Overview

Comprehensive Description

Biology

Occurs on outer reef slopes to depths of 2 to more than 20 m (Ref. 1602, 48637), often silty habitats. Young float with loose surface weeds and adults are often with large Sargassum rafts during the wet season (Ref. 48637). Solitary. Feeds on benthic organisms (Ref. 30573). Somewhat secretive (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Chagos, Kenya, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea south to South Africa (Ref. 4421) and east to southern Japan and southeastern Oceania. Eastern Atlantic: Gulf of Guinea, Annobon Islands, south coast of Africa (Ref. 3592). Replaced by Cantherhines sandwichiensis in the Hawaiian Islands (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 32 - 36; Analspines: 0; Analsoft rays: 29 - 32
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 3592))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Occurs on outer reef slopes to depths of 2 to more than 20 m (Ref. 1602). Solitary.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Can adopt three basic color patterns: mottled grey and brown, dark brown, or grey with a network of close-set polygonal spots. All have a small white spot at the rear base of the second dorsal fin and sometimes the anal fin.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 1.22 - 60.3912
  Temperature range (°C): 25.702 - 28.941
  Nitrate (umol/L): 0.094 - 0.862
  Salinity (PPS): 34.134 - 35.314
  Oxygen (ml/l): 4.517 - 4.640
  Phosphate (umol/l): 0.092 - 0.213
  Silicate (umol/l): 0.900 - 1.557

Graphical representation

Depth range (m): 1.22 - 60.3912

Temperature range (°C): 25.702 - 28.941

Nitrate (umol/L): 0.094 - 0.862

Salinity (PPS): 34.134 - 35.314

Oxygen (ml/l): 4.517 - 4.640

Phosphate (umol/l): 0.092 - 0.213

Silicate (umol/l): 0.900 - 1.557
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 20m.
From 2 to 20 meters.

Habitat: reef-associated. Honeycomb filefish.  (Ruppell, 1837)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 20 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Genomic DNA is available from 2 specimens with morphological vouchers housed at Florida Museum of Natural History
Public Domain

Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cantherhines pardalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 20
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cantherines pardalis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC7509-09|NC_011325|Cantherines pardalis| ACCCGTTGACTCTTTTCAACTAATCACAAAGACATCGGCACCCTCTACTTAATTTTTGGTGCTTGAGCCGGAATAGCAGGGACTGCTCTA---AGCCTTTTAATTCGGGCGGAGCTAAGCCAGCCCGGCGCCCTTCTGGGGGAC---GACCAAATTTATAATGTGATCGTCACAGCTCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAGTCATGATTGGAGGCTTCGGAAACTGGCTTATTCCACTGATA---ATTGGCGCCCCCGACATGGCCTTTCCTCGAATGAACAATATGAGCTTCTGACTGCTCCCCCCTTCTCTTCTTCTTCTCCTCGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACTGGTTGGACCGTATACCCCCCTCTAGCAGGCAACCTTGCCCATGCAGGAGCATCCGTAGATTTA---ACAATTTTCTCTCTGCATCTAGCGGGTATCTCCTCAATCCTTGGTGCAATTAATTTCATTACAACCATCATTAACATGAAACCTCCGACTATTTCCCAATATCAAACCCCTTTATTCGTATGAGCTGTCCTAATTACAGCCGTACTTCTTCTTCTCTCATTACCTGTACTTGCTGCT---GGTATTACAATACTTTTAACTGACCGAAATTTAAATACCACCTTCTTCGACCCAGCCGGAGGGGGAGACCCAATTTTATATCAACATTTATTCTGGTTCTTTGGACACCCTGAAGTATACATTTTAATTATTCCGGGGTTTGGAATAGTCTCGCATATCGTTGCCTATTATTCCGGCAAAAAA---GAACCTTTCGGCTACATGGGCATGGTGTGAGCAATAATAGCCATTGGCCTACTAGGGTTCATGGTTTGGGCCCACCACATGTTTACAGTCGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cantherines pardalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!