Overview

Comprehensive Description

Biology

Inhabits shallow lagoon and seaward reefs from 6 to 40 m (Ref. 37816).
  • Randall, J.E. and L. Taylor 1988 Review of the Indo-Pacific fishes of the serranid genus Liopropoma, with descriptions of seven new species. Indo-Pac. Fish. (16):47 p. (Ref. 6180)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: eastern Caroline, Mariana and Marshall Islands; Line, Society, Tuamoto, Austral and Pitcairn Islands.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 8; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 8
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 64 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.4 cm SL (male/unsexed; (Ref. 1602))
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 6 - 40 m (Ref. 37816)
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 24 - 24
  Temperature range (°C): 28.810 - 28.810
  Nitrate (umol/L): 0.067 - 0.067
  Salinity (PPS): 34.229 - 34.229
  Oxygen (ml/l): 4.454 - 4.454
  Phosphate (umol/l): 0.159 - 0.159
  Silicate (umol/l): 1.553 - 1.553
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 6 - 40m.
From 6 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Liopropoma pallidum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGTACAGCCCTAAGCCTCCTGATTCGAGCAGAACTAAGCCAACCAGGGGCGCTTCTGGGAGATGACCAAATTTATAATGTAATTGTTACGGCCCATGCTTTCGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTCATCCCGCTAATGATCGGAGCCCCCGACATAGCATTCCCCCGGATGAACAACATGAGCTTCTGACTTTTACCCCCTTCATTCCTTCTACTGCTCGCCTCCTCGGGTGTAGAAGCGGGAGCAGGTACAGGCTGAACGGTCTATCCCCCTCTTGCAGGCAACCTGGCCCATGCGGGGGCATCCGTAGATTTAACAATTTTCTCGCTGCACCTCGCCGGTATTTCATCAATCCTCGGAGCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCTGCAATCTCCCAGTACCAGACCCCTCTATTCGTATGAGCCGTCCTCATTACTGCCGTTCTTCTTCTACTCTCCCTCCCTGTCCTAGCCGCCGGAATTACGATACTACTAACAGACCGAAACCTTAATACTTCCTTCTTTGACCCCGCGGGGGGAGGAGACCCCATTCTCTACCAGCACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Liopropoma pallidum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!