Overview

Comprehensive Description

Biology

Inhabits shallow lagoon and seaward reefs from 6 to 40 m (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: eastern Caroline, Mariana and Marshall Islands; Line, Society, Tuamoto, Austral and Pitcairn Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 64 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.4 cm SL (male/unsexed; (Ref. 1602))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 6 - 40 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 24 - 24
  Temperature range (°C): 28.810 - 28.810
  Nitrate (umol/L): 0.067 - 0.067
  Salinity (PPS): 34.229 - 34.229
  Oxygen (ml/l): 4.454 - 4.454
  Phosphate (umol/l): 0.159 - 0.159
  Silicate (umol/l): 1.553 - 1.553
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 40m.
From 6 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Liopropoma pallidum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGTACAGCCCTAAGCCTCCTGATTCGAGCAGAACTAAGCCAACCAGGGGCGCTTCTGGGAGATGACCAAATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTCATCCCGCTAATGATCGGAGCCCCCGACATAGCATTCCCCCGGATGAACAACATGAGCTTCTGACTTTTACCCCCTTCATTCCTTCTACTGCTCGCCTCCTCGGGTGTAGAAGCGGGAGCAGGTACAGGCTGAACGGTCTATCCCCCTCTTGCAGGCAACCTGGCCCATGCGGGGGCATCCGTAGATTTAACAATTTTCTCGCTGCACCTCGCCGGTATTTCATCAATCCTCGGAGCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCTGCAATCTCCCAGTACCAGACCCCTCTATTCGTATGAGCCGTCCTCATTACTGCCGTTCTTCTTCTACTCTCCCTCCCTGTCCTAGCCGCCGGAATTACGATACTACTAACAGACCGAAACCTTAATACTTCCTTCTTTGACCCCGCGGGGGGAGGAGACCCCATTCTCTACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Liopropoma pallidum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!