Articles on this page are available in 2 other languages: Spanish (1), Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: marlin (English), aguja (Espanol), merlín (Espanol)
 
Istiompax indica (Cuvier in Cuvier & Valenciennes, 1832)

Black marlin


Body not very compressed; bill rounded in cross section; adults with small teeth; nape very high; front dorsal rays elevated into triangular peak, remainder of fin very low, height of front lobe less than greatest body depth; first dorsal fin rays 34-43; second dorsal fin rays 5-7; first anal fin rays 10-14; second anal fin rays 6-7; pectoral fins rigid and cannot be folded close to body, 12-20 rays; pelvic fins filamentous, shorter than pectoral fins; 2 keels on side of tail base; anus close to origin of anal fin; lateral line a series of loops or a meshwork, often obscured in adults; body covered with small, triangular scales. 


Dark blue dorsally and silvery white ventrally; usually no blotches or dark bars on body in adults; first dorsal fin blackish to dark blue; other fins dark brown tinged with blue.

Size: to 500 cm; all-tackle world record 708 Kg.

Habitat: pelagic, oceanic.

Depth: 0-100 m.

Tropical and temperate Indo-Pacific and eastern Atlantic; southern California to the SW and NE Gulf of California to Peru and the oceanic islands.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Oceanic, usually found in surface waters above the thermocline, often near shore close to land masses, islands and coral reefs. Feed on fishes, squids, cuttlefishes, octopods, large decapod crustaceans and mostly on small tunas when abundant (Ref. 9668). The flesh is of good quality; marketed refrigerated or frozen and prepared as sashimi in Japan (Ref. 9308). Also Ref. 9692.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is distributed throughout the tropical Indo-Pacific, and occasionally enters temperate waters. Stray individuals migrate into the Atlantic Ocean by way of the Cape of Good Hope, but the existence of Atlantic breeding stocks is unlikely. In the Eastern Pacific it is found from southern California to the southwestern and northeastern Gulf of California to Chile, including all of the oceanic islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: tropical and subtropical waters, occasionally entering temperate waters. Stray individuals migrate into the Atlantic Ocean by way of the Cape of Good Hope, but the existence of Atlantic breeding stocks is unlikely. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nearly circumglobal in tropical through temperate seas (including Red Sea, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 100 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 39 - 50; Analspines: 0; Analsoft rays: 16 - 21
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 500.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 4600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

465 cm FL (male/unsexed; (Ref. 40637)); max. published weight: 750.0 kg (Ref. 5503)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body elongate and not very compressed; upper jaw produced into a robust but not very long beak; two dorsal fins, the height of the first less then the greatest body depth, becoming shorter posteriorly; pectoral fins falcate and rigid, with 19 to 20 rays; body densely covered with small, embedded scales with 1 or 2 sharp points; back dark blue; belly silvery white; membrane of first dorsal fin blue black, without spots; flanks without spots (Ref. 55763). Dark blue above, silvery white below; sometimes with light blue vertical stripes; 1st dorsal fin blackish to dark blue, other fins dark brown with tinges of dark blue in some specimens.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This pelagic and oceanodromous species is usually found in surface waters above the thermocline at temperatures from 15–30°C, often close to land masses, islands and coral reefs. It is found to depths of 100 m. It feeds on fishes, squids, cuttlefishes, octopods, large decapod crustaceans, and mostly on small tunas such as Skipjack, Yellowfin, Bigeye, and Frigate tunas (Nakamura 1985). This species can grow to be 700 kg.

Billfishes are at or near the apex of pelagic food webs, have broad diets, grow very rapidly, have high fecundity, and, in some cases show long-distance migrations (Kitchell et al. 2006). All billfish live at least 9–12 years, with a fecundity of 0.75 to 19 million eggs, increasing with size. Females are usually larger than males, and larvae are pelagic (Collette 2010).

Males and females are indistinguishable externally, but females attain a much larger size. Sex ratio varies with area and season. In Taiwan waters, all black marlin greater than 270 cm LJFL were females. Length of males at first maturity was about 140 cm, and 230 cm for females. Age at first maturity not known. Intensive spawning occurs in the Coral Sea, especially during October and November. Water temperatures about 27–28°C during spawning. Egg counts of ripe females totalled about 40 million (Collette 2010).

The all-tackle game fish record is of a 707.61 kg fish caught off Cabo Blanco, Peru in 1953 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 915 m (Ref. 43), usually 0 - 200 m (Ref. 43)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 915m.
Recorded at 915 meters.

Habitat: pelagic. Black Marlin.  (Cuvier, 1832)   
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Seasonal changes in distributions of catch rates, reflecting concentrations of fish, do take place but individuals do not follow clear migration routes (Ref. 30358). Such seasonal concentrations are known to occur in the north-west Coral Sea, off the North West Shelf of Australia, in the Banda Sea and the east China Sea (Ref. 6390). There have been suggestions that the distributions and migrations of black marlin are sex-dependent (Ref. 30359). Knowledge of seasonal changes in distribution and migration patterns of this highly mobile species is largely based on catch data collected by the Japanese longline fleet (Ref. 6390). Tagging has also assisted greatly in interpretation of movement patterns (Ref. 30358, 30360).In Australian waters, aggregation in the Coral Sea during September-December, presumed 1-2-year-old fish and 1 or 2 older groups move south parallel to the eastern Australian coastline from north Queensland to central New South Wales, apparently in association with the southward movement of the East Australian Current (Ref. 30358). By April, however, the fish have probably dispersed eastwards (catch rates in eastern Australia between April and August are generally very low). Fish can move large distances (up to 7200 km in 359 days) and recaptures from tagging studies over several years strongly suggest annual homing of at least part of the (western Coral Sea) population (Ref. 30358). It appears that fish also migrate from northwestern Australia to Indian Ocean waters south of Indonesia in late March-April, and fish migrate back to north-western Australia during October (Ref. 30354). High catch rates occur in the Banda Sea north of Australia between January and April (Ref. 6390).Black marlin larvae have been found only in the north-west Coral Sea off Queensland and off northwestern Australia, south of 10°S (where they were misidentified as sailfish larvaeIstiophorus platypterus (Ref. 30361, 30362). Off Lizard Island in north Queensland, concentrations of black marlin larvae have been found in close proximity (within half a mile) to the outer slopes of coral reefs on the edge of the continental shelf (Ref. 30362).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: octopus/squid/cuttlefish, Pelagic crustacea, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Believed to prefer water temperatures around 27° to 28°C during spawning. Egg counts of ripe roe totaled about 40 million per female.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Makaira indica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCGACCAATCACAAAGACATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCCCTG---AGCCTCCTAATTCGAGCTGAACTTAGCCAACCTGGCGCTTTACTAGGCGAT---GATCAGATTTATAACGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGGGGTTTCGGAAACTGACTGATTCCTCTAATG---ATCGGAGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTGCTCCCTCCCTCATTCCTTCTACTCCTCGCCTCCTCCGGGGTTGAAGCCGGGGCCGGCACAGGGTGAACCGTCTACCCGCCTCTAGCAGGTAACCTAGCCCACGCAGGAGCATCTGTTGACCTA---ACTATTTTCTCCCTCCATTTAGCTGGTATTTCCTCCATCTTAGGAGCTATCAACTTTATCACTACCATCATTAACATGAAACCAGCCGCCGTTTCAATGTACCAAATCCCCCTATTCGTCTGAGCAGTGCTGATTACAGCTGTCCTACTACTCCTCTCTCTGCCCGTCCTAGCTGCT---GGGATCACAATGCTTCTCACGGATCGAAATCTTAACACTGCCTTCTTCGACCCAGCAGGGGGTGGTGACCCAATCCTTTATCAACACCTATTCTGATTCTTCGGACACCCAGAGGTTTATATTCTTATTCTACCAGGTTTCGGAATGATCTCCCATATTGTCGCCTATTATTCTGGTAAAAAA---GAACCTTTCGGCTATATGGGTATGGTTTGAGCTATGATGGCTATTGGCCTTCTAGGCTTCATTGTCTGAGCCCACCACATGTTTACAGTCGGAATGGACGTTGACACACGTGCCTACTTCACATCTGCTACAATGATCATTGCCATCCCAACCGGCGTTAAAGTCTTTAGCTGACTT---GCAACCCTTCACGGAGGC---TCTATCAAATGAGAAACTCCGCTTCTATGAGCCCTTGGCTTTATCTTCCTATTTACAGTTGGAGGACTAACCGGGATCGTGCTTGCCAACTCCTCACTAGACATTGTCCTTCACGATACATATTATGTAGTAGCCCACTTCCACTACGTT---CTCTCTATGGGTGCCGTCTTTGCCATTGTTGCCGCTTTCGTGCACTGATTCCCCCTATTTACTGGCTACACGCTTCACAGCACATGAACAAAAATCCACTTCGGAGTAATGTTTGTAGGTGTAAACCTCACATTCTTCCCACAACACTTCCTAGGGCTAGCTGGTATGCCTCGG---CGATACTCAGACTATCCGGACGCCTACACC---CTATGAAATACAGTTTCCTCTATTGGATCCCTTGTCTCGCTTGTTGCCGTAATTATGTTCCTATTTATTATTTGAGAAGCATTTACAGCCAAACGAGAAGTA---CTTTCAGTAGAACTCACCGCTACAAAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Makaira indica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Istiompax indica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 22 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATGGTGGGCACTGCCCTGAGCCTCCTAATTCGAGCTGAACTTAGCCAACCTGGCGCTTTACTAGGCGATGATCAGATTTATAACGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGTTTCGGAAACTGACTGATTCCTCTAATGATCGGAGCCCCAGACATGGCCTTCCCTCGAATAAACAACATGAGCTTTTGACTGCTCCCTCCCTCATTCCTTCTACTCCTCGCCTCCTCCGGGGTTGAAGCCGGGGCCGGCACAGGGTGAACCGTCTACCCGCCTCTAGCAGGTAACCTAGCCCACGCAGGAGCATCTGTTGACCTAACTATTTTCTCCCTCCATTTAGCTGGTATTTCCTCCATCTTAGGAGCTATCAACTTTATCACTACCATCATTAACATGAAACCAGCCGCCGTTTCAATGTACCAAATCCCCCTATTCGTCTGAGCAGTGCTGATTACAGCTGTCCTACTACTCCTCTCTCTGCCCGTCCTAGCTGCTGGGATCACAATGCTTCTCACGGATCGAAATCTTAACACTGCCTTCTTCGACCCAGCAGGGGGTGGTGACCCAATCCTTTATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Istiompax indica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Acero, A., Canales Ramirez, C., Carpenter, K.E., Di Natale, A., Fox, W., Miyabe, N., Montano Cruz, R., Nelson, R., Schaefer, K., Serra, R., Sun, C., Uozumi, Y. & Yanez, E.

Reviewer/s
Russell, B., Elfes, C. & Polidoro, B.

Contributor/s

Justification
This species is widespread in the Indo-Pacific. It is commercially and recreationally caught, and is caught as bycatch in longlines and purse seines throughout its range. There have been no stock assessments for this species, and only very limited catch and effort data is available. Given that it is caught with the same gears as the Blue Marlin and Striped Marlin, it is likely that the population of Black Marlin has declined as well, but there is no data to quantify this. In the Eastern Pacific, available catch data does not indicate any reduction in landings, however the impact of commercial fishing and sports fishing on the species is unknown. It is therefore listed for the present as Data Deficient. More information is needed on catch landings, discards and effort for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no stock assessment for this species. Based on reported landings to FAO, the world catch for this species is variable, but shows a gradual increase from around 5,000 tonnes in the 1950s to 10,826 tonnes in 2006 and from 2,373 to 3,440 metric tonnes per year between 1978–1982. Many landings of marlins do not specify this species, and it is discarded when caught as by-catch by long-line fisheries, and is not quantified.

The landing information on marlins for the whole Pacific Ocean is not available, except for the FAO statistics. Based on the FAO Year Book (1996), recently 47,000 metric tons of marlins were caught in the Pacific. Blue Marlin occupied about 42% of the total catch, Striped Marlin occupied about 25%, Sailfish 10%, and Black Marlin 5%, but “marlins” occupied 19% of the total, respectively. The category of “marlins” includes catch of other marlins than Blue Marlin, Striped Marlin, Black Marlin, and Sailfish, and also includes the catch of species unknown. International management authority of the Black Marlin in the Pacific is shared by the Inter American Tropical Tuna Commission (IATTC) and the Western and Central Pacific Fisheries Commission (WCPFC). There has never been an assessment of the status of black marlin in the Pacific, but landings trends over the past thirty years have been generally declining.

In the Indian Ocean, catch per unit effort (CPUE) exhibited dramatic declines since the beginning of the fishery in the 1950s with catches in the initial fishing grounds decreasing substantially. Nominal CPUE in the northwestern Australian area has declined from 2.0 to about 0.25 (approximately 87%) since 1977, while nominal CPUE in the Seychelles area has been very low and has declined from 0.3 to 0.2 (30% decline) since the 1970s (IOTC 2009).

In the Eastern Pacific, FAO (2006) landing data from 1995–2005 has shown a rapid increase from 300 metric tonnes to 1,400 metric tonnes. Landings data from IATTC (2008) for Black Marlin taken by purse seine and long-line in the Eastern Pacific vary from 100 to 417 metric tonnes per year from 1978 to 2007, with a uniformly low catch. However, Black Marlin are often difficult to identify and the catch of unidentified billfishes increased from a few hundred to thousands of metric tonnes during this time frame. In the Eastern Pacific specifically, quantities of billfish caught are not attributed to a single species and many countries are not reporting the catch.

In Mexico, the majority of the marlin catch comes from the Gulf of California (89%), the remainder coming from the Gulf of Tehuantepec (11%). The total recreational catch of billfish has increased since 1990 (first year of reported data) from approximately 12,000 to 33,000 fish in 2005. Recreational fishing effort has also been increasing during the same time period from approximately 4,000 fishing trips in 1990 to 37,000 trips in 2005. Striped Marlin is the dominate species caught in the recreational fishery accounting for approximately 68% of the total catch. Sailfish account for 25% of the total recreational catch, followed Blue Marlin at 7% and Black Marlin at < 1% (ISC 2007).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Caught mainly by commercial longliners, trolling, harpooning and sometimes by set nets and gill nets. It is mostly caught by surface tuna long liners. This species may potentially be threatened by artisanal and commercial long-line fisheries, and it is commonly taken as bycatch in purse seiners, and it is sometimes discarded. It is a important species in sport fisheries, and is targeted by artisanal fisheries.

This species is taken as bycatch similar to blue and striped marlin, primarily in long-lines and secondarily in purse seines, but the quantity is generally not recorded. There is a significant lack of CPUE data.

In the Eastern Pacific, this species is caught by tuna longliners and is also a very important sportsfish off Peru, Ecuador, and northeastern Australia (Matsumoto and Bayliff 2008). Little data exists for landing data from countries in the Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (FAO Fisheries Department 1994).

Size limitations, encouragement of catch-and-release sport fishing, and recommendations for using circle hooks instead of J-hooks are measures designed to increase survival in catch-and-release sport fishing (Serafy 2009).

Marlin species are a special case because by-catch in the longline fisheries concentrating primarily on tunas causes the majority of fishery mortality (>90%) for marlin (Kitchell et al. 2004). In the Pacific, marlin are most frequently captured on the shallow hooks of a longline set (those close to the floats), and removing less than 15% of the hook sets adjacent to floats would decrease marlin catch by as much as 50% (Kitchell et al. 2004).

In the Eastern Pacific, Billfish cannot be taken commercially in Peru, Panama, Nicaragua, and Guatemala, and all recreational fishing is catch and release in Panama, Nicaragua, and Guatemala. It is protected in Mexico, as there is a 50 miles coastal zone area where this species cannot be taken commercially, and there is a larger conservation zone off of Baja California where it cannot be taken commercially. Commercial harvest in Costa Rica is limited to15% of all landings.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Black marlin

The black marlin (Istiompax indica) is a species of marlin found in tropical and subtropical areas of the Indian and Pacific Oceans.[2] With a maximum published length of 4.65 m (15.3 ft) and weight of 750 kg (1,650 lb).,[2] it is one of the largest marlins and also one of the largest bony fish. This marlin is one of the fastest fish, reaching speeds up to 80 mph (130 km/h).[3] Black marlin are fished for commercially and are also a highly prized game fish.

Description[edit]

Compared to striped or white marlins and sailfish, black marlins are more solid than their blue counterparts. They have a shorter bill and a rounder and lower dorsal fin. Black marlin may be distinguished from all other marlin species by their rigid pectoral fins, which, especially from a weight of around 150 lb (75 kg) or so, are unable to be pressed flat against their sides.

Diet[edit]

Diet mostly consists of various fishes and cephalopods.

Commercial fisheries[edit]

In 2010, Greenpeace International added the black marlin to its seafood red list.

Recreational fishing[edit]

Many people see the black marlin as the premier game fish for sport fisherman. Because of their size and physique, these marlins are popularly fished. Research off the coast of Australia suggests the large creature is much easier to catch around the full moon and the week afterwards due to its prey moving to the surface layers, which in turn forces the marlin to hunt in a wider area.

Distribution[edit]

In addition to the Australian coast, black marlin can also be found throughout the tropical Indo-Pacific waters. They can also be found from Southern California to the Gulf of California to Chile, including the coast of all oceanic islands in between. They tend to stay in warmer waters and hunt the surface. In addition to warmer waters, they also are found close to land masses as opposed to wide-open water.

References[edit]

  1. ^ Collette, B., Acero, A., Canales Ramirez, C., Carpenter, K.E., Di Natale, A., Fox, W., Miyabe, N., Montano Cruz, R., Nelson, R., Schaefer, K., Serra, R., Sun, C., Uozumi, Y. & Yanez, E. (2011). "Istiompax indica". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 15 December 2011. 
  2. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Istiompax indica" in FishBase. April 2013 version.
  3. ^ BBC Worldwide (27-05-2008). Black marlin - the fastest fish on the planet. Ultimate Killers - BBC wildlife.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!