Overview

Comprehensive Description

Biology

Solitary on sand at base of coral overhangs (Ref. 90102). Specimens collected from sand or sand and rubble substrata.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Saudi Arabia, Oman, Mauritius, and Kenya (10683); Japan (Ref. 43239) and Indonesia (Ref. 47567). Recently reported from Tonga (Ref. 53797).
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9; Analspines: 1; Analsoft rays: 7 - 8; Vertebrae: 26
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 45.5 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

4.6 cm SL (male/unsexed; (Ref. 10683))
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by semi-translucent body, presence of small orange spots, and 4-5 large internal blackish blotches and rectangular white marks; elongate and filamentous first two dorsal spines especially in male; fully united pelvic fins; presence of pelvic frenum; rounded caudal fin; longitudinal scale series 25-26; ctenoid scales except cycloid on nape, breast and base of pectoral fin; scales absent on operculum; median predorsal scales absent; opening of gill extending to below posterior half of opercle; depth of body 4.8-5.2 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 2 - 30 m (Ref. 10683)
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 2 - 15.5
  Temperature range (°C): 25.709 - 28.749
  Nitrate (umol/L): 0.122 - 0.919
  Salinity (PPS): 32.279 - 35.312
  Oxygen (ml/l): 4.388 - 4.748
  Phosphate (umol/l): 0.110 - 0.350
  Silicate (umol/l): 1.331 - 4.452

Graphical representation

Depth range (m): 2 - 15.5

Temperature range (°C): 25.709 - 28.749

Nitrate (umol/L): 0.122 - 0.919

Salinity (PPS): 32.279 - 35.312

Oxygen (ml/l): 4.388 - 4.748

Phosphate (umol/l): 0.110 - 0.350

Silicate (umol/l): 1.331 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fusigobius inframaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TAGTGGGNACCGCACTAAGTCTGCTTATTCGAGCCGAACTCAGTCAACCCGGCGCCCTATTGGGCGATGACCAGATTTATAATGTAATCGTAACTGCACATGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGCGGGTTTGGAAACTGATTAGTACCCTTAATAATTGGGGCCCCTGACATGGCTTTTCCTCGAATAAACAACATAAGCTTCTGACTCTTACCCCCCTCTTTCCTTCTTCTCCTAGCATCATCTGGGGTTGAAGCCGGAGCAGGGACAGGTTGAACTGTTTACCCACCTCTAGCTGGTAATTTAGCGCATGCAGGGGCGTCCGTTGATTTAACAATTTTTTCGCTTCACTTAGCAGGAATCTCATCGATTCTAGGGGCAATTAATTTTATTACCACCATCCTTAATATAAAACCCCCCGCCACCTCACAGTACCAAACACCCCTTTTCGTGTGGGCTGTCTTAATTACAGCCGTACTTCTTCTACTATCACTACCCGTCCTTGCTGCCGGCATTACAATGCTACTCACAGACCGAAACCTTAACACAACCTTCTTTGACCCCGCAGGAGGAGGGGACCCTATTCTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fusigobius inframaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!