Articles on this page are available in 1 other language: Arabic (15) (learn more)

Overview

Comprehensive Description

Biology

Epibenthic and littoral, entering estuaries and lagoons (Ref. 4343). Usually seen in pairs, hovering a short distance above the substratum. Monogamous (Ref. 52884). t builds its burrow in sand or silty sand by moving out mouthfuls of sediment (Ref. 11441).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: Red Sea and East Africa south to Durban (South Africa), including most islands in the western Indian Ocean islands; Indonesia, Australia and South Pacific islands. Also known from Japan and Philippines (Ref. 2798).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, KwaZulu-Natal (South Africa), Seychelles, Madagascar and Mascarenes (Mauritius, Rodrigues) east to Philippines (possibly Gambier Islands), north to southern Japan, south to Queensland (Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 13 - 15; Analspines: 1; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 180 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

18.0 cm SL (male/unsexed; (Ref. 2798))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Also epibenthic and littoral, entering estuaries and lagoons (Ref. 4343).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Males with 3 black spots near base of 2nd dorsal fin and round spots on cheek; females with brown-edged band from upper lip to upper operculum (Ref. 2798).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 25 samples.

Environmental ranges
  Depth range (m): 0.61 - 13.725
  Temperature range (°C): 24.659 - 29.336
  Nitrate (umol/L): 0.048 - 0.862
  Salinity (PPS): 34.323 - 37.566
  Oxygen (ml/l): 4.314 - 4.825
  Phosphate (umol/l): 0.134 - 0.301
  Silicate (umol/l): 1.205 - 4.102

Graphical representation

Depth range (m): 0.61 - 13.725

Temperature range (°C): 24.659 - 29.336

Nitrate (umol/L): 0.048 - 0.862

Salinity (PPS): 34.323 - 37.566

Oxygen (ml/l): 4.314 - 4.825

Phosphate (umol/l): 0.134 - 0.301

Silicate (umol/l): 1.205 - 4.102
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in sandy areas around coral reefs and constructs burrows in the sand (Ref. 6110). Present in seagrass beds at adult stage (Ref. 41878). Feeds on microalgae and benthic invertebrates (Ref. 11889).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblygobius albimaculatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTTGTATTCGGTGCATGAGCCGGAATGGTAGGCACAGCACTAAGCCTACTAATCCGGGCCGAACTTAGTCAACCCGGCGCATTACTGGGTGACGACCAAATTTACAATGTAATCGTAACCGCCCACGCATTCGTAATAATTTTCTTTATAGTAATGCCGATTATGATCGGAGGCTTTGGAAACTGGCTCATTCCACTTATGATTGGTGCCCCAGACATGGCATTTCCTCGAATAAATAATATGAGCTTTTGACTTCTCCCCCCGTCCTTCCTTCTTCTTCTAGCATCCTCTGGAGTAGAAGCCGGGGCAGGAACGGGATGAACTGTTTACCCGCCCTTAGCAGGCAACCTCGCACACGCAGGAGCATCTGTTGACTTAACAATCTTTTCTCTACATTTAGCAGGTATTTCCTCAATCCTAGGGGCCATCAACTTCTTTACAACAATCCTCAATATGAAACCTCCAGCCATTTCACAGTACCAGACTCCTTTATTTGTTTGAGCAGTTTTAATTACAGCGGTACTTCTTCTTCTGTCTCTGCCAGTTCTTGCTGCCGGGATCACAATGCTCCTAACAGACCGAAACTTAAATACCACCTTCTTTGACCCTGCAGGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblygobius albimaculatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!