Overview

Comprehensive Description

Biology

Inhabits coral rich areas of inner lagoons and subtidal reef flats to seaward reefs (Ref. 1602). Feeds on crustacean ectoparasites and mucus of other fishes (Ref. 9823, 48636). Monogamous (Ref. 52884). A protogynous hermaphrodite (Ref. 55367). Stays in stations where other fish come to be cleaned. Cleaning intensity is not related to client size or commonness (Ref. 28019). Cleaning stations are occupied by a pair of adults, a group of juveniles or a group of females accompanied by a dominant male where a female becomes a functional male if the dominant male disappears (Ref. 5503). Some adults solitary and territorial. An unfamiliar visitor is usually greeted by dance-like movements with the tail maneuvering the back part of the body up and down. Juveniles behave this way when divers approach closely (Ref. 48636). Minimum depth range of 1 meter in Ref. 27115.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (Ref. 4392) to the Line, Marquesan, and Ducie islands, north to southern Japan, south to Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is found in the Indo-Pacific from southern and eastern Africa and the Red Sea to the Tuamotus in the south Pacific, and from southern Japan to the southern Great Barrier Reef and south-western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Blue streak wrasses inhabit Indo-pacific coral reefs, including the Great Barrier Reef. They range from Queensland and the South Seas through the East Indies to the Red Sea, Zanzibar and Mauritius (Marshall, 1964)

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Comores, Kenya, Madagascar, Mauritius, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Wake Atoll and Pitcairn Group, north to southern Japan, south to Western Australia, Lord Howe Island, New Caledonia and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 10
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Adult blue streak wrasses usually grow to be 4 inches long (Grant,1978).

Wrasses possess a smooth, compressed, elongate body with a pointed snout. They have small mouths with prominent lips. They have jaws and teeth, particularly 2 canines that are curved anteriorly in each jaw.

Wrasses have a rounded caudal fin along with a dorsal fin consisting of 9 spines and 9-11 rays and an anal fin with 2-3 spines and 9-10 rays (Marshall, 1964). Wrasses have very small scales and the head is normally scaleless.

Blue streak wrasses are brilliant blue with a broad jet-black band that runs from the tip of the snout to the end of the tail, starting out narrow at the anterior end and gradually broadening towards the posterior end. This band usually takes up most of the tail, except the upper and lower rays which are a shade of blue (Marshall, 1966). Young wrasses are sometimes all black, except for a pale streak along the lower, upper and back caudal rays (Marshall, 1964).

The colors of young and adult wrasses differ (Smith, 1965). They are also known to change colors based on mood (Grant, 1978).

There is no geographic variation in morphology or coloration.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 115 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

14.0 cm TL (male/unsexed; (Ref. 55367)); max. reported age: 4 years (Ref. 3426)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Often with yellow back in deep water (Ref. 48636). Scales on lateral line: 50-52 (+2 past hypural) (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits coral rich areas of inner lagoons and subtidal reef flats to seaward reefs at depths of over 40 m (Ref. 1602). Feeds on crustacean ectoparasites and mucus of other fishes (Ref. 9823). Stays in stations where other fish come to be cleaned. Cleaning stations are occupied by a pair of adults, a group of juveniles or a group of females accompanied by a dominant male where a female becomes a functional male if the dominant male disappears (Ref. 5503).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 40 m (Ref. 9710), usually 1 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits coral rich areas and subtidal reef flats to seaward reefs to depths of at least 40 m. It is widely reported to be a monandric hermaphrodite but further confirmed to display bi-directional sex-change, exhibits socially controlled sex reversal and lives in single-male, multiple female social groups (Kuwamura 1984, Sadovy and Cornish 2000, Kuwamura et al. 2002, Sadovy de Mitcheson and Liu 2008). Males exhibit territoriality and the largest, oldest individual is a male which dominates all the females in the group (Robertson 1972, Nakashima et al. 2000).

It feeds on crustaceans ectoparasites and mucus of fishes which gather at specific cleaning ‘stations’ for attention (Pott 1973). Males and females are the same in colour, juveniles are black with a single blue stripe running from snout to the upper part of caudal fin.

It is active in daytime and is reported to be able to produce a protective mucous cocoon at night. Seasonal fluctuation of the activity rate has been observed with almost all individuals always active during late spring and early summer (Kuwamura 1981).

In Japan, spawning occurred within 4-5 months of the year, from late May to early September. Larvae of about 1.8 mm in total length hatch at 30 hours after spawning (Kuwamura 1981).

This species is monochromatic, spawns in harem. Spawning ascent distance was about three m with rapid ascending speed. Spawning activities were seen in March, May, June and November at Enewetak Atoll, Marshall Islands (Colin and Bell 1991). The size of eggs is approximately 0.64 mm and spherical in shape. Eggs contained multiple oil globules

Maximum size of species has been recorded at 22 cm (TL) in New Caledonia and maturity is reached at a size of about six cm TL (Kuwamura 1981, M. Kulbicki pers. comm.). All of the larger adults have an almost completely developed ventroanterior hook in the caudal fin. Maximum lifespan is estimated to be four years (Allsop and West 2003) and minimum population doubling time is approximately 1.4-4.4 years (Froese and Pauly 2008).

It shows cleaning behaviour, which only occurs during the day and particularly in the early morning (Grutter 1996). In captivity it is affected by abundance and size-frequency distribution of the monogenean parasites on the host of fishes, which was more pronounced on larger fish than on small fish (Grutter et al. 2002). It spends 60 to 154 more times cleaning larger fishes (> 12.5 cm SL) than medium (9.5 to 12.5 cm SL) or small sized fish (
It consumes a large number of parasites (1218 +/- 118) each day or 4.8 +/- 0.4 parasites per minute (Grutter 1996) and most of the prey items were juvenile gnathiid isopods (Grutter 1997). The biomass of gnathiids in the diet in New Caledonia was lower than at Lizard Island, but higher than at Heron Island, suggesting that the role of gnathiids in cleaning behaviour is variable (Grutter 1999).

At One Tree Lagoon on the Great Barrier Reef, overall mortality during first year for L. dimidiatus was 50%, juveniles do not shelter within the substratum and displayed relatively high mortality over the first twelve months (Eckert 1987). The average annual mortality ofL. dimidiatus was 11.1 +/- 2.2 %.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Striped cleaner wrasses tend to dwell in coral or rocky areas on coral reefs (Roughley, 1951). They are commonly found in waters adjacent to shallow coral outcrops along the Great Barrier Reef (Grant, 1978). They are also seen in tide-pools. (Smith, 1965)

They are not migratory.

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 502 specimens in 1 taxon.
Water temperature and chemistry ranges based on 311 samples.

Environmental ranges
  Depth range (m): 0.15 - 99
  Temperature range (°C): 20.792 - 29.336
  Nitrate (umol/L): 0.019 - 5.255
  Salinity (PPS): 32.185 - 40.307
  Oxygen (ml/l): 3.591 - 5.079
  Phosphate (umol/l): 0.055 - 0.567
  Silicate (umol/l): 0.567 - 10.063

Graphical representation

Depth range (m): 0.15 - 99

Temperature range (°C): 20.792 - 29.336

Nitrate (umol/L): 0.019 - 5.255

Salinity (PPS): 32.185 - 40.307

Oxygen (ml/l): 3.591 - 5.079

Phosphate (umol/l): 0.055 - 0.567

Silicate (umol/l): 0.567 - 10.063
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 40m.
From 1 to 40 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits coral rich areas of inner lagoons and subtidal reef flats to seaward reefs (Ref. 1602). Feeds on crustacean ectoparasites and mucus of other fishes (Ref. 9823, 48636). Monogamous (Ref. 52884). Stays in stations where other fish come to be cleaned. Cleaning intensity is not related to client size or commonness (Ref. 28019). Cleaning stations are occupied by a pair of adults, a group of juveniles or a group of females accompanied by a dominant male where a female becomes a functional male if the dominant male disappears (Ref. 5503). An unfamiliar visitor is usually greeted by dance-like movements with the tail maneuvering the back part of the body up and down. Juveniles behave this way when divers approach closely (Ref. 48636). A small body size and the presence of a lateral stripes both contribute as long-distance signals of cleaning services for fish clients (Ref. 75868).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Wrasses are carnivorous. Their diet consists primarily of parasitic copepods and other invertebrates that are taken from the mouth and gill openings of larger fish. They also feed occasionally on free-swimming crustaceans.

Blue streak wrasses are known as common cleaner fish that set up cleaning stations on various parts of coral reefs, usually 3-10ft. deep. They attract larger fish to their stations by making strange, oscillatory swimming movements, and the fish then stop to get cleaned. Wrasses enter the mouth and gill openings and remove any ectoparasites and diseased tissue. The larger fish not only refrain from devouring these small cleaner fish, but actually readily open their mouth and gill cavities so that they are able to clean.

This is clearly a mutualistic relationship between cleaner wrasses and various larger fish of the ocean (Grant, 1978).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawners. Sex reversal is completed in 14-18 days (Ref. 34185, 34258). A monandric species (Ref. 55367). Length at sex change = 8.8 cm TL (Ref. 55367).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
4 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Wrasses practice external fertilization in which the female's eggs are released into the water. Mating usually occurs at twilight (Flying Fish Express)

Large males defend reef territories and attract multiple females to these territories, usually by performing a beautiful mating dance. Females live within these territories and spawn with the male. Fertilized eggs form planktonic larvae that move freely with the ocean currents. If the territorial male leaves or dies, the most dominant female will take his role and become male within the next 24 hours. She assumes the territory and mates with the rest of the females.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Labroides dimidiatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCCTGAGCCGGCATAGTAGGCACAGCCTTGAGCCTACTTATTCGAGCTGAATTAAGCCAACCCGGCGCTCTCCTGGGAGATGACCAAATCTACAATGTAATCGTTACAGCCCATGCGTTTGTAATGATTTTCTTTATAGTAATACCAATTATAATCGGAGGATTCGGAAACTGGCTTATCCCCTTAATAATTGGTGCGCCTGACATGGCTTTTCCTCGAATGAACAACATGAGTTTTTGACTCCTCCCCCCATCCTTCCTACTTCTTCTTGCCTCCTCCGGTGTAGAAGCAGGCGCTGGAACCGGTTGAACAGTTTATCCCCCTTTAGCCGGAAATTTAGCTCACGCAGGAGCATCTGTTGATCTTACCATTTTCTCCCTCCACCTGGCCGGTATTTCATCCATCCTAGGAGCTATTAATTTCATTACAACTATTATTAATATGAAACCCCCTGCTATTTCTCAATATCAAACACCTCTCTTCGTCTGAGCGGTATTAATTACAGCTGTCCTTCTTCTCCTTTCCCTTCCAGTCCTTGCTGCCGGCATTACAATACTCCTAACAGACCGAAACCTTAATACTACTTTCTTCGACCCTGCAGGAGGGGGAGACCCTATTCTATATCAGCACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Labroides dimidiatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at State Herbarium of South Australia
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S. & Liu, M.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is abundant throughout the Indo-Pacific. Although it is intensively collected for the aquarium trade, it is not thought to be contributing to any widespread population decline. It is listed as Least Concern. More research is needed on sustainable harvest levels and the impact of collection on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common in many parts of its range.

It is common in the southern coral areas of the Ryukyu Islands and Ogasawara Islands (Kataoka et al. 1970), on the inshore rocky reefs, whereas it does not live on the sand or pebble areas (Kuwamura 1981). The populations increased in summer and autumn, but decreased in winter, sometimes nearly zero. About 0.9 individuals per 100 m2 have been recorded at rocky reefs at Shirahama (Kuwamura 1981).

It is common in the Capricorn/ Bunker Group, One Tree and Heron Islands and Wistari Reef, Fairfax, Fitzroy, Llewellyn and Musgrave Islands on the Great Barrier Reef, with 1.77 recruits per 100m2 (Eckert 1984).

In Australia, it was found to be one of the most abundant labrids at Lizard Island, GBR (three individuals per 150 m2) and occurred in similar densities in all habitat zones (Green 1996).

In Hong Kong, it is common in shallow areas of boulders and coral areas, but never abundant (Sadovy and Cornish 2000).

In Fiji, a total of 475 individuals were observed in various UVC surveys with body sizes of 4-17 cm TL (M. Kulbicki pers. comm. 2008).

In New Caledonia, a total of 1,407 individuals were observed in various UVC surveys with body sizes of 3-22 cm TL. In 31 stations, a total of 58 individuals were caught with a total weight of 242.1 g (M. Kulbicki pers. comm. 2008).

In French Polynesia, a total of 568 individuals were observed in various UVC surveys with body sizes of 4-12 cm TL (M. Kulbicki pers. comm. 2008)

In Tonga, a total of 205 individuals were observed in various UVC surveys with body sizes of 3-11 cm TL (M. Kulbicki pers. comm. 2008).

Mean density was 1.5 fish per 100 m2 on coral reefs of the Adang-ra Wi Islands in the Adaman Sea (Satapoomin undated).

It is common at Enewetak Atoll, Marshall Islands (Colin and Bell 1991), Solomon Islands (Allen 2006) and in the Red Sea (Richard and Field 1998).

In Pangkor Island, Malaysia an estimated mean density of 0.33 individuals from three 100 m X 2 m transects was recorded in underwater fish visual surveys (Y. Yusuf unpublished data).

On the east coast of Peninsular Malaysia, an estimated mean density of 4.55 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
There are no major threats known for this species, although it is targeted for the aquarium trade and there are occuring coral habitat degradation in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.

This species has been observed at protected areas on the Great Barrier Reef, Australia (Hutchins and Sawinston 1996), at Ras Mohammed National Park, Egypt (Bshary 2003) and in the Mafia Island Marine Park, Tanzania (Garpe and Öhman 2003). Given the intensive collection of this species for the aquarium trade, more research is needed on the local and global impact of collection, as well as on the implementation of sustainable harvest and trade measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Wrasses are not known to have any negative affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Cleaner wrasses benefit humans by increasing the survival of various economically important fish. They increase the survival of larger fish by eating and removing harmful parasites and diseased tissue from their scales and body.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bluestreak cleaner wrasse

A school of porcupinefish (Diodon holacanthus) waiting for the cleaning services provided by two cleaner wrasses. Northeast coast, Taiwan

The bluestreak cleaner wrasse (Labroides dimidiatus) is one of several species of cleaner wrasse found on coral reefs in the Indian Ocean and much of the Pacific Ocean, as well as many seas, including the Red Sea and those around Southeast Asia. Like other cleaner wrasses, it eats parasites and dead tissue off larger fishes' skin in a mutualist relationship that provides food and protection for the wrasse, and considerable health benefits for the other fish.[1][2]

Behavior [edit]

A pair of cleaner wrasse servicing a sweetlips at a cleaning station in East Timor
Cleaner wrasse on an Epinephelus tukula

Cleaner wrasses usually can be found around cleaning stations. The bigger fish recognise them as cleaner fish because they have a lateral stripe along the length of the body[3] and by their movement patterns. Upon recognising the cleaner and successfully soliciting its attention, client fish adopt a species specific pose to allow the cleaner access to its body surface, gills and sometimes mouth. A species of blenny called Aspidontus taeniatus has evolved this behavior as mimicry, in order to tear small pieces of flesh from bigger fish. Another species the bluestreak fangblenny, Plagiotremus rhinorhynchos, mimics juvenile cleaner wrasse so that its presence is tolerated by the cleaners and, it is assumed, can take advantage of the concentration of potential victims[4]

All cleaner wrasses start their lives as females. In a group of 6–8 cleaner wrasses there is only one male, the rest are females or juveniles. The strongest female changes its sex when the male dies, an occurrence known as sequential hermaphroditism.

Cleaner wrasses sleep in crevices between rocks or corals, covered in a slime layer that is secreted at dusk. In the morning these can be seen floating on the surface. They live about four years and can grow up to four inches.

References [edit]

  1. ^ Côté, I.M. (2000). "Evolution and ecology of cleaning symbioses in the sea". Oceanography and Marine Biology 38 (1): 311–355. 
  2. ^ Johnsom, M.L. (2012). Biodiversity Sciences http://www.biodiversityscience.com/2012/01/31/high-street-cleaners/ |url= missing title (help). 
  3. ^ Stummer, L.E., Weller, J.A., Johnson, M.L., & Côté, I.M. (2005). "Size and stripes: how clients recognise cleaners". Animal Behaviour 68 (1): 145–150. doi:10.1016/j.anbehav.2003.10.018. 
  4. ^ Johnson, Magnus and Hull, Susan (2006). "Interactions between fangblennies (Plagiotremus rhinorhynchos) and their potential victims: fooling the model rather than the client?". Marine Biology 148 (1): 889–897. doi:10.1007/s00227-005-0118-y. 

Further reading [edit]

  • Meulengracht-Madsen, Jens: (1976) Akvariefisk i farger, J.W. Cappelens forlag AS
  • Labroides dimidiatus at FishBase
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!