Overview

Comprehensive Description

Biology

Solitary on sand at base of coral overhangs (Ref. 90102). Specimens collected from sand or sand and rubble substrata.
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Saudi Arabia, Oman, Mauritius, and Kenya (10683); Japan (Ref. 43239) and Indonesia (Ref. 47567). Recently reported from Tonga (Ref. 53797).
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 9; Analspines: 1; Analsoft rays: 7 - 8; Vertebrae: 26
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 45.5 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

4.6 cm SL (male/unsexed; (Ref. 10683))
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by semi-translucent body, presence of small orange spots, and 4-5 large internal blackish blotches and rectangular white marks; elongate and filamentous first two dorsal spines especially in male; fully united pelvic fins; presence of pelvic frenum; rounded caudal fin; longitudinal scale series 25-26; ctenoid scales except cycloid on nape, breast and base of pectoral fin; scales absent on operculum; median predorsal scales absent; opening of gill extending to below posterior half of opercle; depth of body 4.8-5.2 in SL (Ref. 90102).
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 2 - 30 m (Ref. 10683)
  • Randall, J.E. 1994 A new genus and six new gobiid fishes (Perciformes: Gobiidae) from Arabian waters. Fauna Saudi Arabia 14:317-340. (Ref. 10683)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 16 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 2 - 15.5
  Temperature range (°C): 25.709 - 28.749
  Nitrate (umol/L): 0.122 - 0.919
  Salinity (PPS): 32.279 - 35.312
  Oxygen (ml/l): 4.388 - 4.748
  Phosphate (umol/l): 0.110 - 0.350
  Silicate (umol/l): 1.331 - 4.452

Graphical representation

Depth range (m): 2 - 15.5

Temperature range (°C): 25.709 - 28.749

Nitrate (umol/L): 0.122 - 0.919

Salinity (PPS): 32.279 - 35.312

Oxygen (ml/l): 4.388 - 4.748

Phosphate (umol/l): 0.110 - 0.350

Silicate (umol/l): 1.331 - 4.452
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fusigobius inframaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TAGTGGGNACCGCACTAAGTCTGCTTATTCGAGCCGAACTCAGTCAACCCGGCGCCCTATTGGGCGATGACCAGATTTATAATGTAATCGTAACTGCACATGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGCGGGTTTGGAAACTGATTAGTACCCTTAATAATTGGGGCCCCTGACATGGCTTTTCCTCGAATAAACAACATAAGCTTCTGACTCTTACCCCCCTCTTTCCTTCTTCTCCTAGCATCATCTGGGGTTGAAGCCGGAGCAGGGACAGGTTGAACTGTTTACCCACCTCTAGCTGGTAATTTAGCGCATGCAGGGGCGTCCGTTGATTTAACAATTTTTTCGCTTCACTTAGCAGGAATCTCATCGATTCTAGGGGCAATTAATTTTATTACCACCATCCTTAATATAAAACCCCCCGCCACCTCACAGTACCAAACACCCCTTTTCGTGTGGGCTGTCTTAATTACAGCCGTACTTCTTCTACTATCACTACCCGTCCTTGCTGCCGGCATTACAATGCTACTCACAGACCGAAACCTTAACACAACCTTCTTTGACCCCGCAGGAGGAGGGGACCCTATTCTATACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fusigobius inframaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!