Overview

Brief Summary

Sang Spektakuler "Amphiprion clarkii"

Clownfish Clarkii atau Amphiprion clarkii adalah ikan nemo yang memiliki distribusi yang luas. Ikan ini dapat ditemukan di perairan tropis, laguna dan di lereng terumbu. Amphiprion clarkii merupakan ikan yang memiliki warna-warni yang menarik, dengan garis-garis hitam, putih dan kuning cerah, pola warna ini menunjukkan variasi geografis yang cukup besar, namun umumnya pada tubuh ikan ini ada dua garis putih, satu di belakang mata dan satu di atas anus. Jenis ikan Badut ini memiliki tubuh yang kuning-oranye dengan garis-garis putih vertikal di sepanjang tubuh mereka. Sirip ekor berwarna putih atau kuning, namun warnanya selalu lebih halus dari warna tubuhnya.

Amphiprion clarkii merupakan spesies ikan akuarium yang cukup terkenal. Ikan ini adalah jenis ikan omnivora. Mereka umunya menjadi tuan rumah dalam anemon laut. Ikan badut ini tidak begitu memerlukan Anemone untuk bertahan hidup, tetapi mereka mudah dan akan menerima berbagai jenis anemone berbeda untuk di tinggali, termasuk karang. Amphiprion clarkii umum ditemukan berenang di antara tentakel Anemon baik besar dan kecil, maupun di terumbu karang yang spektakuler.Ikan ini jarang ditemukan di laut dalam, karena biasanya habitat tinggalnya yang berupa anemone dan karang berada di perairan dangkal dengan penetrasi cahaya yang cukup sebagai bahan dasar fotosintesis zooxanthellae.

Ikan Amphiprion clarkii memproduksi lendir pelindung yang menutupi tubuh mereka untuk mencegah sengatan dari Anemon. Produksi lender ini dapat dilakukan dengan dua cara: pertama ikan menyerap lendir dari Anemones itu sendiri, yang mereka gunakan untuk melindungi tubuhnya agar tidak menyengat tubuh sendiri, atau mereka menghasilkan lendir sendiri yang reaktif terhadap sengatan anemon. Amphiprion clarkii memiliki gerakan renang yang sangat berbeda yang berbeda dari kebanyakan ikan. Hal ini mungkin diturunkan melalui susunan genetik mereka. Ikan Butterflyfish merupakan predator dari ikan Amphiprion clarkii. Ikan ini bersifat hermafrodit. Ikan ini memiliki hierarki sosial yang ketat. Di alam bebas ikan ini hidup dalam kelompok kecil dengan satu perempuan yang dominan besar, satu laki-laki yang aktif secara seksual lebih kecil, dan beberapa laki-laki lebih kecil dan remaja. Ketika perempuan itu hilang, maka jantan terbesar akan berubah kelamin dan menjadi perempuan.

Amphiprion clarkii sering melakukan tugas bersih-bersih pada tubuh anemon yaitu dengan cara memunguti remah-remah makanan atau kotoran lainnya sehingga tubuh anemon bisa terbebas dari berbagai jenis parasit, dan ikan ini sering membawakan makanan bagi anemon.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Fredy M. Aritonang

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit lagoons and outer reef slopes. Omnivorous. Oviparous, with elliptical eggs (Ref. 240). Monogamous (Ref. 52884). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Cryptodendrum adhaesivum, Entacmaea quadricolor, Heteractis aurora, Heteractis crispa, Heteractis magnifica, Heteractis malu, Macrodactyla doreensis, Stichodactyla gigantea, Stichodactyla haddoni, and Stichodactyla mertensii (Ref. 5911). Has been observed to share home anemone with individuals of A. sandaracinos (Ref. 90000). Has been reared in captivity (Ref. 35418, 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: Persian Gulf to Western Australia, throughout the Indo-Australian Archipelago and in the western Pacific at the islands of Melanesia and Micronesia, north to Taiwan, southern Japan and the Ryukyu Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 15 - 16; Analspines: 2; Analsoft rays: 13 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 6113)); max. reported age: 11 years (Ref. 11318)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Highly variable in color and several geographical and localized forms (Ref. 48636). Two white bands, one behind the eye and one above the anus. Caudal fin white, sometimes yellowish, but always lighter than rest of the body.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits lagoons and outer reef slopes. Omnivorous. Comensal with the anemones @Cryptodendrum adhesivum@ @Entacmaea quadricolor@, @Stichodactyla mertensii@, @S. gigantea@, @S. haddoni@, @Heteractis crispa@, and @H. aurora@.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 1 - 60 m (Ref. 58652)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 70 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0.305 - 50.8
  Temperature range (°C): 24.872 - 28.954
  Nitrate (umol/L): 0.016 - 1.118
  Salinity (PPS): 32.185 - 35.361
  Oxygen (ml/l): 4.202 - 4.725
  Phosphate (umol/l): 0.073 - 0.337
  Silicate (umol/l): 0.869 - 5.552

Graphical representation

Depth range (m): 0.305 - 50.8

Temperature range (°C): 24.872 - 28.954

Nitrate (umol/L): 0.016 - 1.118

Salinity (PPS): 32.185 - 35.361

Oxygen (ml/l): 4.202 - 4.725

Phosphate (umol/l): 0.073 - 0.337

Silicate (umol/l): 0.869 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 55m.
From 1 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Inhabits lagoons and outer reef slopes. Commensal with the anemones Cryptodendrum adhesivum Entacmaea quadricolor, Stichodactyla mertensii, S. gigantea, S. haddoni, Heteractis crispa, and H. Omnivorous (Ref. 35418, 35420). Feeds on plants and invertebrates (Ref. 6110). Aurora. Has been reared in captivity (Ref. 35418, 35420).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Benthic spawner. Sex reversal is completed in less than 5-6 months (Ref. 34185). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion clarkii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAAATTTATAACGTTATTGTTACCGCACATGCCTTCGTGATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGAAACTGACTAGTACCCCTTATGCTTGGCGCCCCCGATATAGCATTCCCTCGCATAAACAACATAAGCTTCTGGCTCCTCCCTCCCTCTTTCCTTCTTCTGCTTGCTTCCTCAGGAGTTGAAGCCGGGGCCGGAACAGGCTGAACTGTATATCCCCCACTGTCTGGAAACCTAGCCCATGCAGGAGCATCCGTGGACTTAACTATTTTCTCCCTCCACCTGGCAGGTGTTTCATCAATCCTGGGAGCAATCAACTTTATCACTACCATTATTAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTTCTCCTCTCTCTCCCAGTACTAGCTGCCGGTATTACTATGCTCTTAACGGACCGAAATCTAAATACTACCTTCTTTGATCCAGCAGGGGGAGGAGATCCAATTCTCTACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion clarkii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at University of the Ryukyus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Clark's anemonefish

Clark's anemonefish or the Yellowtail clownfish (Amphiprion clarkii) is a widely distributed clownfish. It is found in tropical waters, in lagoons and on outer reef slopes, from the Persian Gulf to Western Australia and throughout the Indian Ocean and Pacific Ocean as far as Melanesia and Micronesia, and as far north as Taiwan, southern Japan and the Ryukyu Islands.

Clark's Anemonefish is a spectacularly colourful fish, with vivid black, white and yellow stripes, though the exact pattern shows considerable geographical variation. There are normally two white bands, one behind the eye and one above the anus. The tail fin may be white or yellow, but is always lighter than rest of the body. Amphiprion clarkii was recently observed to coexist with the Orange skunk clownfish Amphiprion sandaracinos within one host anemone of Stichodactyla mertensii.[1]

Clarke's Anemonefish are a popular aquarium species. They are omnivorous, and in the aquarium will readily eat brine shrimp. They regularly host many sea anemones in the home aquarium.

Amphiprion clarkii sipadan.jpg

References

  1. ^ Bos, Arthur (2012). "Clownfishes Amphiprion clarkii and A. sandaracinos (Pomacentridae) coexist in the sea anemone Stichodactyla mertensii". Coral Reefs 30: 369. doi:10.1007/s00338-010-0713-3.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!