Overview

Comprehensive Description

Biology

Oceanic and mesopelagic, found in the upper 100 m south of 50°S, but below 550 m in the region of Subtropical Convergence (Ref. 4066). Migrates from 80 to 140 m to the surface at about 18h00 with ascent rate of 0.5 m per minute; the descent rate is 1.8 m per minute. Forms the main component of the Deep Scattering Layer in the Pacific sector. Feeds on copepods, hyperiids and euphausiids, but also takes ostracods and gastropods. Eaten by squid and to an insignificant degree, by fishes (Channichthyidae, Notolepis sp.) and birds (Procellariidae). Maximum depth from Ref. 58018.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Circumglobal between the Subtropical Convergence and Antarctic Polar Front.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

New Zealand Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern circumglobal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 13 - 15; Analspines: 0; Analsoft rays: 18 - 20
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 90 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

9.0 cm SL (male/unsexed; (Ref. 5182)); 9.6 cm SL (female); max. published weight: 12.1 g (Ref. 5182); max. published weight: 14.6 g; max. reported age: 6 years (Ref. 31516)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

bathypelagic; oceanodromous (Ref. 51243); marine; depth range 100 - 350 m (Ref. 4066)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 94 specimens in 1 taxon.
Water temperature and chemistry ranges based on 90 samples.

Environmental ranges
  Depth range (m): 0 - 25878
  Temperature range (°C): -0.626 - 14.216
  Nitrate (umol/L): 15.280 - 43.853
  Salinity (PPS): 33.795 - 34.766
  Oxygen (ml/l): 0.341 - 7.750
  Phosphate (umol/l): 1.195 - 3.188
  Silicate (umol/l): 5.468 - 121.173

Graphical representation

Depth range (m): 0 - 25878

Temperature range (°C): -0.626 - 14.216

Nitrate (umol/L): 15.280 - 43.853

Salinity (PPS): 33.795 - 34.766

Oxygen (ml/l): 0.341 - 7.750

Phosphate (umol/l): 1.195 - 3.188

Silicate (umol/l): 5.468 - 121.173
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Oceanic and mesopelagic, found in the upper 100 m south of 50°S, but below 550 m in the region of Subtropical Convergence (Ref. 4066). Feeds on copepods, hyperiids and euphausiids, but also takes ostracods and gasteropods.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Electrona carlsbergi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATCTTCGGTGCCTGAGCAGGCATAGTAGGAACTGCCCTCAGTCTCCTAATTCGAGCCGAACTCAGCCAACCTGGGGCCCTCCTGGGGGACGACCAGATTTATAATGTAATCGTAACAGCTCACGCCTTTGTAATAATCTTCTTTATAGTTATACCCATTATGATTGGGGGTTTCGGAAACTGACTTATCCCCCTTATAATTGGGGCCCCCGATATGGCATTCCCCCGAATAAATAACATAAGCTTCTGACTCCTTCCCCCTTCCTTCCTCCTCCTTCTGGCCTCCTCCGGGGTAGAAGCCGGGGCCGGGACCGGCTGAACAGTCTATCCCCCGCTTGCCGGGAACCTAGCCCACGCCGGGGCCTCTGTTGACCTAACAATCTTCTCCCTCCACCTAGCAGGTGTCTCCTCAATCTTAGGCGCAATTAACTTTATTACAACCATCATTAATATAAAACCCCCTGCAATCTCCCAGTACCAAACCCCCTTATTTGTTTGAGCCGTCCTCATTACAGCTGTCCTTCTACTTCTTTCACTACCCGTACTAGCTGCCGGCATCACAATACTTTTAACAGACCGAAATCTAAATACCACCTTCTTCGACCCCTCAGGCGGGGGAGACCCCATCCTCTACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Electrona carlsbergi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!