Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Sang Spektakuler "Amphiprion clarkii"

Clownfish Clarkii atau Amphiprion clarkii adalah ikan nemo yang memiliki distribusi yang luas. Ikan ini dapat ditemukan di perairan tropis, laguna dan di lereng terumbu. Amphiprion clarkii merupakan ikan yang memiliki warna-warni yang menarik, dengan garis-garis hitam, putih dan kuning cerah, pola warna ini menunjukkan variasi geografis yang cukup besar, namun umumnya pada tubuh ikan ini ada dua garis putih, satu di belakang mata dan satu di atas anus. Jenis ikan Badut ini memiliki tubuh yang kuning-oranye dengan garis-garis putih vertikal di sepanjang tubuh mereka. Sirip ekor berwarna putih atau kuning, namun warnanya selalu lebih halus dari warna tubuhnya.

Amphiprion clarkii merupakan spesies ikan akuarium yang cukup terkenal. Ikan ini adalah jenis ikan omnivora. Mereka umunya menjadi tuan rumah dalam anemon laut. Ikan badut ini tidak begitu memerlukan Anemone untuk bertahan hidup, tetapi mereka mudah dan akan menerima berbagai jenis anemone berbeda untuk di tinggali, termasuk karang. Amphiprion clarkii umum ditemukan berenang di antara tentakel Anemon baik besar dan kecil, maupun di terumbu karang yang spektakuler.Ikan ini jarang ditemukan di laut dalam, karena biasanya habitat tinggalnya yang berupa anemone dan karang berada di perairan dangkal dengan penetrasi cahaya yang cukup sebagai bahan dasar fotosintesis zooxanthellae.

Ikan Amphiprion clarkii memproduksi lendir pelindung yang menutupi tubuh mereka untuk mencegah sengatan dari Anemon. Produksi lender ini dapat dilakukan dengan dua cara: pertama ikan menyerap lendir dari Anemones itu sendiri, yang mereka gunakan untuk melindungi tubuhnya agar tidak menyengat tubuh sendiri, atau mereka menghasilkan lendir sendiri yang reaktif terhadap sengatan anemon. Amphiprion clarkii memiliki gerakan renang yang sangat berbeda yang berbeda dari kebanyakan ikan. Hal ini mungkin diturunkan melalui susunan genetik mereka. Ikan Butterflyfish merupakan predator dari ikan Amphiprion clarkii. Ikan ini bersifat hermafrodit. Ikan ini memiliki hierarki sosial yang ketat. Di alam bebas ikan ini hidup dalam kelompok kecil dengan satu perempuan yang dominan besar, satu laki-laki yang aktif secara seksual lebih kecil, dan beberapa laki-laki lebih kecil dan remaja. Ketika perempuan itu hilang, maka jantan terbesar akan berubah kelamin dan menjadi perempuan.

Amphiprion clarkii sering melakukan tugas bersih-bersih pada tubuh anemon yaitu dengan cara memunguti remah-remah makanan atau kotoran lainnya sehingga tubuh anemon bisa terbebas dari berbagai jenis parasit, dan ikan ini sering membawakan makanan bagi anemon.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Fredy M. Aritonang

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Adults inhabit lagoons and outer reef slopes. Omnivorous. Oviparous, with elliptical eggs (Ref. 240). Monogamous (Ref. 52884). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205). Associated with the anemones: Cryptodendrum adhaesivum, Entacmaea quadricolor, Heteractis aurora, Heteractis crispa, Heteractis magnifica, Heteractis malu, Macrodactyla doreensis, Stichodactyla gigantea, Stichodactyla haddoni, and Stichodactyla mertensii (Ref. 5911). Has been observed to share home anemone with individuals of A. sandaracinos (Ref. 90000). Has been reared in captivity (Ref. 35418, 35420).
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Known as either Clark’s anemonefish or yellowtail clownfish, this species is the most widely distributed anemonefish in the Indo West Pacific, ranging from the Persian Gulf to western Australia, throughout the Indo-Australian Archipelago, Melanesia, and Micronesia, and as far north as Taiwan, southern Japan, and the Ryukyu Islands.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

  • Allen, G. 1997. Marine Fishes of Tropical Australia and South-East Asia. Perth, Australia: Western Australian Museum.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Persian Gulf to Western Australia, throughout the Indo-Australian Archipelago and in the western Pacific at the islands of Melanesia and Micronesia, north to Taiwan, southern Japan and the Ryukyu Islands.
  • Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Clark’s anemonefish are colorful, although the exact pattern shows considerable geographical variation. The base body color is usually black but may range from a yellow to brown color, with varying amounts of orange on the head, ventral areas, and fins. A vertical, white to yellowish bar is located on the head, posterior to the eye, with two more on the body: one above the anus and the other at the base of the caudal fin. However, juveniles from all geographic regions and adults from Vanuatu and New Caledonia may be mainly or entirely orange-yellow with only the two most anterior white bars. The caudal fin may be white or yellow, but is always lighter than rest of body coloration. Male caudal fins are either yellow or white with yellow edges, whereas in some females, the caudal fin may change to a solid white as they mature. Both males and females have yellow pectoral fins. Individuals that reside within Stichodactyla mertensii are frequently black except for a pale snout, with white bars on the head and body, and a yellow or white tail. Coloration may differ in additional ways, depending on the species of host anemone that the fish inhabits.

This species has a total of 10 dorsal spines, 15 to 16 soft dorsal rays, 2 anal spines, and 13 to 14 total anal soft rays. The teeth are close-set, each resembling a typical incisor. These are used to defend its host anemone from invading fish, and can inflict harm to humans if the fish is provoked.

On rare occasions, these anemonefish will develop an interesting mutation within their eyes. A pale blue crescent will appear in the upper part of the iris, often referred to as “Pearl Eyes.” Individuals with this trait are highly desirable within the aquarium trade.

Range length: 14 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 10; Dorsal soft rays (total): 15 - 16; Analspines: 2; Analsoft rays: 13 - 14
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 6113)); max. reported age: 11 years (Ref. 11318)
  • Anderson, C. and A. Hafiz 1987 Common reef fishes of the Maldives. Part 1. Novelty Press, Republic of Maldives. 83 p. (Ref. 6113)
  • Moyer, J.T. 1986 Longevity of the anemonefish Amphiprion clarkii at Miyake-jima, Japan with notes on four other species. Copeia 1986(1):135-139. (Ref. 11318)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Highly variable in color and several geographical and localized forms (Ref. 48636). Two white bands, one behind the eye and one above the anus. Caudal fin white, sometimes yellowish, but always lighter than rest of the body (Ref. 1602). Caudal peduncle with another white bar; caudal fin white or yellow, the rest of median fins variable in color from yellow-orange to black. Body depth 1.7-2.0 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Inhabits lagoons and outer reef slopes. Omnivorous. Comensal with the anemones @Cryptodendrum adhesivum@ @Entacmaea quadricolor@, @Stichodactyla mertensii@, @S. gigantea@, @S. haddoni@, @Heteractis crispa@, and @H. aurora@.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Clark's anemonefish inhabit coral reefs, sheltered lagoons, and steep edges of reefs up to a depth of 60 meters. This species is always found living within the tentacles of sea anemones (Class Anthozoa). Although they are often found near anemones such as Entacmaea quadricolor, Heteractis magnifica, and Stichodactyla gigantea, they are known to naturally associate with all 10 of the anemone species known to host clownfishes.

Range depth: 1 to 60 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; non-migratory; marine; depth range 1 - 60 m (Ref. 58652)
  • Broad, G. 2003 Fishes of the Philippines. Anvil Publishing, Inc., pasi City. 510 pp. (Ref. 58652)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 70 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0.305 - 50.8
  Temperature range (°C): 24.872 - 28.954
  Nitrate (umol/L): 0.016 - 1.118
  Salinity (PPS): 32.185 - 35.361
  Oxygen (ml/l): 4.202 - 4.725
  Phosphate (umol/l): 0.073 - 0.337
  Silicate (umol/l): 0.869 - 5.552

Graphical representation

Depth range (m): 0.305 - 50.8

Temperature range (°C): 24.872 - 28.954

Nitrate (umol/L): 0.016 - 1.118

Salinity (PPS): 32.185 - 35.361

Oxygen (ml/l): 4.202 - 4.725

Phosphate (umol/l): 0.073 - 0.337

Silicate (umol/l): 0.869 - 5.552
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 55m.
From 1 to 55 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

This species primarily consumes planktonic food such as zooplankton, copepods, and algae. In some cases, they have been observed to consume parasites found on their host anemone. Feeding behavior is affected by the hierarchical structure of the group within the host anemone. Smaller fish, which experience the greatest amount of aggression, have less energy to venture outside the anemone to forage, thus forcing them to remain within a close distance to their host. This may be beneficial to the overall survival of the population, as those smaller fish are better protected from the predation that the older and larger dominant fish are subjected to while foraging a few meters from their host anemone.

Animal Foods: eggs; aquatic crustaceans; zooplankton

Plant Foods: algae

Other Foods: microbes

Primary Diet: omnivore ; planktivore

  • Nose, Y. 1985. Food habits of teleostean reef fishes in Okinawa Island, Southern Japan. Tokyo, Japan: University of Tokyo Press.
  • Sano, M., M. Shimizu, Y. Nose. 1984. Food habits of teleostean reef flshes in Okinawa Island, southern Japan. Univ. Mus., Univ. Tokyo, Bull. 25: 1-128.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs inshore (Ref. 75154). Inhabits lagoons and outer reef slopes. Commensal with the anemones Cryptodendrum adhesivum Entacmaea quadricolor, Stichodactyla mertensii, S. gigantea, S. haddoni, Heteractis crispa, and H. Omnivorous (Ref. 35418, 35420). Feeds on plants and invertebrates (Ref. 6110). Aurora. Has been reared in captivity (Ref. 35418, 35420).
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Clark's anemonefish form mutualistic symbiotic relationships with all anemone species that are known to host anemone- and clownfishes. In this relationship, the anemonefish receives shelter and a protected nesting location, while the host anemone receives defense from its resident anemonefishes. Anemones remain healthier while hosting anemonefish, developing terminal bulbs on the tips of the tentacles and thereby increasing the amount of surface area from which the photosynthetic algae housed within the anemone’s tentacles can capture solar energy. These bulbs do not develop in anemones lacking anemonefish.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Larval anemonefish are extremely susceptible to predation as they are small, poor swimmers, resulting in very high mortality rates while in the planktonic stage. Predation on adult and juvenile anemonefishes is greatly reduced due to the protection conferred by the host anemone, whose sting deters potential predators. The eggs are more susceptible to predation, mainly by wrasses and pomacentrid damselfishes. Egg predation increases at night, when the male is not guarding them.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Hierarchical social structure is maintained through an array of aggressive tactics by larger fish towards the smaller individuals residing in the host anemone. Juvenile Clark's anemonefish are able to find host anemones through olfactory imprinting that occurs as the eggs develop in the nest. Anemone selection occurs as a ritualistic swimming pattern in which the fish will repeatedly brush up against the tentacles of the potential host anemone. If the anemone is found to be unsuitable in some way, the fish will move on to another anemone and repeat the process until a suitable host is found. Special chemicals contained within the mucus layer covering the skin of the clownfish have the capacity to block stings from the anemone’s nematocysts.

Clark's anemonefish are able to perceive their environment using visual, olfactory, tactile, auditory, and vibrational (lateral line) sensory systems.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Eggs generally hatch 6 to 8 days after fertilization, depending on the surrounding water temperature; the cooler the water, the longer the incubation period. Once the eggs hatch, larvae are completely independent from their parents. The planktonic larval stage lasts between 7 to 9 days and ends when the juvenile fish returns to the bottom and finds a suitable host anemone to inhabit.

  • Breder, C., D. Rosen. 1966. Modes of reproduction in fishes. Neptune City, New Jersey: T.F.H. Publications.
  • Fricke, H., S. Fricke. 1977. Monogamy and sex change by aggressive dominance in coral reef fish. Nature, 266: 830-832.
  • Myers, R. 1999. Miconesian Reef Fish: A Field Guide for Divers and Aquarists. Barrigada, Territory of Guam: Coral Graphics.
  • Thresher, R. 1984. Reproduction in Reef Fishes. New Jersey: T.F.H. Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Benthic spawner. Sex reversal is completed in less than 5-6 months (Ref. 34185). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
  • Moyer, J.T. and A. Nakazono 1978 Protandrous hermaphroditism in six species of the anemonefish genus Amphiprion in Japan. Jap. J. Ichthyol. 25(2):101-106. (Ref. 32166)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Data on longevity in wild Clark's anemonefish is limited to a single study, which estimated that a female under periodic observation over a period of 11 years was at least 13 years old at the time she disappeared from her host anemone, with other anemones hosting females with estimated ages of 10 and 12 years. Sexually functional males disappear from anemones more frequently, perhaps suggesting shorter average lifespans for males, although this pattern could also be due to increased mobility of males seeking dominance on other anemones.

Range lifespan

Status: wild:
10 to 13 years.

  • Moyer, J. 1986. Longevity of the anemonefish Amphiprion clarkii at Miyake-jima, Japan with notes on four other species.. Copeia, 1986: 135-139.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clark's anemonefish, as part of the anemonefish subfamily Amphiprioninae, is a species characterized by protandrous hermaphrodism, meaning that all larvae develop as males and possibly change into females later in life. An adult male, female, and several juveniles may reside together within an anemone. If the female is removed or dies, the largest male becomes a female. Females control males with aggressive dominance, thus prohibiting the creation of other females. The largest male will in turn dominate the juveniles, preventing other males from spawning. This results in distinct monogamous pairings during the breeding season.

Prior to spawning, males prepare a nest where the female deposits her eggs. When spawning is about to occur, the male, extending his fins in a corralling gesture, chases the female into the nest. The female makes several passes over the nest and then begins to lay orange elliptical shaped eggs over a period of 1 to 2 hours before leaving the nest. The male then passes over the eggs and fertilizes them.

Mating System: monogamous

Clark's anemonefish breed nearly year-round in tropical waters, typically spawning 2 to 3 times per month. Spawning frequency may be somewhat limited during winter months in the northern edge of its distribution. Females lay demersal eggs (adhering to the substrate) in a large nest containing of 600 to 700 elliptical eggs from multiple spawnings. The eggs are approximately 3 to 4 mm in length and are attached to the substrate with a fine thread. The number of eggs in a nest varies depending on the age and size of the female.

Spawning is synchronized with the full moon and usually occurs in the early morning hours. Possible explanations for this include stronger water currents along the reef created by spring tides, which aid dispersal by transporting the anemonefish larvae greater distances, and a greater food supply and increased visibility of planktonic prey as a result of simultaneous spawning of invertebrates (such as corals and annelids) during the full moon.

Breeding interval: Breeding occurs possibly 2 to 3 times per month, although spawning may be reduced (or cease completely) in the northern regions of their distribution during winter months.

Breeding season: Spawning occurs year-round in the tropics, but only in the warmer months (May-October) in northern regions. Spawning occurs near the full moon.

Range number of offspring: 600 to 700.

Range gestation period: 6 to 8 days.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sequential hermaphrodite (Protandrous ); sexual ; fertilization (External ); oviparous

Males provide the majority of egg care, with the female involved only sporadically. Main duties of the male include fanning the eggs in a process that helps with incubation, and eating eggs that are infertile or that have been damaged during spawning. Once the eggs hatch, larvae are completely independent from their parents.

Parental Investment: male parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

  • Breder, C., D. Rosen. 1966. Modes of reproduction in fishes. Neptune City, New Jersey: T.F.H. Publications.
  • Fautin, D., G. Allen. 1992. Field Guide to Anemonefishes and their Host Sea Anemones. Perth, Australia: Western Australian Museum. Accessed November 01, 2011 at http://www.nhm.ku.edu/inverts/ebooks/intro.html.
  • Fricke, H., S. Fricke. 1977. Monogamy and sex change by aggressive dominance in coral reef fish. Nature, 266: 830-832.
  • Moyer, J. 1980. Influence of Temperate Waters on the Behavior of the Tropical Anemonefish Amphiprion Clarkii at Miyake-Jima, Japan. Bulletin of Marine Science, Vol. 30, Supplement 1: 261-272.
  • Myers, R. 1999. Miconesian Reef Fish: A Field Guide for Divers and Aquarists. Barrigada, Territory of Guam: Coral Graphics.
  • Thresher, R. 1984. Reproduction in Reef Fishes. New Jersey: T.F.H. Publications, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amphiprion clarkii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAAATTTATAACGTTATTGTTACCGCACATGCCTTCGTGATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGATTTGGAAACTGACTAGTACCCCTTATGCTTGGCGCCCCCGATATAGCATTCCCTCGCATAAACAACATAAGCTTCTGGCTCCTCCCTCCCTCTTTCCTTCTTCTGCTTGCTTCCTCAGGAGTTGAAGCCGGGGCCGGAACAGGCTGAACTGTATATCCCCCACTGTCTGGAAACCTAGCCCATGCAGGAGCATCCGTGGACTTAACTATTTTCTCCCTCCACCTGGCAGGTGTTTCATCAATCCTGGGAGCAATCAACTTTATCACTACCATTATTAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTTCTCCTCTCTCTCCCAGTACTAGCTGCCGGTATTACTATGCTCTTAACGGACCGAAATCTAAATACTACCTTCTTTGATCCAGCAGGGGGAGGAGATCCAATTCTCTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amphiprion clarkii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at University of the Ryukyus
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Although the conservation status of this species has not been evaluated, the increased demand for Clark's anemonefish in the aquarium trade has reduced populations in some locations. As global degredation of coral reefs continues to increase, these anemonefish will undoubtably encounter decreases in suitable habitat availability, which may cause populations to become threatened in the future.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • IUCN. 2003. "2003 IUCN Red List of Threatened Species" (On-line). Accessed October 04, 2011 at www.iucnredlist.org..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known negative impacts of this species on humans. Adults may nip at a SCUBA diver's fingers, if provoked.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clark's anemonefish are found in the tropical fish aquarium trade and certain rare color morphs of the species are highly sought after. They are easily bred and grow relatively quickly in captivity, and thus make useful research animals.

Positive Impacts: pet trade ; research and education

  • Sadovy, Y., A. Vincent. 2002. Ecological Issue and the Trade in Live Reef Fishes. Academic Press, San Diego, CA, Coral Reef Fishes: Dynamics and Diversity in a Complex Ecosystem: 395.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: subsistence fisheries; aquarium: commercial
  • Baensch, H.A. 1992 Neue Meerwasser-Praxis. Tetra Verlag, Melle, Germany. (Ref. 7309)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Clark's anemonefish

Amphiprion clarkii, known commonly as Clark's anemonefish and yellowtail clownfish, is a marine fish belonging to the family Pomacentridae, the clownfishes and damselfishes.[1]

Description[edit]

Clark's anemonefish is a small-sized fish which grows up to 10 cm as a male and 15 cm as a female.[2] It is stocky, laterally compressed, and oval to rounded.

It is colorful, with vivid black, white, and yellow stripes, though the exact pattern shows considerable geographical variation. Usually it is black dorsally and orange-yellow ventrally, the black areas becoming wider with age.[3] There are two vertical white bands, one behind the eye and one above the anus, and the caudal peduncle is white. The snout is orange or pinkish. The dorsal and tail fins are orange-yellow,[4] and the tail fin is generally lighter in tone than the rest of the body, sometimes becoming whitish.[5] Juveniles are orange-yellow with vertical white bands.[4]

Distribution[edit]

Clark's anemonefish is widely distributed in tropical waters from the Indo-West Pacific.[6]

Habitat[edit]

The adult inhabits lagoons and outer reef slopes. It lives in association with about ten species of sea anemones:

Feeding[edit]

Clark's anemonefish is omnivorous and its diet is based on zooplankton and algaes.[7]

Amphiprion clarkii sipadan.jpg

Behaviour[edit]

The fish is diurnal. It is a protrandous hermaphrodite, the male often changing sex to become a female. A male may keep a harem. The fish is also aggressive and territorial.[8] Without a host, Clark's anemonefish stays close to rockwork.[8] Otherwise, it is dependent on sea anemones to provide a habitat and nesting sites. The fish has a mucous coat to protect it from anemone stings. It is a mutualistic relationship. The clownfish helps to attract prey items close to the anemone's tentacles, and helps to defend it from tentacle-eating predators, such as butterflyfishes.[3]

References[edit]

  1. ^ "WoRMS - World Register of Marine Species - Amphiprion clarkii (Bennett, 1830)". Marinespecies.org. Retrieved 2014-01-27. 
  2. ^ Lougher, Tristan (2006). What Fish?: A Buyer's Guide to Marine Fish. Interpet Publishing. p. 13. ISBN 0-7641-3256-3. "What size? Males maximum 4 in (10 cm), females maximum 5 7/8 in (15 cm)" 
  3. ^ a b c By Padgette' Steer. "ADW: Amphiprion clarkii: INFORMATION". Animaldiversity.ummz.umich.edu. Retrieved 2014-01-27. 
  4. ^ a b "SOUS LES MERS : Amphiprion clarkii - poisson-clown de Clark". Fran.cornu.free.fr. Retrieved 2014-01-27. 
  5. ^ "Facts about Clark's Anemonefish (Amphiprion clarkii) - Encyclopedia of Life". Eol.org. 2013-02-14. Retrieved 2014-01-27. 
  6. ^ "Facts about Clark's Anemonefish (Amphiprion clarkii) - Encyclopedia of Life". Eol.org. 2013-02-14. Retrieved 2014-01-27. 
  7. ^ "Facts about Clark's Anemonefish (Amphiprion clarkii) - Encyclopedia of Life". Eol.org. 2013-02-14. Retrieved 2014-01-27. 
  8. ^ a b Lougher, Tristan (2006). What Fish?: A Buyer's Guide to Marine Fish. Interpet Publishing. p. 13. ISBN 0-7641-3256-3. "In the absence of an anemone, the fish remains close to rockwork. Otherwise, it stays with its host, wherever it is located.... Clarke's anemonefish is a belligerent species when large, attacking anything that threatens its anemone" 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!