Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults occur on deep reef slopes rich with invertebrates such as sponges and seawhips, but young adults are occasionally seen much shallower (Ref. 48636). Usually solitary in coral and rocky reefs. Feed mainly on benthic, hard-shelled, invertebrates such as mollusks and crustaceans. Protogynous (Ref. 55080). Oviparous, distinct pairing during breeding (Ref. 205).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the Indo-Pacific from Somalia to Durban, South Africa to the Abrolhos Islands, Western Australia. In the Western Pacific, it is found from Wakayama, Japan to Bali, Indonesia and New Caledonia. It is evidently absent from the Red Sea, northwestern Indian Ocean and the east coast of Australia. The relatively poor representation of this species in collections, especially from Indonesia and southeast Asia, may be due to its occurrence on deep offshore reefs. This habitat is poorly collected at many localities (B. Russell pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: east coast of Africa to Japan, the Philippines and New Caledonia.
  • Parenti, P. and J.E. Randall 2011 Checklist of the species of the families Labridae and Scaridae: an update. Smithian Bull. 13:29-44. (Ref. 88079)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Philippines, north to Ryukyu Islands, south to Houtman Abrolhos (Western Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 12
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 550 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

55.0 cm TL (male/unsexed; (Ref. 4392)); max. published weight: 1,812 g (Ref. 4887)
  • Honebrink, R. 1990 Fishing in Hawaii: a student manual. Education Program, Division of Aquatic Resources, Honolulu, Hawaii. 79 p. (Ref. 4887)
  • Randall, J.E. 1986 Labridae. p. 683-706. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4392)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Usually solitary in coral and rocky reefs. Feeds mainly on benthic, hard-shelled, invertebrates such as molluscs and crustaceans.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Young easily identified by the unusual coloration. Adults normally have an oval shaped black saddle near the tail, but it may become indistinct in large males (Ref. 48636).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 160 m (Ref. 9823)
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This is a large species, to about 310 mm SL. It occurs on deep reef slopes rich with invertebrates such as sponges and seawhips, but young adults are occasionally seen much shallower. Specimens have been taken at depths of 8-160 m. It is usually solitary in coral and rocky reefs. It feeds mainly on benthic, hard-shelled, invertebrates such as mollusks and crustaceans. It is protogynous (DeMartini et al. 2005). Size at sex change: 38.6-40.5 cm L.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 6.5 - 40
  Temperature range (°C): 25.104 - 26.262
  Nitrate (umol/L): 0.006 - 0.397
  Salinity (PPS): 34.930 - 35.248
  Oxygen (ml/l): 4.698 - 4.799
  Phosphate (umol/l): 0.088 - 0.114
  Silicate (umol/l): 1.304 - 1.566

Graphical representation

Depth range (m): 6.5 - 40

Temperature range (°C): 25.104 - 26.262

Nitrate (umol/L): 0.006 - 0.397

Salinity (PPS): 34.930 - 35.248

Oxygen (ml/l): 4.698 - 4.799

Phosphate (umol/l): 0.088 - 0.114

Silicate (umol/l): 1.304 - 1.566
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 8 - 160m.
From 8 to 160 meters.

Habitat: reef-associated. Bodianus bilunulatus = Saddleback hogfish.  (Lacepede, 1801)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
  • Honebrink, R. 1990 Fishing in Hawaii: a student manual. Education Program, Division of Aquatic Resources, Honolulu, Hawaii. 79 p. (Ref. 4887)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Size at sex change: 38.6-40.5 cm L (Ref. 55080).
  • DeMartini, E.E., A.M. Friedlander and S.R. Holzwarth 2005 Size at sex change in protogynous labroids, prey body size distributions, and apex predator densities at NW Hawaiian atolls. Mar. Ecol. Prog. Ser. 207:259-271. (Ref. 55080)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bodianus bilunulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTTTATTTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACCGCGCTAAGTTTACTTATCCGGGCCGAACTAAGCCAACCCGGTGCTCTCCTCGGAGACGACCAGATTTATAATGTTATCGTTACGGCACACGCCTTCGTAATAATCTTCTTTATAGTAATACCCATTATGATTGGAGGTTTTGGAAACTGACTTATCCCTCTAATAATTGGGGCCCCCGACATGGCATTTCCTCGAATGAACAACATGAGCTTCTGACTCCTCCCTCCATCTTTCCTACTGCTGTTAGCCTCTTCAGGCGTAGAAGCAGGAGCTGGCACCGGATGGACCGTTTATCCGCCCCTAGCAGGCAATCTAGCCCATGCAGGAGCATCCGTCGACTTAACCATCTTCTCCCTTCACCTAGCTGGGGTCTCCTCAATTTTAGGTGCAATTAACTTTATCACCACAATTATTAACATGAAACCACCAGCCATCTCTCAATACCAAACCCCTCTCTTTGTTTGAGCCGTCCTAATTACCGCTGTACTACTTCTGCTCTCTCTCCCCGTCCTGGCCGCCGGCATTACAATGCTATTAACAGACCGAAACCTAAATACTACATTCTTTGACCCAGCCGGCGGAGGGGACCCGATTCTATACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bodianus bilunulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 60 specimens with morphological vouchers housed at National Institute of Water and Atmospheric Research, Auckland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Russell, B.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
Little is known about population and life history characteristics. It is very widespread throughout the Indo-West Pacific and is fairly common in deeper areas. This species is moderately small and sought by aquarium fish collectors, but there is no catch data. It is probably occasionally caught by hook and line and spear fishing. This species is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is no population information available for this species. This is fairly common in some areas and in deeper waters.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Honebrink, R. 1990 Fishing in Hawaii: a student manual. Education Program, Division of Aquatic Resources, Honolulu, Hawaii. 79 p. (Ref. 4887)
  • Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bodianus bilunulatus

The Tarry hogfish, Bodianus bilunulatus, is a species of wrasse native to the Indian Ocean from the African coast to the western Pacific Ocean to Japan, New Caledonia, and the Philippines. Reports of its presence in Hawaii are erroneous. This species occurs on reef slopes at depths of from 3 to 160 m (9.8 to 520 ft) with the adults being found in deeper waters than the juveniles. This species can reach 55 cm (22 in) in total length with a maximum recorded weight of 1.8 kg (4.0 lb). It is of minor importance to local commercial fisheries and is also popular as a game fish. It can also be found in the aquarium trade.[2] Other common names include: blackspot wrasse, crescent-banded hogfish, Hawaiian hogfish, saddle-back hogfish, table boss, and tuxedo hogfish.

References[edit]

  1. ^ Russell, B. 2010. Bodianus bilunulatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 01 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2008). "Bodianus bilunulatus" in FishBase. December 2008 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!