Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Burbot is the only cod species that lives in fresh water. It is found in clear moving water or in clean deep lakes. During the day, the fish hides in the depths or under stones or hollows. The fish hunts actively at dusk and at night. Just like cod, it has a barbel on its chin, which it uses to search the bottom for food. When the burbot is young, it eats mostly insect larvae, gammarids and water louse. After growing to 20-40 centimeters, the fish switches over to a diet of fish.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

The only member of the family which lives in freshwater. Crepuscular and nocturnal (Ref. 11941). Found in well oxygenated flowing waters and large lakes. Occurs from estuaries of large lowland rivers as well as from small mountain streams, preferring deep waters in summer (Ref. 59043). Also inhabit deep lakes and large rivers (Ref. 5723, 10294) with slow-moving current. Seek shelter under rocks, in crevices on the river banks, among roots of trees and dense vegetation (Ref. 30578, 10294). Those in rivers tend to congregate in deep holes throughout the year, except at spawning (Ref. 27547). Movements into shallower water during summer nights are related to feeding (Ref. 1998). Smaller individuals feed on insect larvae, crayfish, mollusks and other invertebrates with a changing preference for fishes in larger individuals (Ref. 1998, 10294). Source of oil. Sold mainly salted. Liver is sold smoked or canned in Europe (Ref. 1998). Processed into fishmeal (Ref. 1998). Because of its nocturnal habits and its slow movements, this fish is not very much appreciated by sport fishermen. Flesh is tasty but a little dry (Ref. 30578). Locally threatened due to river regulation (Ref. 59043).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Close up on the Burbot

http://www.dnr.state.mn.us/minnaqua/speciesprofile/burbot.html

MN DNR MinnAqua Program Species Profile

Close Up on the Burbot

by Mike Kurre, Mentor Coordinator

Burbot:

Lota lota (low’-tah low’-tah): from the French word for codfish; “burbot” is also a French word, meaning “mud” or “mire”

Ur, Ur, Ur! spoke the burbot. . .

What’s in a name any way? Burbot is only one of numerous names this cold-water species from the cod family goes by. Many of the fresh water cod’s nick-names can’t be mentioned, but here is a list of the most common: Eel Pout, Lawyer, Ling, Cusk, Lush, Loche, Mudblow and Poor Man’s Lobster.

Burbot can be found in most Minnesota northern lakes and rivers, including Lake Superior, but can also be found in small numbers in the prairie regions and parts of the lower Mississippi. They are good indicators of a healthy watershed. Typically they require water temps lower than 70 degrees during the summer and are a rare catch, but come winter-time, these predators come alive and are most active.

Identification

The burbot coloration varies from yellow-brown to brown or even dark olive with black mottling and blotching, giving it almost a camouflage appearance. Burbot resembles an eel more than other freshwater fish. Its scales are small, the skin has a slimy feel and this bottom hugger has large chin barbel with tubular nostrils similar to catfish, for detecting food.

This secretive fish can live up to the ripe old age of 15 and the Minnesota state record is 19 lbs. 3 ozs. and was caught in Lake of the Woods. These fish can weigh over 60 lbs in other areas of the world. Typically in Minnesota, they are under 8 lbs. and are less than 28 inches in length.

Handling

Burbot can be handled by placing a firm grip just behind the head. Their teeth are much like largemouth bass, like rough sandpaper. Don’t be shocked when our eel-like looking friend, uniquely and harmlessly, wraps its body around your forearm and gives you a little…. ur…ur…ur, vocalization when handling them. It’s just their way of greeting you.

Food

They eat mostly other fish such as small yellow perch and walleyes, but also consume fish eggs, clams, crayfish, mayfly larvae and other aquatic insects.

Reproduction

The spawning season for this unique fish is very unusual. It spawns during mid-winter into early spring, before the ice is off the lake or river. Reproduction occurs in pairs or sometimes in groups of dozens or even in the hundreds, in shallow water over sand or gravel bottoms. There is no nest built and no care for the eggs or newly hatched young. After the release of eggs and sperm the fish thrash about scattering the eggs, which later fall to the bottom. A single female can lay as many as 1 million eggs depending on her size. The embryos develop for 4 to 5 weeks in the cold water and hatch at the tiny size of .15 inches (one of the smallest freshwater fish larvae).

Predators

Young burbots are common prey for many fish, such as smallmouth bass, yellow perch, smelt, lake trout and muskie. Humans also can be considered a predator even though many people consider burbot the “ish” in fish and most folks don’t even like to touch them. Folks who cut the line not knowing that baked with a little butter, salt and pepper, miss out on a delicacy served in many households.

Tackle & Fishing Tips

Most burbots are accidentally caught by anglers targeting other fish like walleyes (that would be me). They are especially active during low light conditions during the winter months. Tip-ups or walleye style jigging equipment, spooled with 4 to 8 lb line will provide the necessary gear needed to land these unique creatures.

Your bait of choice can be just about any minnows, locating the bait within inches of a deep muddy river- or lake-bottom (like the mud flats in Lake Mille Lacs). Keep a watchful eye on your line; Burbot have very sensitive bite. Wait too long to set the hook and you’ll be fishing-out your hook from the gullet or cutting your line to make an ethical release.

Burbot do not have special conservation status in Minnesota and are not actively managed, so fish away and enjoy another special offering from the lakes of Minnesota.

Fun Facts

* Burbot have long been used for fish meal, oil and food for animals raised for furs (the oil is absorbed through digestion making for a great fur conditioner).

* The tough skin was once used in the windows of Siberia as a substitute for glass.

* Burbots are part of an annual celebration in February in Walker, MN. The Eelpout Festival has been a great event, distracting Minnesotan’s during winters for over 30 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: nameyer1

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Black Sea, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, Hudson Bay, Hudson Strait, North East Pacific, North Pacific, North West Territories, Polish Exclusive Economic Zone, Swedish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Burbot, Lota_lota, are a holarctic species native to the cold fresh waters of the Nearctic and Palearctic regions found between 40 and 70 degrees North latitudes.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Cohen, D., T. Inada, T. Iwamoto, N. Scialabba. 1990. Gadiform fishes of the world : Order Gadiformes, an annotated and illustrated catalogue. Rome: Food and Agriculture Organization of the United Nations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumarctic in freshwater (Ref. 1371). Europe: Loire drainage, France eastward to White, Barents and Arctic Sea basins; upper Volga drainage; western Caspian basin; rivers draining to Black Sea; Rhône drainage (France); in Italy native only in Po drainage; eastrward England (now extirpated). In Siberia eastward to River Lena. Reported that populations from eastern Siberia and North America belong to a different species, Lota maculosa (Ref. 59043).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Europe: from Loire drainage (France) eastward to White, Barents and Arctic Sea basins; upper Volga drainage; southeastern Caspian basin; rivers draining to Black Sea; Rhône drainage (France); in Italy, native only in Po drainage; eastern England (now extirpated). In Siberia eastward to River Lena. Originally absent from Iberian Peninsula, central and southern Italy, Adriatic basin, Greece, Ireland, western and northern Great Britain and western France.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Burbot, Lota lota, are a holarctic species native to the cold fresh waters of the Nearctic and Palearctic regions found between 40 and 70 degrees North latitudes.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Cohen, D., T. Inada, T. Iwamoto, N. Scialabba. 1990. Gadiform fishes of the world : Order Gadiformes, an annotated and illustrated catalogue. Rome: Food and Agriculture Organization of the United Nations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Widely distributed in both hemispheres south to about 40 degrees north latitude (south to Pennsylvania, Kentucky, Missouri, Wyoming, and Oregon).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Europe to Asia and North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Burbot are large fish known to grow to as much as 1.5 m in length and 34 kg in mass (Morrow 1980). These fish are yellow, light tan, or brown with dark brown or black patterning on the body, head and most fins. The underbelly and pectoral fins are pale to white (Cohen et al. 1990; Morrow 1980). The first dorsal fin is short and is followed by a long second dorsal fin at least 6 times the length of the first and joined to a rounded caudal fin (Morrow 1980). Burbot have neither dorsal nor anal spines and have 67 to 96 soft dorsal rays, and 58 to 79 soft anal rays (Cohen et al. 1990). Gill rakers are short, pectoral fins are rounded, and caudal fins have 40 rays (Morrow 1980). Like other cods, burbot are also characterized by a single barbel located on the chin (Morrow 1980).

Range mass: 34 (high) kg.

Range length: 152 (high) cm.

Range basal metabolic rate: 171.6 (high) cm^3 oxygen/hour.

Average basal metabolic rate: 73.9 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 67 - 96; Analspines: 0; Analsoft rays: 58 - 84; Vertebrae: 50 - 67
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Burbot are large fish known to grow to as much as 1.5 m in length and 34 kg in mass (Morrow 1980). These fish are yellow, light tan, or brown with dark brown or black patterning on the body, head and most fins. The underbelly and pectoral fins are pale to white (Cohen et al. 1990; Morrow 1980). The first dorsal fin is short and is followed by a long second dorsal fin at least 6 times the length of the first and joined to a rounded caudal fin (Morrow 1980). Burbot have neither dorsal nor anal spines and have 67 to 96 soft dorsal rays, and 58 to 79 soft anal rays (Cohen et al. 1990). Gill rakers are short, pectoral fins are rounded, and caudal fins have 40 rays (Morrow 1980). Like other cods, burbot are also characterized by a single barbel located on the chin (Morrow 1980).

Range mass: 34 (high) kg.

Range length: 152 (high) cm.

Range basal metabolic rate: 171.6 (high) cm^3 oxygen/hour.

Average basal metabolic rate: 73.9 cm^3 oxygen/hour.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1520 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

152 cm TL (male/unsexed; (Ref. 27547)); max. published weight: 34.0 kg (Ref. 27547); max. reported age: 20 years (Ref. 556)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 84 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Diagnosed from all other freshwater fishes in Europe by its pelvic fin origin anterior to pectoral fin origin and by having one central barbel on lower jaw (Ref. 59043). Distinguished by the long second dorsal fin, at least 6 times as long as the first, and a single barbel on the chin (Ref. 27547). Gill rakers short (Ref. 27547). First dorsal short; second dorsal and anal fins joined to caudal; pectorals short and rounded; caudal rounded (Ref. 27547), with 40 rays (Ref. 2196). Color is yellow, light tan to brown with a pattern of dark brown or black on the body, head and fins (Ref. 1371). Pelvic fins pale, others dark and mottled (Ref. 27547).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Seine River Demersal Habitat

This taxon is one of a number of demersal species in the Seine River system of Western Europe. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The Marne and Yonne exhibit the greatest torrential flows, due to the percentage of their courses underlain by impermeable strata, in combination with the river gradients. Although the Loing manifests the highest percentage of impermeable strata of all the tributaries, its low gradient mitigates against torrential velocities. Thus the majority of the Seine and its tributaries exhibit a relaxed generally even flow rate.

Seine water pollutant loads of heavy metals, nutrients, sediment and bacteria are relatively high, especially influnced by wastewater and surface runoff from Paris and its suburbs. Parisian pollutant loadings are noted to be particularly high during periods of high rainfall, not only due to high runoff, but also from the inadequate sewage treatment facilities in periods of high combined wastewater/stormwater flow.

Heavy metal concentrations at Poses weir reveal the following levels: copper, 1.9 milligrams per liter; cadmium, 32 mg/l; and lead, 456 mg/l. Concentrations of zinc are also quite high, making the Seine Estuary one of the most highly contaminated estuaries in the world with respect especially to lead and cadmium. Significant amounts of toxic pollutants are also attached to sediments deposited in the Seine during the last two centuries, including mercury, nickel, chromium, toluene, DDT and a variety of herbicides and pesticides. Downriver from Paris, significant quantites of ammonium are discharged into the Seine from effluent of the Achères wastewater treatment plant.

There are a total of 37 fish species inhabiting the Seine, and another two taxa that are known to have been extirpated in modern times. Two of the largest aquatic fauna known to have lived in the Seine are now locally extinct: the 500 centimeter (cm) long sturgeon (Acipenser sturio) and the 83 cm long allis shad (Alosa alosa).

The largest extant native demersal (species living on or near the river bottom) taxa in the Seine are:

the 133 cm European eel (Anguilla anguilla);

the 150 cm northern pike (Esox lucius);

the 120 cm sea lamprey (Petromyzon marinus); and,

the 152 cm Burbot (Lota lota).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Amur River Demersal Habitat

This taxon is one of a number of demersal species in the Amur River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton

The persistence of mercury contamination in Amur River bottom sediments is a major issue, arising from historic cinnabar mining in the basin and poor waste management practises, especially in the communist Soviet era, where industrial development was placed ahead of sound conservation practises.

The largest native demersal fish species in the Amur River is the 560 centimeter (cm) long kaluga (Huso dauricus); demersal biota are those that inhabit the bottom of a surface water body. Another large demersal fish found in the Amur is the 300 cm Amur sturgeon (Acipenser schrenckii), a taxon which is endemic to the Amur basin.

Other demersal endemic fish species (all in the concubitae family) of the Amur Basin are Iksookimia longicorpa, I. koreensis, I. hugowolfeldi, Cobitis melanoleuca melanoleuca and the Puan spine loach (Iksookimia pumila).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Burbot are demersal fish found in deep temperate lake bottoms and slow moving cold river bottoms between 4 and 18 degrees C (Riede 2004; Cohen et al. 1990). Primarily found at depths ranging from 1 to 700 m, these fish prefer fresh waters but are also found in some brackish water systems (Cohen et al. 1990). These fish often dwell among benthic refugia such as roots, trees, rocks, and dense vegetation (Billard 1997).

Range depth: 1 to 700 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; brackish water

  • Scott, W., E. Crossman. 1973. Freshwater fishes of Canada. Bull. Fish. Res. Board Can., 184: 1-966.
  • Morrow, J. 1980. The Freshwater Fishes of Alaska. University of British Columbia Resource Ecology Library: University of British Columbia.
  • Riede, K. 2004. Global register of migratory species - from global to regional scales. Final report of the R&D Projekt 808 05 081. Bonn, Germany: Federal Agency for Nature Conservation.
  • Billard, R. 1997. Les poissons d'eau douce des rivières de France. Identification, inventaire et répartition des 83 espèces. Lausanne: Delachaux & Niestlé.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; potamodromous (Ref. 51243); freshwater; brackish; pH range: 7.5; dH range: 18; depth range 1 - 700 m (Ref. 1998)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat:
All well oxygenated flowing waters and large lakes. Known from estuaries of large lowland rivers as well as from small mountain streams.

Biology:
Generally nocturnal. Males reproduce for the first time at two years, females at three in Central Europe. Spawns in November-March, at temperatures below 4°C. May undertake short spawning migrations. Spawns at night, in groups of up to 20 interlaced individuals forming a ball about 60 cm in diameter constantly moving and rolling on the bottom, releasing eggs and sperm. Eggs are semipelagic, slightly sticky and 1.2-1.8 mm in diameter. Eggs hatch after 40-70 days. Larvae are positively phototactic, float below surface in March-April. After about two months, juveniles are benthic, grow rapidly, reach about 80 mm SL within first year. In contrast to most freshwater fish, very active during winter even below ice cover. Larvae feed on drifting invertebrates or zooplankton. Juveniles and adults feed on large invertebrates and small fish.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Burbot are demersal fish found in deep temperate lake bottoms and slow moving cold river bottoms between 4 and 18 degrees C (Riede 2004; Cohen et al. 1990). Primarily found at depths ranging from 1 to 700 m, these fish prefer fresh waters but are also found in some brackish water systems (Cohen et al. 1990). These fish often dwell among benthic refugia such as roots, trees, rocks, and dense vegetation (Billard 1997).

Range depth: 1 to 700 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; lakes and ponds; rivers and streams; brackish water

  • Scott, W., E. Crossman. 1973. Freshwater fishes of Canada. Bull. Fish. Res. Board Can., 184: 1-966.
  • Morrow, J. 1980. The Freshwater Fishes of Alaska. University of British Columbia Resource Ecology Library: University of British Columbia.
  • Riede, K. 2004. Global register of migratory species - from global to regional scales. Final report of the R&D Projekt 808 05 081. Bonn, Germany: Federal Agency for Nature Conservation.
  • Billard, R. 1997. Les poissons d'eau douce des rivières de France. Identification, inventaire et répartition des 83 espèces. Lausanne: Delachaux & Niestlé.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 305 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.09 - 38
  Temperature range (°C): 6.107 - 7.379
  Nitrate (umol/L): 1.212 - 1.615
  Salinity (PPS): 6.858 - 6.901
  Oxygen (ml/l): 8.187 - 8.276
  Phosphate (umol/l): 0.236 - 0.274
  Silicate (umol/l): 12.053 - 12.992

Graphical representation

Depth range (m): 0.09 - 38

Temperature range (°C): 6.107 - 7.379

Nitrate (umol/L): 1.212 - 1.615

Salinity (PPS): 6.858 - 6.901

Oxygen (ml/l): 8.187 - 8.276

Phosphate (umol/l): 0.236 - 0.274

Silicate (umol/l): 12.053 - 12.992
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Common in deep (to at least 90 m) cold waters of lakes, reservoirs, and large rivers. In summer, stays in deep cold waters but may move into shallower water at night. Life history may be confined to lakes or rivers or may migrate between lake and riverine habitats; all three patterns may occur within a single river basin. Often exhibits a post-spawning movement into tributary rivers in late winter and early spring. Spawns usually in lakes but may move into rivers to spawn. River-spawning populations prefer low-velocity areas in main channels or in side channels behind deposition bars (see USFWS 2003). Broadcasts eggs usually over sand or gravel (sometimes silt) in up to about 10 ft of water (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 700m.
From 1 to 700 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Potamodromous. Migrating within streams, migratory in rivers, e.g. Saliminus, Moxostoma, Labeo. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May move long distances between spawning and nonspawning habitats (usually 1 to 25 km, but up to 120 km in the Kootenai River) (see USFWS 2003). May move from lake into stream to spawn (Scott and Crossman 1973). Basically sedentary during nonspawning season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Newly hatched burbot are completely planktivorous, and remain so even when they are no longer gape limited (Ghan and Sprules 1993). Diet of larval burbot is dominated by rotifer species for the first two weeks. Diet then shifts to slightly larger nauplii, changing further during week four to cycloid copepoda, daphnia, and calanoid copepoda (Ghan and Sprules 1993). Juveniles have a diet of mollusca and insecta larvae (Tolanen et al. 1999). Adult burbot are piscivorous and consume over 99% actinopterygii by mass in Lake Superior (Bailey 1972). Though burbot are always a primarily piscivorous fish, their diet changes seasonally and in response to competition. After the winter months, Tolanen et al. (1999) found that burbot ate a much higher proportion of aquatic invertebrates, namely crustacea in the early summer and mysida in the fall. In the Vilyusk resevoir, diet overlap with pike forces burbot to broaden their diet breadth to include more benthic invertebrates (Kirillov 1988). In addition to actinopterygii and invertebrates, Bailey (1972) also found rocks, wood chips, plastic, and other inert materials in burbot stomachs, indicating that burbot feeding habits were somewhat indiscriminate.

Animal Foods: fish; insects; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

  • Tolanen, A., J. Kjellmann, J. Lappalainen. 1999. Diet Overlap between Burbot and Whitefish in a Subarctic Lake. Ann. Zool. Fennici, 36: 205-214.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The only member of the family which lives in freshwater. Crepuscular and nocturnal (Ref. 11941). Inhabits deep lakes and large rivers (Ref. 5723) with slow-moving current. Seeks shelter under rocks, in crevices on the river banks, among roots of trees and dense vegetation (Ref. 30578). Those in rivers tend to congregate in deep holes throughout the year, except at spawning (Ref. 27547). Movements into shallower water during summer nights are related to feeding (Ref. 1998). Smaller individuals feed on insect larvae, crayfish, mollusks and other invertebrates with a changing preference for fishes in larger individuals (Ref. 1998). Feeds mainly on fish (Ref. 13439).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Newly hatched burbot are completely planktivorous, and remain so even when they are no longer gape limited (Ghan and Sprules 1993). Diet of larval burbot is dominated by rotifer species for the first two weeks. Diet then shifts to slightly larger nauplii, changing further during week four to cycloid copepods, daphnia, and calanoid copepods (Ghan and Sprules 1993). Juveniles have a diet of molluscs and insect larvae (Tolanen et al. 1999). Adult burbot are piscivorous and consume over 99% fish by mass in Lake Superior (Bailey 1972). Though burbot are always a primarily piscivorous fish, their diet changes seasonally and in response to competition. After the winter months, Tolanen et al. (1999) found that burbot ate a much higher proportion of aquatic invertebrates, namely crustaceans in the early summer and oppossum shrimp in the fall. In the Vilyusk resevoir, diet overlap with pike forces burbot to broaden their diet breadth to include more benthic invertebrates (Kirillov 1988). In addition to fish and invertebrates, Bailey (1972) also found rocks, wood chips, plastic, and other inert materials in burbot stomachs, indicating that burbot feeding habits were somewhat indiscriminate.

Animal Foods: fish; insects; mollusks; aquatic or marine worms; aquatic crustaceans; zooplankton

Primary Diet: carnivore (Piscivore )

  • Tolanen, A., J. Kjellmann, J. Lappalainen. 1999. Diet Overlap between Burbot and Whitefish in a Subarctic Lake. Ann. Zool. Fennici, 36: 205-214.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Young eat mainly immature aquatic insects, crayfish, molluscs, and other deepwater invertebrates. Larger individuals feed mostly on fishes (Becker 1983, Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Burbot are top predators in their ecosystem, sometimes overlapping with similar top predators such as Esox or large salmonidae (Kirillov 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

esox lucius are known to prey on burbot where the two species coexist (Schwalme 1992). Osmerus eperlanus and perca flavescens prey on larval and juvenile individuals (Scott and Crossman 1973). Humans also exert predation pressure on burbot through commercial and sport fisheries (Cohen 1990; Kirillov 1988). In the Great Lakes, the sea lamprey, Petromyzon_marinus, is also known to prey on burbot (Smith 1971). Burbot rely on their cryptic habits and coloration to avoid predators.

Known Predators:

  • northern pike (Esox_lucius)
  • yellow perch (Perca_flavescens)
  • smelt (Osmerus_eperlanus)
  • sea lamprey (Petromyzon_marinus)
  • humans (Homo_sapiens)

Anti-predator Adaptations: cryptic

  • Smith, B. 1971. Sea Lampreys in the Great Lakes of North America. Pp. 207-248 in M Hardisty, ed. The Biology of Lampreys. London: Academic Press.
  • Schwalme, K. 1992. A Quantitative Comparison Betwen Diet and Body Fatty Acid Composition in Wild Northern Pike (Esox_lucius L.). Fish Physiol. Biochem., 10(2): 91-98.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Burbot are top predators in their ecosystem, sometimes overlapping with similar top predators such as pike or large salmonids (Kirillov 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Northern pike are known to prey on burbot where the two species coexist (Schwalme 1992). Smelt and yellow perch prey on larval and juvenile individuals (Scott and Crossman 1973). Humans also exert predation pressure on burbot through commercial and sport fisheries (Cohen 1990; Kirillov 1988). In the Great Lakes, the sea lamprey, Petromyzon marinus, is also known to prey on burbot (Smith 1971). Burbot rely on their cryptic habits and coloration to avoid predators.

Known Predators:

Anti-predator Adaptations: cryptic

  • Schwalme, K. 1992. A Quantitative Comparison Betwen Diet and Body Fatty Acid Composition in Wild Northern Pike (Esox lucius L.). Fish Physiol. Biochem., 10(2): 91-98.
  • Smith, B. 1971. Sea Lampreys in the Great Lakes of North America. Pp. 207-248 in M Hardisty, ed. The Biology of Lampreys. London: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Lota lota preys on:
Pallasea
Gammaracanthus
Myoxocephalus thompsonii
Etheostoma caeruleum

Based on studies in:
Finland (Lake or pond, Pelagic)

This list may not be complete but is based on published studies.
  • J. Sarvala, Paarjarven energiatalous, Luonnon Tutkija 78(4-5):181-190, from p. 184 (1974).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Enteric Redmouth Disease. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Burbot perceive chemical, tactile, visual, and acoustic stimuli, as do most fish. Though burbot and northern pike exhibit similar hunting strategies, burbot appear to rely less on sight than pike (Kahilainen and Lehtonen 2003).

Perception Channels: visual ; acoustic ; vibrations

  • von der Emde, G. 2004. The Senses of Fish: Adaptations for the Reception of Natural Stimuli. Boston: Kluwer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Burbot perceive chemical, tactile, visual, and acoustic stimuli, as do most fish. Though burbot and northern pike exhibit similar hunting strategies, burbot appear to rely less on sight than pike (Kahilainen and Lehtonen 2003).

Perception Channels: visual ; acoustic ; vibrations

  • von der Emde, G. 2004. The Senses of Fish: Adaptations for the Reception of Natural Stimuli. Boston: Kluwer.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Burbot eggs hatch in the spring between April and June depending on location (Bjorn 1940; Cohen 1990). Time to hatching is dependent on temperature as well as the particular population and eggs usually take between 30 and 70 days to hatch (MacCrimmon 1959; Bjorn 1940). In four weeks larval burbot increase in length from less than 1 cm to over 2 cm (Ghan and Sprules 1993). Burbot in Lake Superior exhibited very fast growth rates during the first two growing seasons, attaining 42% of total length after 10 growing seasons (Bailey 1972).

In the Vilyuy River Basin, Siberia, burbot attain sexual maturity in their 7th or 8th year, with males usually maturing 1 year before females (Kirillov 1988). In Lake Superior, burbot as young as one year old were sexually mature (Bailey 1972). Though sexually mature specimens were found for both sexes in year 1 and older age classes, there was a higher proportion of sexually mature males until year 5 when all specimens of both sexes were sexually mature (Bailey 1972). Activity of burbot increases in autumn as energy reserves are concentrated on the growth and development of gonads for the winter spawning season (Kirillov 1988). Maturation of the gonads in both sexes occurs about 4 months after the fall peak in nutritional reserves (Pulliainen and Korhonen 1990).

  • MacCrimmon, H. 1959. Observations on Spawning of Burbot in Lake Simcoe, Ontario. Journal of Wildlife Management, 23(4): 447-449.
  • Kirillov, A. 1988. Burbot of Vilyusk Resevoir. Journal of Ichthyology, 28(2): 49-55.
  • Ghan, D., W. Sprules. 1993. Diet and Prey Selection in Young Burbot. Journal of Fish Biology, 42: 47-64.
  • Bailey, M. 1972. Age, Growth, Reproduction and Food of the Burbot, Lota_lota (Linneaus), in Southwestern Lake Superior. Trans. Amer. Fish. Soc., 4: 667-674.
  • Bjorn, E. 1940. Preliminary Observations and Experimental Study of the ling, Lota_maculosa (LeSueur), in Wyoming. Trans. Am. Fish. Soc., 69: 192-196.
  • Pulliainen, E., K. Korhonen. 1990. Seasonal Changes in Condition Indices in Adult Mature and Non-maturing Burbot, Lota_lota (L.), in the north-eastern Bothnian Bay, Northern Finland. Journal of Fish Biology, 36(2): 251-259.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There appears to be individual movements into spawning areas with the males arriving first at spawning areas (Ref. 27547). It occurs at night, with spawners forming a great globular mass, each pushing toward the center (Ref. 28694), or at least milling around close together (Ref. 28697), releasing eggs or sperm. Observed to make postspawning runs upriver, apparently for feeding (Ref. 28697). Eggs hatch after 40-70 days. After about 2 months, juveniles are benthic, grow rapidly, reach about 8 cm SL within first year. (Ref. 59043).
  • Cohen, D.M., T. Inada, T. Iwamoto and N. Scialabba 1990 FAO species catalogue. Vol. 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated catalogue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish. Synop. 125(10). Rome: FAO. 442 p. (Ref. 1371)   http://www.fishbase.org/references/FBRefSummary.php?id=1371&speccode=25 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Burbot eggs hatch in the spring between April and June depending on location (Bjorn 1940; Cohen 1990). Time to hatching is dependent on temperature as well as the particular population and eggs usually take between 30 and 70 days to hatch (MacCrimmon 1959; Bjorn 1940). In four weeks larval burbot increase in length from less than 1 cm to over 2 cm (Ghan and Sprules 1993). Burbot in Lake Superior exhibited very fast growth rates during the first two growing seasons, attaining 42% of total length after 10 growing seasons (Bailey 1972).

In the Vilyuy River Basin, Siberia, burbot attain sexual maturity in their 7th or 8th year, with males usually maturing 1 year before females (Kirillov 1988). In Lake Superior, burbot as young as one year old were sexually mature (Bailey 1972). Though sexually mature specimens were found for both sexes in year 1 and older age classes, there was a higher proportion of sexually mature males until year 5 when all specimens of both sexes were sexually mature (Bailey 1972). Activity of burbot increases in autumn as energy reserves are concentrated on the growth and development of gonads for the winter spawning season (Kirillov 1988). Maturation of the gonads in both sexes occurs about 4 months after the fall peak in nutritional reserves (Pulliainen and Korhonen 1990).

  • MacCrimmon, H. 1959. Observations on Spawning of Burbot in Lake Simcoe, Ontario. Journal of Wildlife Management, 23(4): 447-449.
  • Kirillov, A. 1988. Burbot of Vilyusk Resevoir. Journal of Ichthyology, 28(2): 49-55.
  • Ghan, D., W. Sprules. 1993. Diet and Prey Selection in Young Burbot. Journal of Fish Biology, 42: 47-64.
  • Bailey, M. 1972. Age, Growth, Reproduction and Food of the Burbot, Lota lota (Linneaus), in Southwestern Lake Superior. Trans. Amer. Fish. Soc., 4: 667-674.
  • Bjorn, E. 1940. Preliminary Observations and Experimental Study of the ling, Lota lota (LeSueur), in Wyoming. Trans. Am. Fish. Soc., 69: 192-196.
  • Pulliainen, E., K. Korhonen. 1990. Seasonal Changes in Condition Indices in Adult Mature and Non-maturing Burbot, Lota lota (L.), in the north-eastern Bothnian Bay, Northern Finland. Journal of Fish Biology, 36(2): 251-259.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The lifespan of burbot has been known to be as high as 20 years, though studies of natural populations rarely see individuals exceeding 10 to 12 years of age (Cohen 1990; Kirillov 1988; Bailey 1972). Incidence of older and larger individuals in nearctic regions may exceed that of older individuals in palearctic regions due to the absence of an established fishery, sport or otherwise, in North America where one thrives in Eurasia (Kirillov 1988).

Range lifespan

Status: wild:
20 (high) years.

Typical lifespan

Status: wild:
1 to 12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The lifespan of burbot has been known to be as high as 20 years, though studies of natural populations rarely see individuals exceeding 10 to 12 years of age (Cohen 1990; Kirillov 1988; Bailey 1972). Incidence of older and larger individuals in nearctic regions may exceed that of older individuals in palearctic regions due to the absence of an established fishery, sport or otherwise, in North America where one thrives in Eurasia (Kirillov 1988).

Range lifespan

Status: wild:
20 (high) years.

Typical lifespan

Status: wild:
1 to 12 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Burbot breed once per year in the winter, migrating to shallow water or to a smaller stream to spawn (Cohen 1990). Burbot move to spawning areas individually and males tend to arrive before females (Morrow 1980). Spawning occurs during the night when individuals form a globular mass, each fish pushing toward the center and releasing eggs or sperm (MacCrimmon 1959; Cahn 1936). Postspawning runs upstream have been observed, most likely for feeding (MacCrimmon 1959).

Mating System: polygynandrous (promiscuous)

Burbot are potamodromous, migrating up tributaries or smaller stream reaches to spawn (Cohen 1990). They spawn in winter, laying their eggs in shallow water to hatch during the spring (Kirillov 1988). Fecundity varies geographically from slightly above 100,000 in specimens from Wyoming to over 3 million elsewhere in their range (Bailey 1972). Average fecundity ranges from 700,000 to 800,000 eggs (Kirillov 1988; Bailey 1972). Eggs are yellow, amber, or orange in color, spherical, and rest on the substrate (Koli 1990; Bjorn 1940). Eggs usually hatch in two to four months.

Burbot may take several years to become sexually mature. Present literature indicates a certain proportion of burbot populations fail to mature during each breeding season (Pulliainen and Korhonen 1990). Some studies have also suggested that burbot may take one or two years to restore nutritional reserves after a spawning event (Pulliainen and Korhonen 1990).

Breeding interval: Burbot spawn once yearly.

Breeding season: Burbot spawning occurs in the winter between December and March (varies geographically) but lasts no longer than one month for any one population.

Range number of offspring: 100000 to 3000000.

Average number of offspring: 700000-800000.

Range time to hatching: 2 to 4 months.

Range age at sexual or reproductive maturity (female): 1 to 8 years.

Average age at sexual or reproductive maturity (female): 6 years.

Range age at sexual or reproductive maturity (male): 1 to 8 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Burbot are broadcast spawners and provide no parental care. Parental investment in burbot is characterized by an increased metabolic activity level and food consumption rates in the fall in order to contribute to the growth and maturation of gonads in both male and females over a four month period preceeding spawning events (Pulliainen and Kohonen 1990; Kirrilov 1988). It has been suggested that burbot may require one to two years to replenish their nurtritional reserves after each spawning event, but no further information on this topic was available (Pulliainen and Kohonen 1990).

Parental Investment: pre-fertilization (Provisioning)

  • Cohen, D., T. Inada, T. Iwamoto, N. Scialabba. 1990. Gadiform fishes of the world : Order Gadiformes, an annotated and illustrated catalogue. Rome: Food and Agriculture Organization of the United Nations.
  • Morrow, J. 1980. The Freshwater Fishes of Alaska. University of British Columbia Resource Ecology Library: University of British Columbia.
  • MacCrimmon, H. 1959. Observations on Spawning of Burbot in Lake Simcoe, Ontario. Journal of Wildlife Management, 23(4): 447-449.
  • Koli, L. 1990. Fishes of Finland. Helsinki: Werner Söderström Osakeyhtiö.
  • Kirillov, A. 1988. Burbot of Vilyusk Resevoir. Journal of Ichthyology, 28(2): 49-55.
  • Bailey, M. 1972. Age, Growth, Reproduction and Food of the Burbot, Lota_lota (Linneaus), in Southwestern Lake Superior. Trans. Amer. Fish. Soc., 4: 667-674.
  • Bjorn, E. 1940. Preliminary Observations and Experimental Study of the ling, Lota_maculosa (LeSueur), in Wyoming. Trans. Am. Fish. Soc., 69: 192-196.
  • Cahn, A. 1936. Observations on the Breeding of Lawyer, Lota_maculosa . Copeia, 3: 163-165.
  • Pulliainen, E., K. Korhonen. 1990. Seasonal Changes in Condition Indices in Adult Mature and Non-maturing Burbot, Lota_lota (L.), in the north-eastern Bothnian Bay, Northern Finland. Journal of Fish Biology, 36(2): 251-259.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Burbot breed once per year in the winter, migrating to shallow water or to a smaller stream to spawn (Cohen 1990). Burbot move to spawning areas individually and males tend to arrive before females (Morrow 1980). Spawning occurs during the night when individuals form a globular mass, each fish pushing toward the center and releasing eggs or sperm (MacCrimmon 1959; Cahn 1936). Postspawning runs upstream have been observed, most likely for feeding (MacCrimmon 1959).

Mating System: polygynandrous (promiscuous)

Burbot are potamodromous, migrating up tributaries or smaller stream reaches to spawn (Cohen 1990). They spawn in winter, laying their eggs in shallow water to hatch during the spring (Kirillov 1988). Fecundity varies geographically from slightly above 100,000 in specimens from Wyoming to over 3 million elsewhere in their range (Bailey 1972). Average fecundity ranges from 700,000 to 800,000 eggs (Kirillov 1988; Bailey 1972). Eggs are yellow, amber, or orange in color, spherical, and rest on the substrate (Koli 1990; Bjorn 1940). Eggs usually hatch in two to four months.

Burbot may take several years to become sexually mature. Present literature indicates a certain proportion of burbot populations fail to mature during each breeding season (Pulliainen and Korhonen 1990). Some studies have also suggested that burbot may take one or two years to restore nutritional reserves after a spawning event (Pulliainen and Korhonen 1990).

Breeding interval: Burbot spawn once yearly.

Breeding season: Burbot spawning occurs in the winter between December and March (varies geographically) but lasts no longer than one month for any one population.

Range number of offspring: 100000 to 3000000.

Average number of offspring: 700000-800000.

Range time to hatching: 2 to 4 months.

Range age at sexual or reproductive maturity (female): 1 to 8 years.

Average age at sexual or reproductive maturity (female): 6 years.

Range age at sexual or reproductive maturity (male): 1 to 8 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

Burbot are broadcast spawners and provide no parental care. Parental investment in burbot is characterized by an increased metabolic activity level and food consumption rates in the fall in order to contribute to the growth and maturation of gonads in both male and females over a four month period preceeding spawning events (Pulliainen and Kohonen 1990; Kirrilov 1988). It has been suggested that burbot may require one to two years to replenish their nurtritional reserves after each spawning event, but no further information on this topic was available (Pulliainen and Kohonen 1990).

Parental Investment: pre-fertilization (Provisioning)

  • Cohen, D., T. Inada, T. Iwamoto, N. Scialabba. 1990. Gadiform fishes of the world : Order Gadiformes, an annotated and illustrated catalogue. Rome: Food and Agriculture Organization of the United Nations.
  • Morrow, J. 1980. The Freshwater Fishes of Alaska. University of British Columbia Resource Ecology Library: University of British Columbia.
  • MacCrimmon, H. 1959. Observations on Spawning of Burbot in Lake Simcoe, Ontario. Journal of Wildlife Management, 23(4): 447-449.
  • Koli, L. 1990. Fishes of Finland. Helsinki: Werner Söderström Osakeyhtiö.
  • Kirillov, A. 1988. Burbot of Vilyusk Resevoir. Journal of Ichthyology, 28(2): 49-55.
  • Bailey, M. 1972. Age, Growth, Reproduction and Food of the Burbot, Lota lota (Linneaus), in Southwestern Lake Superior. Trans. Amer. Fish. Soc., 4: 667-674.
  • Bjorn, E. 1940. Preliminary Observations and Experimental Study of the ling, Lota lota (LeSueur), in Wyoming. Trans. Am. Fish. Soc., 69: 192-196.
  • Cahn, A. 1936. Observations on the Breeding of Lawyer, Lota lota . Copeia, 3: 163-165.
  • Pulliainen, E., K. Korhonen. 1990. Seasonal Changes in Condition Indices in Adult Mature and Non-maturing Burbot, Lota lota (L.), in the north-eastern Bothnian Bay, Northern Finland. Journal of Fish Biology, 36(2): 251-259.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns mainly in winter in North America. Eggs hatch in about a month. Individuals spawn annually or in alternate years. Usually sexually mature in 3-4 years (males) or 4-5 years (females) (see USFWS 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lota lota

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGCTGATTTTTCTCGACCAATCACAAAGACATTGGCACCCTCTATCTCGTATTTGGTGCCTGAGCCGGCATAGTCGGAACAGCCCTAAGCCTGCTCATTCGAGCAGAGCTAAGTCAACCCGGCGCACTCCTTGGTGAC---GATCAGATTTATAATGTAATCGTCACAGCACACGCTTTCGTAATAATTTTCTTTATAGTAATACCACTAATAATTGGAGGCTTCGGAAACTGACTAGTCCCCCTAATGATCGGCGCCCCCGATATAGCCTTTCCTCGTATGAACAACATGAGCTTCTGACTTCTTCCTCCATCATTCTTGCTTCTCCTAGCATCCTCTGGGGTAGAAGCCGGAGCCGGAACAGGTTGAACTGTATACCCTCCTCTAGCAGGCAATCTTGCTCATGCTGGGGCTTCTGTTGACCTTACTATTTTCTCCCTGCATTTAGCAGGGGTCTCATCAATTCTTGGAGCAATTAATTTTATTACCACCATCATCAACATGAAACCCCCAGCAATCTCACAATATCAAACACCGCTATTTGTCTGAGCAGTCCTAATTACAGCCGTCCTACTACTCCTGTCTCTCCCCGTTTTAGCCGCTGGTATTACGATACTGCTGACTGATCGAAATCTTAATACTTCCTTCTTTGACCCCGCTGGAGGAGGGGACCCAATTCTGTATCAGCACTTATTCTGATTCTTTGGTCACCCTGAAGTCTACATTCTTATTCTTCCAGGCTTTGGAATAATCTCACACATCGTAGCATACTACTCAGGGAAAAAAGAACCTTTTGGTTACATAGGAATAGTTTGAGCTATAATGGCCATTGGCCTTCTTGGCTTTATCGTGTGAGCTCATCATATATTTACGGTGGGAATAGATGTTGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lota lota

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Burbot are near extinction in the Kootnai river in Idaho and British Columbia due to construction of the Libby dam in Idaho. Efforts to bring back the population are ongoing (Kootnai River Fisheries Investigation 2000). Burbot are stocked where commercial fisheries exist in Europe (Kirillov 1988).

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • Idaho Department of Fish and Game. Kootenai River Fisheries Investigation: Stock Status of Burbot. 85-65. Boise, Idaho: Idaho Department of Fish and Game. 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Justification
A widespread species but locally threatened by river regulation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Burbot are near extinction in the Kootnai river in Idaho and British Columbia due to construction of the Libby dam in Idaho. Efforts to bring back the population are ongoing (Kootnai River Fisheries Investigation 2000). Burbot are stocked where commercial fisheries exist in Europe (Kirillov 1988).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Idaho Department of Fish and Game. Kootenai River Fisheries Investigation: Stock Status of Burbot. 85-65. Boise, Idaho: Idaho Department of Fish and Game. 2000.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
No major threats known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of burbot on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Burbot are an important commercial fishery in parts Eurasia where they are used as a source of oil, the flesh is eaten, and liver is sold smoked or canned (Kirillov 1988; Scott and Crossman 1973). Burbot are also processed into fish meal (Scott and Crossman 1973). Because of slow movements and nocturnal habits, little or no sport fishery exists in North America (Cohen 1990).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: experimental; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative effects of burbot on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Burbot are an important commercial fishery in parts Eurasia where they are used as a source of oil, the flesh is eaten, and liver is sold smoked or canned (Kirillov 1988; Scott and Crossman 1973). Burbot are also processed into fish meal (Scott and Crossman 1973). Because of slow movements and nocturnal habits, little or no sport fishery exists in North America (Cohen 1990).

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Burbot

Burbot, Lota lota

The burbot (Lota lota) or bubbot[1] is the only gadiform (cod-like) freshwater fish. Also known as mariah, the lawyer, and (misleadingly) eelpout, the burbot is closely related to the marine common ling and the cusk. It is the only member of the genus Lota.

Contents

Etymology

The name burbot comes from the Latin word barba, meaning beard, referring to the single chin whisker, or barbel.[2] The genus and species name "lota" comes from the old French[3] "lotte", fish named also "barbot" in this language. The InuktitutIñupiaq word for burbot was also used to name the recently discovered extinct transitional species Tiktaalik.

Description

Like a cross between the catfish and the eel, the burbot has a serpentine-like body, but is easily distinguished by a single barbel on the chin.[2] The body is elongated and laterally compressed with a flattened head and single tube-like projection for each nostril. The mouth is wide, with both upper and lower jaws consisting of many small teeth. Burbot have two soft dorsal fins: the first being low and short, the second being much longer. The anal fin is low and almost as long as the dorsal fin. The caudal fin is rounded, the pectoral fins are fan-shaped, and pelvic fins are narrow with an elongate second fin ray. Having such small fins relative to body size indicate a benthos lifestyle with low swimming endurance, unable to withstand strong currents. The circular or cycloid scales are very small, making it difficult to accurately age, and thus even more challenging to manage.[4] The burbot is commonly confused with the close, ocean dwelling relative : the lingcod.

Geographic Distribution

Burbot have circumpolar distribution above 40°N latitude. Populations are continuous from the British Isles eastward across Europe and Asia to the Bering Strait. On the North American side, burbot range eastward from the Seward Peninsula in Alaska to New Brunswick along the Atlantic coast. Burbot are most common in streams and lakes of North America and Europe. They are fairly common in Lake Erie but are also found in the other Great Lakes. Recent genetic analysis suggest that the geographic pattern of burbot may indicate multiple species or sub-species, making this single taxon species somewhat misleading.[4]

United Kingdom

In Britain, the burbot is possibly an extinct fish, as it is believed that there have been no documented catches of the species since the 1970s. [2] If the burbot does still survive in the UK, the counties of Cambridgeshire and Yorkshire (particularly the River Derwent or River Ouse) seem to be the strongest candidates for areas in which the species might yet continue to survive [3]. There have been plans to re-introduce this freshwater member of the cod family back into British waters but these have yet to come to fruition.

Ecology

Habitat

Burbot live in large, cold rivers, lakes, and reservoirs. Primarily preferring freshwater habitats, but able to thrive in brackish environments for spawning. During summer months, they are typically found in the colder water below the thermocline. In Lake Superior, burbot can live at depths below 300 meters.[4] As benthic fish, they tolerate an array of substrate types including mud, sand, rubble, boulder, silt, and gravel for feeding.[5] Adults will construct extensive burrows in the substrate for shelter during the day. As crepuscular fish, burbot are active hunters at night.[4] Burbot populations are adfluvial during the winter months, and they migrate to near-shore reefs and shoals to spawn,[4] preferring spawning grounds of sand or gravel.[5]

Life history

Burbot reach sexual maturity between 4 and 7 years of age.[6] Spawning season typically occurs between December and March, often under ice at extremely low temperatures ranging between 1 and 4° Celsius. Though a relatively short season lasting from two to three weeks, burbot will spawn multiple times, but not every year.[4]

As broadcast spawners, burbot do not have an explicit nesting site, but rather release eggs and sperm into the water column to drift and settle. When spawning, many male burbot will gather around one or two females, forming a spawning ball. Writhing in the open water, males and females will simultaneous release sperm and eggs. Depending on water temperatures, the incubation period of the eggs will last from 30 to 128 days. Fertilized eggs will then drift until they settle into cracks and holes in the substrate.[6]

Depending on body size, female burbot fecundity ranges from 63,000 to 3,477,699 eggs for each batch.[4] Rate of growth, longevity, and age of sexual maturity of burbot are strongly correlated of with water temperature: large, older individuals produce more eggs than small, younger individuals. Eggs are round with a large oil globule, approximately 1 mm in diameter and have an optimal incubation range between 1 and 7° Celsius.[4]

Newly hatched burbot larvae are pelagic, passively drifting in the open water. Habitats about 12° Celsius are known to be intolerable for larval burbot.[6] By night, juveniles are active, taking shelter during the day under rocks and other debris. Growing rapidly in their first year, burbot reach between 11–12 cm in total length by late fall.[4] During the second year of life, burbot on average will grow another 10 cm.[7]

Burbot transition from pelagic habitats to favor benthic environments as they reach adulthood, around 5 years old. Average length of burbot by maturity is approximately 40 cm, with slight sexual dimorphism.[7] Maximum length ranges between 30 and 60 cm, and weigh between 1 and 3 kg.

Diet

At the larval stage, month-old burbot will begin exogenous feeding, consuming food through the mouth and digesting in the intestines. Burbot at the larval stage and into the juvenile stage will feed on invertebrates based on size: Under 1 cm, burbot will eat copepods and cladocerans, and above 1 and 2 cm zooplankton and amphipods. As adults, burbot are primarily piscivores, preying on lamprey, whitefish, grayling, northern pike, suckers, stickleback, trout, and perch.[4] At times, burbot will also eat insects and other macroinvertebrates and have been known to eat frogs, snakes, and birds. Having such a wide diet is also correlated to their tendency to bite lures, making them very easy to catch.

Commercial significance

The burbot is edible. In Finland, its roe is sold as caviar. There is an annual spearfishing tournament held near Roblin, Manitoba, Canada. One of the highlights of the tournament is the fish-fry where the day's catch is served up deep-fried. When cooked, burbot meat tastes very similar to American lobster, leading to the burbot's nickname of "poor man's lobster."

In the 1920s, Minnesota druggist Theodore "Ted" H. Rowell and his father, Joseph Rowell, a commercial fisherman on Lake of the Woods, were using the burbot as feed for the foxes on Joe’s blue-fox farm. They discovered that the burbot contained something that improved the quality of the foxes’ furs; this was confirmed by the fur buyers who commented that these furs were superior to other furs they were seeing. Ted Rowell felt it was something in the burbot, so he extracted some oil and sent it away to be assayed. The result of the assay was that the liver of the burbot has 3 to 4 times the potency in vitamin D, and 4 to 10 times in vitamin A, than “good grades” of cod-liver oil. The vitamin content varies in Burbot from lake to lake, where their diet may have some variation. Additionally, the burbot liver makes up approximately 10% of the fish's total body weight, and its liver is six times the size of those of freshwater fish of comparable size. Ted also found in his research that the oil is lower in viscosity, and more rapidly digested and assimilated than most other fish liver oils. Ted went on to found the Burbot Liver Products Company which later became Rowell Laboratories, Inc., of Baudette, Minnesota, and is today a subsidiary of Solvay Pharmaceuticals of Brussels, Belgium.

Evelyn C. Smith researched and developed of the use of livers from the fresh water burbot for fish oil strong in vitamin A and D. She started during the Great Depression (1929) by offering free burbot oil to the poor and grew to commercializing the oil until the sale of the production equipment to the Rowell Fish Company in 1940.[8]

Angling

Batchawana Bay, Lake Superior

The IGFA recognizes the world record burbot as caught on Lake Diefenbaker, Canada by Sean Konrad on March 27, 2010. The fish weighed 25 pounds 2 ounces (11.4 kg).[9]

The burbot is a tenacious predator, which will sometimes attack other fish that are almost the same size and as such can be a nuisance fish in waters where it is not native. Recent discoveries of burbot in the Green River at Flaming Gorge Reservoir in Utah have concerned wildlife biologists who fear that the burbot could decimate the sport fish population in what is recognized as one of the world's top Brown Trout fisheries, because it often feeds on the eggs of other fish in the lake like Sockeye salmon. The Utah Division of Fish and Game has instituted a "No Release" "Catch and Kill" regulation for the burbot in Utah waterways.[10]

The town of Walker, Minnesota, holds an International Eelpout Festival every winter on Leech Lake.[11] The festival received national attention on March 4, 2011 when a correspondent from The Tonight Show with Jay Leno did a segment on the event.

Conservation status

Burbot populations are difficult to study, due to their deep habitats and reproduction under ice. Although burbot global distribution is widespread and abundant, many populations have been threatened or extirpated. Lacking popularity in commercial fishing, many regions do not even consider management plans. Pollution and habitat change such as river damming appear to be the primary causes for riverine burbot populations, while pollution and the adverse effects of invasive species have the greatest influence on lacustrine populations. Management of burbot is on low priority, being non-existent in some regions.[12]

References

  1. ^ http://www.ukdivers.net/life/fishcards.htm
  2. ^ a b http://www.dnr.state.mn.us/volunteer/janfeb00/burbot_profile.html
  3. ^ http://www.cnrtl.fr/etymologie/lotte
  4. ^ a b c d e f g h i j https://research.idfg.idaho.gov/Fisheries%20Research%20Reports/Res03-33McPhail2000%20Burbot%20Biology%20and%20Life%20History.pdf
  5. ^ a b http://www.michigandnr.com/PUBLICATIONS/PDFS/ifr/ifrlibra/special/reports/sr37/SR37_app02_pp108_thru_119.pdf
  6. ^ a b c http://nhguide.dbs.umt.edu/index.php?c=fish&m=desc&id=6
  7. ^ a b http://www.tandfonline.com/doi/abs/10.1577/1548-8659(1972)101%3C667%3AAGRAFO%3E2.0.CO%3B2
  8. ^ "Smith Bros. Family History
  9. ^ IGFA World Record for burbot
  10. ^ http://www.ksl.com/?nid=148&sid=11968637&hl=6
  11. ^ "Annual International Eelpout Festival." Annual International Eelpout Festival. 26 April 2008. 29 May 2008 [1]
  12. ^ http://onlinelibrary.wiley.com/doi/10.1111/j.1467-2979.2009.00340.x/abstract
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The only freshwater member of the family (Nelson 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!