Overview
Comprehensive Description
Biology
Oceanic and mesopelagic, found in the upper 100 m south of 50°S, but below 550 m in the region of Subtropical Convergence (Ref. 4066). Migrates from 80 to 140 m to the surface at about 18h00 with ascent rate of 0.5 m per minute; the descent rate is 1.8 m per minute. Forms the main component of the Deep Scattering Layer in the Pacific sector. Feeds on copepods, hyperiids and euphausiids, but also takes ostracods and gastropods. Eaten by squid and to an insignificant degree, by fishes (Channichthyidae, Notolepis sp.) and birds (Procellariidae). Maximum depth from Ref. 58018.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
Trusted
Distribution
Circumglobal between the Subtropical Convergence and Antarctic Polar Front.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
Trusted
New Zealand Exclusive Economic Zone
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
Trusted
Physical Description
Morphology
Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 15; Analspines: 0; Analsoft rays: 18 - 20
-
Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
http://www.fishbase.org/references/FBRefSummary.php?id=4066&speccode=10238
Trusted
Size
Max. size
9.0 cm SL (male/unsexed; (Ref. 5182)); 9.6 cm SL (female); max. published weight: 12.1 g (Ref. 5182); max. published weight: 14.6 g; max. reported age: 6 years (Ref. 31516)
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
-
Linkowski, T.B. 1987 Age and growth of four species of Electrona (Teleostei, Myctophidae). Proc. V Congr. Europ.Ichthyol.,Stockholm p. 435-442. (Ref. 31516)
http://www.fishbase.org/references/FBRefSummary.php?id=31516&speccode=6984
Trusted
Ecology
Habitat
Environment
bathypelagic; oceanodromous (Ref. 51243); marine; depth range 100 - 350 m (Ref. 4066)
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
-
Hulley, P.A. 1986 Myctophidae. p. 282-321. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4066)
http://www.fishbase.org/references/FBRefSummary.php?id=4066&speccode=10238
Trusted
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 94 specimens in 1 taxon.
Water temperature and chemistry ranges based on 90 samples.
Environmental ranges
Depth range (m): 0 - 25878
Temperature range (°C): -0.626 - 14.216
Nitrate (umol/L): 15.280 - 43.853
Salinity (PPS): 33.795 - 34.766
Oxygen (ml/l): 0.341 - 7.750
Phosphate (umol/l): 1.195 - 3.188
Silicate (umol/l): 5.468 - 121.173
Graphical representation
Depth range (m): 0 - 25878
Temperature range (°C): -0.626 - 14.216
Nitrate (umol/L): 15.280 - 43.853
Salinity (PPS): 33.795 - 34.766
Oxygen (ml/l): 0.341 - 7.750
Phosphate (umol/l): 1.195 - 3.188
Silicate (umol/l): 5.468 - 121.173
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 90 samples.
Environmental ranges
Depth range (m): 0 - 25878
Temperature range (°C): -0.626 - 14.216
Nitrate (umol/L): 15.280 - 43.853
Salinity (PPS): 33.795 - 34.766
Oxygen (ml/l): 0.341 - 7.750
Phosphate (umol/l): 1.195 - 3.188
Silicate (umol/l): 5.468 - 121.173
Graphical representation
Depth range (m): 0 - 25878
Temperature range (°C): -0.626 - 14.216
Nitrate (umol/L): 15.280 - 43.853
Salinity (PPS): 33.795 - 34.766
Oxygen (ml/l): 0.341 - 7.750
Phosphate (umol/l): 1.195 - 3.188
Silicate (umol/l): 5.468 - 121.173
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Migration
Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
-
Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
http://www.fishbase.org/references/FBRefSummary.php?id=51243&speccode=4683
Trusted
Trophic Strategy
Oceanic and mesopelagic, found in the upper 100 m south of 50°S, but below 550 m in the region of Subtropical Convergence (Ref. 4066). Feeds on copepods, hyperiids and euphausiids, but also takes ostracods and gasteropods.
-
Hulley, P.A. 1990 Myctophidae. p. 146-178. In O. Gon and P.C. Heemstra (eds.) Fishes of the Southern Ocean. J.L.B. Smith Institute of Ichthyology, Grahamstown, South Africa. (Ref. 5182)
http://www.fishbase.org/references/FBRefSummary.php?id=5182&speccode=6981
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Electrona carlsbergi
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 8 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTACCTAATCTTCGGTGCCTGAGCAGGCATAGTAGGAACTGCCCTCAGTCTCCTAATTCGAGCCGAACTCAGCCAACCTGGGGCCCTCCTGGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCACGCCTTTGTAATAATCTTCTTTATAGTTATACCCATTATGATTGGGGGTTTCGGAAACTGACTTATCCCCCTTATAATTGGGGCCCCCGATATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTTCCCCCTTCCTTCCTCCTCCTTCTGGCCTCCTCCGGGGTAGAAGCCGGGGCCGGGACCGGCTGAACAGTCTATCCCCCGCTTGCCGGGAACCTAGCCCACGCCGGGGCCTCTGTTGACCTAACAATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCAATTAACTTTATTACAACCATCATTAATATAAAACCCCCTGCAATCTCCCAGTACCAAACCCCCTTATTTGTTTGAGCCGTCCTCATTACAGCTGTCCTTCTACTTCTTTCACTACCCGTACTAGCTGCCGGCATCACAATACTTTTAACAGACCGAAATCTAAATACCACCTTCTTCGACCCCTCAGGCGGGGGAGACCCCATCCTCTACCAACACTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Electrona carlsbergi
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 14
Species With Barcodes: 1
Public Records: 7
Specimens with Barcodes: 14
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


