Moran et al. 1988).

Within the live reef food fish trade, there is a capture fishery of wild caught fingerlings and juveniles (fingerlings, hereafter) for grow out in sea cages and pens. Juveniles are commonly taken in estuaries in the Philippines (Pratt et al. 2000, Padilla et al. 2003) and Thailand (Vidthayanon and Premcharoen 2002), Malaysia, southern China, Vietnam and Indonesia. Fingerlings are either locally grown out or sold to Taiwan or Hong Kong (Sadovy 2000). The numbers can be substantial. For example, in one year 10 million fry were exported from Thailand to Hong Kong (Sadovy 2000). These fingerlings are grown out in open sea cages and big pens in Malaysia. Wild caught Epinephelus bleekeri fingerlings are raised in floating cages and ponds in Vietnam (Tuan 2003).

Among the fishing gears, seine net, scoop net and push net are mainly used for collecting small fish of 1 to 3 cm. Seine nets provide the highest yield (catch per unit effort) in terms of number of pieces per trip. For larger seed, encircling nets, used together with artificial reefs, were the most important in terms of quantity and quality of catch. The seasonality of use of different gears reflects the growth of the seed and their move to deeper water as the season progresses (Tuan and Hambrey 2000). No hatcheries are known for this species (Sadovy pers. comm.).

Epinephelus bleekeri was widely cultured in Hong Kong in the early 1990s when green groupers experienced disease problems that could not be overcome. Epinephelus bleekeri was not affected by the same disease, so fish farmers gave up farming green grouper and changed to this species. E. bleekeri Epinephelus bleekeri adapted very well to the new environment but grew much slower than green groupers. Disease problems with Epinephelus bleekeri began about three years ago. The diseased fish would consume excessive food one day, then stopped feeding the following day. By then an infection was noticeable on the fish’s body. Its condition would worsen very quickly and within three days most of the fish would die. Treatments with antibiotics, freshwater bath, malachite green, methylene blue and formalin have had no success with this problem. The situation was uncontrollable in 2001 with an almost 95% mortality rate for imported Epinephelus bleekeri. Researchers found that the disease was caused by a new vibrio (SPC Live Reef Fish Information Bulletin #9).

Listed in Life Reef Food Fish Trade in Hong Kong (Donaldson et al. 2003) and Philippines (Pratt et al. 2000 Padilla et al. 2003). Live reef fish import data from the Hong Kong Census and Statistics Department (HK CSD) record the largest quantities of "other groupers" and "other marine fishes" as being imported from Thailand. Thailand and Malaysia are important sources for so-called "cultured" species including Brown Spotted Grouper Epinephelus areolatus / Epinephelus bleekeri, which are amongst 12 most commonly available species imported to Hong Kong (http://www.traffic.org/reef-fish/executivesummary.html).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Perhaps the greatest threat to Epinephelus bleekeri globally is overfishing. In India, trawl fishery is one of the major threats to this species. In many Southeast Asian countries, the process of removal of small juveniles from natural habitats for farming can lead to decreased numbers of this fish species."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Near Threatened (NT)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Epinephelus bleekeri is listed as ‘Least Concern’ in Australia (Northern Territory), but there are no measures specific to this species. The species does occur in some marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

"Caught with hook-and-line, longlines, and trawls. Traps are used to catch E. bleekeri at Gulf of Mannar (India) region perticularly in Keelakarai and Rameswaram (LalMohan, 1985). One of the major species at """"Kalava grounds"""". Serranid fishery occurs off Kerala, South India (Sivakami and Seetha, 2006)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Uses

"Uses: Fisheries: minor commercial. Aquaculture: commercial. Price category: very high. An excellent tasting fish, but it is apparently not abundant. Cultured in floating net cages, pens, ponds in South east Asian countries. Used in Life Reef Food Fish Trade in Hong Kong (Donaldson et al., 2003)."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: minor commercial; aquaculture: commercial; price category: very high; price reliability: questionable: based on ex-vessel price for species in this genus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Risk Statement

Harmless to humans.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!