Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Commercially cultured in Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species occurs in the northwest Pacific, including the Republic of Korea, Japan, and Taiwan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northwest Pacific: Japan to Taiwan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Japan and Taiwan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in coral and rocky areas from 3-10 m (R. Myers pers. comm. 2008). It has been observed in coral atolls (Nanami and Nishihira 2004). Juveniles feed on small crustaceans including copepods, isopods, tanaids and cumaceans from algal mats, while adults consume polychaetes, sipunculids, gastropods, chitons and crustaceans including crabs, shrimps and hermit crabs (Shibuno et al. 1993).

It was reported to spawn during mid-morning, before 10:00 am (Moyer 1974, Meyer 1977), group or aggregate spawning (Meyer 1977) by the terminal phase was observed in the Japanese waters. There was no evidence of spawning during late morning and afternoon, and the observations of spawning were four days prior to the new moon (Moyer 1974). Breeding ground of this species is approximately 200 m2, varying from nine to 11 m in depth. Water temperature was 27 °C (Moyer 1974).

Spawning begins with the arrival of large numbers of initial-phase fish at the coral or rocky areas, where they begin to mill about in increasingly tighter aggregations (Thresher 1984). The size of aggregations varies from a dozen to as many as several hundred individuals with different-sized aggregates. In addition, it has been reported to perform a “bobbing” motion while swimming with the entire body arcing up and down (Moyer 1974, Meyer 1977).

Moyer (1974) described the spawning behaviour of T. cupido in detail. During the first day of spawning, this species aggregates close to the rocks, and split periodically into three or four groups of close to 100 individuals each. Larger fish appeared to be about 10-13 cm in length and were obviously the aggressors. Only one or rarely two or three fish in each group dash up to discharge their reproductive clouds. Second day, the number of fish participating had decreased remarkably compared to the first day. On the fifth day, reproductive activity has almost ceased, but small individuals of about fifteen fish were sighted. Little herding and no clouds of reproductive materials were observed.

Hatched in a captivity laboratory environment, eggs of this species were found to be buoyant and spherical with a single spherical oil globule. Diameters ranged from 0.54 mm to 0.65 mm and spawning was observed from June to August in the morning between 0800 to 1200 (Kimura et al. 1998).

It exhibits similar colour patterns with T. purpureum, T. trilobatum, T. quinquevittatum and T. heiseri (Bernardi et al. 2004). It has been reported to be a protogynous hermaphrodite (Devlin and Nagahama 2002), however, gonadal histology has not been studied in any detail (Sadovy de Mitcheson and Liu 2008). It has been noted as one of the cleaner fishes in Japan (Kuwamura 1976).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 2 - 5.5
  Temperature range (°C): 25.894 - 27.306
  Nitrate (umol/L): 0.365 - 0.498
  Salinity (PPS): 34.192 - 34.520
  Oxygen (ml/l): 4.568 - 4.703
  Phosphate (umol/l): 0.103 - 0.284
  Silicate (umol/l): 2.957 - 4.892

Graphical representation

Depth range (m): 2 - 5.5

Temperature range (°C): 25.894 - 27.306

Nitrate (umol/L): 0.365 - 0.498

Salinity (PPS): 34.192 - 34.520

Oxygen (ml/l): 4.568 - 4.703

Phosphate (umol/l): 0.103 - 0.284

Silicate (umol/l): 2.957 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Pelagic spawner.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thalassoma cupido

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTTGCATTCGGCGCATGAGCTGGAATAGTCGGAACAGCCCTAAGCCTGCTCATTCGGGCAGAATTAAGCCAGCCCGGCGCCCTCCTTGGGGACGACCAGATTTATAACGTCATCGTCACAGCCCATGCATTCGTCATAATTTTCTTTATAGTAATGCCAATTATGATTGGGGGGTTCGGAAACTGACTAATTCCCCTGATGATTGGGGCCCCCGATATGGCCTTCCCCCGTATGAATAACATAAGCTTCTGGCTTCTTCCCCCCTCATTCCTCCTCCTCCTCGCTTCTTCTGGTGTAGAAGCGGGGGCCGGGACTGGATGAACAGTTTACCCACCCCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTGGATCTTACTATCTTCTCCTTACATCTAGCAGGTGTTTCATCAATCTTAGGTGCAATTAACTTTATCACAACCATTATTAACATAAAACCCCCAGCCATCTCTCAGTATCAGACGCCTCTTTTCGTATGAGCCGTTCTGATTACGGCAGTCCTTCTTCTACTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTAACGGACCGAAACCTTAACACCACCTTCTTTGACCCTGCTGGAGGAGGGGACCCCATTCTTTATCAGCATCTGTTCTGATTCTTTGGCCACCCAGAAAGTCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thalassoma cupido

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Shea, S., Liu, M. & Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is found in Tawian, Japan and Korea, and is likely abundant throughout its range. There are no known major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. It is likely abundant throughout its small range.

It is one of the most common shore-fish in Igaya Bay, southern Japan (Moyer 1974).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species, although it is caught in both recreational and commercial multi-species fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.

This species was recorded in the Saikai National Park, including Fukue and Wakamatsu Marine Parks, Japan (DINRAC 2007). However, most of the MPAs situated in southeast Asia are considered to be poorly managed and subjected to heavy illegal fishing pressure (Chou et al. 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Thalassoma cupido

Thalassoma cupido is a species of wrasse native to the northwestern Pacific Ocean, where it occurs from Japan to Taiwan.[2] It is an inhabitant of coral or rocky reefs and occurs at depths from 3 to 10 m (9.8 to 33 ft).[1] This species can reach 20 cm (7.9 in) total length, though most do not exceed 14 cm (5.5 in). This species can also be found in the aquarium trade and is farmed in Japan.[2]

References[edit]

  1. ^ a b Shea, S., Liu, M. & Sadovy, Y. 2010. Thalassoma cupido. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 17 November 2013.
  2. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2013). "Thalassoma cupido" in FishBase. October 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!