Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

More common at oceanic islands than on continental reefs. Occurs in large groups around coral outcrops and caves of outer reef slopes. Feeds on copepods and other planktonic crustaceans or crustacean larvae and fish eggs (Ref. 9710, 37816).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Bali and the Ryukyu Islands to the Tuamoto Islands, north to southern Japan, south to Australia (Ref. 2334) and New Caledonia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 7 - 8
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 48635))
  • Kuiter, R.H. and T. Tonozuka 2001 Pictorial guide to Indonesian reef fishes. Part 1. Eels- Snappers, Muraenidae - Lutjanidae. Zoonetics, Australia. 302 p. (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by purple to violet color with numerous small dark blue to orange spots; red-orange band on snout to pectoral fin base; female similar, but lacks spots and has shorter dorsal, anal and pelvic fins; greatest depth of body 2.9-3.4 in SL; presence of fleshy protuberance at front of upper lip in male; no prolonged dorsal spine; deeply forked caudal fin with prolonged lobes in male (Ref 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 60 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 3.66 - 49
  Temperature range (°C): 26.287 - 28.941
  Nitrate (umol/L): 0.045 - 0.822
  Salinity (PPS): 34.134 - 34.999
  Oxygen (ml/l): 4.512 - 4.719
  Phosphate (umol/l): 0.092 - 0.190
  Silicate (umol/l): 1.056 - 3.817

Graphical representation

Depth range (m): 3.66 - 49

Temperature range (°C): 26.287 - 28.941

Nitrate (umol/L): 0.045 - 0.822

Salinity (PPS): 34.134 - 34.999

Oxygen (ml/l): 4.512 - 4.719

Phosphate (umol/l): 0.092 - 0.190

Silicate (umol/l): 1.056 - 3.817
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 5 - 60m.
From 5 to 60 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found inshore (Ref. 75154).
  • Randall, J.E. and R. Lubbock 1981 A revision of the serranid fishes of the subgenus Mirolabrichthys (Anthiinae: Anthias), with description of five new species. Contrib. Sci. Nat. Hist. Mus. Los Angeles County, 333. 27 p. (Ref. 12401)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudanthias pascalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTACTTAGTGTTTGGTGCTTGGGCCGGGATAGTAGGCACAGCCTTGAGCTTGCTCATTCGAGCAGAGCTCAGTCAGCCCGGGGCCCTCTTAGGCGACGACCAAATTTATAATGTTATCGTTACAGCGCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAATTATGATTGGCGGTTTTGGCAATTGACTAATCCCCCTAATGATTGGTGCCCCTGATATAGCTTTCCCCCGTATAAATAACATAAGCTTCTGGTTATTGCCCCCGTCCTTCCTCCTTCTGCTTGCTTCATCTGGGGTAGAAGCGGGGGCGGGCACAGGATGAACAGTTTACCCGCCCTTAGCTGGCAACCTAGCCCACGCAGGAGCATCCGTCGACCTTACTATTTTCTCCTTGCACTTAGCAGGTATTTCATCTATTCTAGGGGCCATTAACTTTATTACTACAATTATTAATATAAAACCCCCAGCCATCTCCCAATACCAGACACCTTTATTCGTCTGGGCAGTCCTTATTACGGCTGTCCTCCTACTACTATCCCTTCCAGTTCTTGCCGCAGGCATTACGATACTCCTAACAGACCGAAATCTTAATACTACCTTTTTTGACCCCGCTGGAGGAGGAGACCCTATCCTCTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pseudanthias pascalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!