Overview
Comprehensive Description
Biology
Occurs on outer reef slopes to depths of 2 to more than 20 m (Ref. 1602, 48637), often silty habitats. Young float with loose surface weeds and adults are often with large Sargassum rafts during the wet season (Ref. 48637). Solitary. Feeds on benthic organisms (Ref. 30573). Somewhat secretive (Ref. 9710).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Distribution
Distribution
Chagos, Kenya, Mozambique, Red Sea, Reunion, Seychelles, Somalia, South Africa (country)
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Randall, J.E. (1992). Red Sea Reef Fishes. Immel Publishing.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6091
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Bock, K.R. (1996). Checklist of the reef fishes of Diani and Galu, Kenya. Journal of East African natural History 85: 5-22.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6357
-
Letourneur, Y., M. Harmelin-Vivien & R. Galzin (1993). Impact of hurricane Firinga on fish community structure on fringing reefs of Reunion Island, S.W. Indian Ocean. Environmental Biology of Fishes 37: 109-120
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6048
Trusted
Indo-Pacific: Red Sea south to South Africa (Ref. 4421) and east to southern Japan and southeastern Oceania. Eastern Atlantic: Gulf of Guinea, Annobon Islands, south coast of Africa (Ref. 3592). Replaced by Cantherhines sandwichiensis in the Hawaiian Islands (Ref. 37816).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Physical Description
Morphology
Dorsal spines (total): 2; Dorsal soft rays (total): 32 - 36; Analspines: 0; Analsoft rays: 29 - 32
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
25.0 cm TL (male/unsexed; (Ref. 3592))
-
Harmelin-Vivien, M.L. and J.-C. Quéro 1990 Monacanthidae. p. 1061-1066. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI, Paris; and UNESCO, Paris. Vol. 2. (Ref. 3592)
http://www.fishbase.org/references/FBRefSummary.php?id=3592&speccode=1081
Trusted
Diagnostic Description
Description
Occurs on outer reef slopes to depths of 2 to more than 20 m (Ref. 1602). Solitary.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Can adopt three basic color patterns: mottled grey and brown, dark brown, or grey with a network of close-set polygonal spots. All have a small white spot at the rear base of the second dorsal fin and sometimes the anal fin.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Ecology
Habitat
Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6 samples.
Environmental ranges
Depth range (m): 1.22 - 60.3912
Temperature range (°C): 25.702 - 28.941
Nitrate (umol/L): 0.094 - 0.862
Salinity (PPS): 34.134 - 35.314
Oxygen (ml/l): 4.517 - 4.640
Phosphate (umol/l): 0.092 - 0.213
Silicate (umol/l): 0.900 - 1.557
Graphical representation
Depth range (m): 1.22 - 60.3912
Temperature range (°C): 25.702 - 28.941
Nitrate (umol/L): 0.094 - 0.862
Salinity (PPS): 34.134 - 35.314
Oxygen (ml/l): 4.517 - 4.640
Phosphate (umol/l): 0.092 - 0.213
Silicate (umol/l): 0.900 - 1.557
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 6 samples.
Environmental ranges
Depth range (m): 1.22 - 60.3912
Temperature range (°C): 25.702 - 28.941
Nitrate (umol/L): 0.094 - 0.862
Salinity (PPS): 34.134 - 35.314
Oxygen (ml/l): 4.517 - 4.640
Phosphate (umol/l): 0.092 - 0.213
Silicate (umol/l): 0.900 - 1.557
Graphical representation
Depth range (m): 1.22 - 60.3912
Temperature range (°C): 25.702 - 28.941
Nitrate (umol/L): 0.094 - 0.862
Salinity (PPS): 34.134 - 35.314
Oxygen (ml/l): 4.517 - 4.640
Phosphate (umol/l): 0.092 - 0.213
Silicate (umol/l): 0.900 - 1.557
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 2 - 20m.
From 2 to 20 meters.
Habitat: reef-associated. Honeycomb filefish. (Ruppell, 1837)
From 2 to 20 meters.
Habitat: reef-associated. Honeycomb filefish. (Ruppell, 1837)
Trusted
Environment
reef-associated; marine; depth range 2 - 20 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Molecular Biology and Genetics
Molecular Biology
Genomic DNA is available from 2 specimens with morphological vouchers housed at Florida Museum of Natural History
Trusted
Statistics of barcoding coverage: Cantherhines pardalis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 20
Species With Barcodes: 1
Public Records: 4
Species: 20
Species With Barcodes: 1
Trusted
Barcode data: Cantherines pardalis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GBGC7509-09|NC_011325|Cantherines pardalis| ACCCGTTGACTCTTTTCAACTAATCACAAAGACATCGGCACCCTCTACTTAATTTTTGGTGCTTGAGCCGGAATAGCAGGGACTGCTCTA---AGCCTTTTAATTCGGGCGGAGCTAAGCCAGCCCGGCGCCCTTCTGGGGGAC---GACCAAATTTATAATGTGATCGTCACAGCTCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAGTCATGATTGGAGGCTTCGGAAACTGGCTTATTCCACTGATA---ATTGGCGCCCCCGACATGGCCTTTCCTCGAATGAACAATATGAGCTTCTGACTGCTCCCCCCTTCTCTTCTTCTTCTCCTCGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACTGGTTGGACCGTATACCCCCCTCTAGCAGGCAACCTTGCCCATGCAGGAGCATCCGTAGATTTA---ACAATTTTCTCTCTGCATCTAGCGGGTATCTCCTCAATCCTTGGTGCAATTAATTTCATTACAACCATCATTAACATGAAACCTCCGACTATTTCCCAATATCAAACCCCTTTATTCGTATGAGCTGTCCTAATTACAGCCGTACTTCTTCTTCTCTCATTACCTGTACTTGCTGCT---GGTATTACAATACTTTTAACTGACCGAAATTTAAATACCACCTTCTTCGACCCAGCCGGAGGGGGAGACCCAATTTTATATCAACATTTATTCTGGTTCTTTGGACACCCTGAAGTATACATTTTAATTATTCCGGGGTTTGGAATAGTCTCGCATATCGTTGCCTATTATTCCGGCAAAAAA---GAACCTTTCGGCTACATGGGCATGGTGTGAGCAATAATAGCCATTGGCCTACTAGGGTTCATGGTTTGGGCCCACCACATGTTTACAGTCGGAATGG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Cantherines pardalis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1
Public Records: 2
Species: 2
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



